CBSE Class 12 2024 Biology Set 3 Question Paper (Paper Code: 57/3/3) is available for download. The exam was successfully conducted by CBSE on March 19 in the morning session from 10:30 AM to 1:30 PM. As per the student’s initial reactions, the CBSE Class 12 2024 Biology Set 3 Question Paper was reported as Moderate. The Ecology section was reported as Easy to Moderate, the Genetics and Evolution section as Challenging, and the Human Physiology section as Moderate.

CBSE Class 12 2024 Biology (Set 3- 57/3/3) 2024 Answer Key With Solution

Candidates can download the CBSE Class 12 Biology Question Paper with Solution and Answer Key PDFs for Set 3 Question Paper (Code: 57/3/3) using the link below.

CBSE Class 12 2024 Biology Questions with Solutions

SECTION - A
 

Question 1:

Embryo formation without fertilization is observed in some species of:

1. Maize
2. Rose
3. Mango
4. Rice

Question 2:

The origin of life according to the early Greek philosophers was transfer of unit of life from outer space to the different planets in the form of:

1. seeds
2. spores
3. gemmules
4. gametes

Question 3:

The ploidy of apomictic embryos developing from the nucellus and antipodal cells respectively would be:

1. 2n, 3n
2. 2n, n
3. 3n, 2n
4. n, 2n

Question 4:

A DNA fragment has 3000 nucleotides, out of which 160 are Guanine. How many bases having double hydrogen bonds between them does this DNA fragment possess?

1. 160
2. 320
3. 1340
4. 2680

Question 5:

After the 1850s in the post-industrialization era in England, the expected effect of natural selection on the number of white-winged moths as compared to the dark-winged moths was:

1. Less in number
2. More in number
3. Both were less in number
4. Both were more in number

Question 6:

In which of the following chromosomal disorders do the individuals have short stature, small head, furrowed tongue, and partially open mouth?

1. Turner’s syndrome
2. Down’s syndrome
3. Klinefelter’s syndrome
4. Edwards’ syndrome

Question 7:

A Snapdragon plant bearing pink-colored flowers is crossed with a Snapdragon plant bearing white-colored flowers. Their F1 progeny will show:

1. 25% Red : 50% Pink : 25% White
2. 50% Red : 50% White
3. 50% Pink : 50% White
4. 25% Pink : 50% Red : 25% White

Question 8:

A patient is suffering from the infection of the alveoli of lungs and is showing the symptoms of fever, chills, cough, headache, and bluish-colored lips and fingernails. The patient was diagnosed to be suffering from the infection of:

1. Epidermophyton
2. Entamoeba histolytica
3. Haemophilus influenzae
4. Salmonella typhi

Question 9:

The linking of the antibiotic resistance gene with the plasmid vector of Salmonella typhimurium by Stanley Cohen and Herbert Boyer was made possible by the enzyme:

1. Taq polymerase
2. DNA ligase
3. Restriction endonuclease
4. β-galactosidase

Question 10:

In an experiment, E. coli is grown in a medium containing ¹⁴NH₄Cl (¹⁴N is the light isotope of Nitrogen) followed by growing it for six generations in a medium having the heavy isotope of nitrogen (¹⁵N). After six generations, their DNA was extracted and subjected to CsCl density gradient centrifugation. Identify the correct density (Light/Hybrid/Heavy) and ratio of the bands of DNA in CsCl density gradient centrifugation:

1. Hybrid : Heavy, 1 : 16
2. Light : Heavy, 1 : 31
3. Hybrid : Heavy, 1 : 31
4. Light : Heavy, 1 : 05

Question 11:

The population growth curve applicable for a population of beetles growing in nature under unlimited resource conditions available to them will be:

1. Population density decreases linearly with time.
2. Sigmoid growth curve.
3. Exponential growth curve.
4. Population density increases linearly with time.

Question 12:

Which one of the following represents the correct annealing of primers to the DNA to be amplified in the PCR?

1. Both primers are complementary to the same strand.
2. Primers anneal in a non-complementary manner.
3. Both primers are complementary to the opposite strands at their ends.
4. Primers anneal perfectly in opposite directions to the DNA template.

Question 13:

Assertion (A): The zygote gives rise to heart-shaped embryo and subsequently proembryo in most angiosperms.
Reason (R): The zygote is present at the micropylar end of the embryo sac and develops into an embryo.

1. Both Assertion (A) and Reason (R) are true, and Reason (R) is the correct explanation of Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Question 14:

Assertion (A): The stirrer facilitates the even mixing of oxygen availability in a bioreactor.
Reason (R): Stirred-tank bioreactors generally have a flat base.

1. Both Assertion (A) and Reason (R) are true, and Reason (R) is the correct explanation of Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Question 15:

Assertion (A): Primary transcripts in eukaryotes are subjected to splicing to remove the introns.
Reason (R): Primary transcripts contain both exons and introns, and the introns are non-functional in eukaryotes.

1. Both Assertion (A) and Reason (R) are true, and Reason (R) is the correct explanation of Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Question 16:

Assertion (A): The chronic use of alcohol by a person leads to cirrhosis.
Reason (R): Alcohol addiction at times becomes the cause of mental and financial distress to the entire family of the addicted person.

1. Both Assertion (A) and Reason (R) are true, and Reason (R) is the correct explanation of Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

SECTION B

Question 17:

Amniocentesis is a very useful and important technique, but due to some reason there is a statutory ban on amniocentesis. Justify this statement.

Question 18:

With reference to the set-ups (A, B, and C) given below, of the electrophoretic separation of a mixture of DNA fragments of varied lengths, answer the questions that follow:

(a) In which one of the two Set-ups, A or B, would you see the DNA fragments separated and why?

(b) In Set-up C, which one of the two, I/II, are the bands of longer fragments of DNA? Justify your answer.

Question 19:

Consider the given data of a hypothetical small portion of mRNA that codes for a functional polypeptide chain and answer the questions that follow:
mRNA Sequence: 5’– UCAUUAACCCAGAUCUUCUUAAAAGGA –3’

(a) How many amino acids will be formed from the given codons, if substitution of ‘U’ by ‘C’ takes place at the 5th codon? Explain your answer.

(b) Write the number of amino acids that would be in the polypeptide synthesised by a similar mRNA as above, where in the fourth codon instead of ‘C’ there is ‘U’. Justify your answer.

Question 20:

Write important features of ‘humus’ formed during the decomposition cycle in a terrestrial ecosystem.

OR

(b) (i) Graphically represent the relationship between species richness and area on a log-log scale for bats and fishes.

(ii) Write the equation for the relationship as on a logarithmic scale.

Question 21:

What is a vaccine? Write the basis on which it acts when administered in the body.

SECTION C

Question 22:

Draw a T.S. of a mature anther of an angiosperm. Label its any three wall layers and mention their functions.

Question 23:

A population of snakes lived in a desert with brown sand. Study the drawings given below showing the change in the population from ‘one’ to ‘two’ over time and answer the question that follows. Brown snakes and Grey snakes are represented by alleles A/a (Dominant/recessive).

(a) If the frequency of the recessive trait is 9% in population-one, work out the frequency of homozygous dominant and heterozygous dominant snakes.

(b) Name the mechanism of evolution that must have operated so that population-two evolved from population-one.

Question 24:

(a) (i) List two major reasons for using cow-dung in a biogas plant instead of using domestic sewage.

(ii) Mention one use of the unspent slurry of the biogas plant.

OR

(b) Name the bioactive molecule and its microbial source generally used by physicians to treat the patients for:

• (i) Myocardial infarction:

• (ii) High blood cholesterol level:

• (iii) Organ transplantation:

Question 25:

Differentiate between spermatogenesis and oogenesis in humans on the basis of the following:

(a) When the process is initiated.

(b) Number of functional gametes produced per primary spermatocyte/oocyte.

(c) Specific site at which meiosis II is completed.

Question 26:

Three crosses were carried out in pea plants with respect to flower colour violet/white (V/v) and flower position axial/terminal (A/a). Study in the table the crosses ‘a’, ‘b’ and ‘c’ where parental phenotypes and their F1 progeny phenotypes are given. Find the genotypes of each of the parental pairs of crosses ‘a’, ‘b’ and ‘c’.

Question 27:

Explain any three roles of ‘predation’ in an ecosystem with the help of suitable examples.

Question 28:

(a) Give the scientific name of the bacteria widely used in biotechnology to create a GM cotton crop resistant to bollworm attacks.

Question 28:

(b) Explain how GM cotton crop is able to resist insect attacks.

SECTION D

Question 29:

In recombinant DNA technology, restriction enzymes are used as they recognize and cut DNA within a specific recognition sequence. BamHI is one such restriction enzyme which binds at the recognition sequence 5’-G↓GATCC-3’ and cleaves this sequence between G and G on each strand, whereas AluI binds at the recognition sequence 5’-AG↓CT-3’ and cleaves these sequences between G and C on each strand.

(a) If AluI is used to cut the given DNA strand, how many DNA fragments would be formed? Write the sequence of each fragment formed with its polarity.

(b) Which one of the two restriction enzymes BamHI or AluI will preferably be used on the same given DNA strand to make a recombinant DNA molecule and why?

(c) After binding to the two strands of the double helix DNA, where specifically does the restriction enzyme act to cut the two strands of DNA? Write the specific term used for the specific nucleotide sequences of DNA recognised by a restriction endonuclease.

OR

(c) Write the specific sequence of DNA segment recognised by the restriction endonuclease EcoRI.

Question 30:

Study the figures given below that depict the comparative age distribution of human populations in Sweden and Rwanda (International Data Base 2003) and answer the questions that follow:

(a) What can be inferred from the very broad base of Rwanda’s age pyramid? Support your answer with the data provided in the figure.

(b) Sweden has an age distribution that is approximately of the same width near its base as at the apex. What does this indicate?

(c) Name the type of age pyramid shown above for Sweden.

(d) Name the type of age pyramid shown above for Rwanda.

Question 31:

(a) “The influence of both the alleles in a heterozygous state is clearly expressed in codominance.” Explain with the help of inheritance of ABO blood group in humans.

OR

(b) (i) Explain the mechanism of switching ‘on’ of the structural genes of lac operon.

(ii) “Regulation of lac operon is referred to be negatively regulated.” Justify giving a reason.

Question 32:

(a) Describe the life cycle of Plasmodium from the time it enters the human body till a female Anopheles mosquito bites an infected person.

Question 32:

(b) Mention the two events of Plasmodium life cycle that occur within the female Anopheles body.

OR

(b) (i) Write two differences between malignant tumor and benign tumor.

(ii) Explain any three diagnostic techniques for the detection of cancer.

Question 33:

(a) (i) Explain any four devices that flowering plants have developed to encourage cross-pollination.

(ii) Why do plants discourage self-pollination? State any one reason.

OR

(b) Explain the ovarian and uterine events taking place along with the role of pituitary and ovarian hormones, during menstrual cycle in a normal human female under the following phases:

(i) Follicular phase/proliferative phase

(ii) Luteal phase/secretory phase

(iii) Menstrual phase