
CBSE Class 12 Biology Question Paper with Solutions PDF Set 1 – 57/4/1 is now available for download. CBSE conducted the Class 12 Biology examination on March 25, 2025. The question paper consists of 33 questions carrying a total of 70 marks. Section A includes 16 MCQs for 1 mark each, Section B contains 5 very short-answer questions for 2 marks each, Section C comprises 7 short-answer questions for 3 marks each, Section D comprises 2 Case-based questions carries 4 marks each and Section E comprises 3 long-answer questions carries 5 marks each.
| CBSE Class 12 Biology Question Paper with Solutions | Download PDF | Check Solutions |

In its extended ‘beads-on-string’ form of chromatin, the ‘beads’ in the string represent :
In the eukaryotic nucleus, DNA is packaged by wrapping around proteins to form a structure called chromatin.
The most basic level of chromatin organization is often described as a 'beads-on-string' structure.
In this model, the 'beads' represent the core structural units known as nucleosomes.
Each nucleosome consists of approximately 147 base pairs of DNA wrapped around a core of eight histone proteins (a histone octamer).
The 'string' connecting these nucleosomes is a stretch of DNA called linker DNA.
Therefore, the beads in the chromatin string are nucleosomes.
Quick Tip: Remember the composition of the histone octamer: two molecules each of H2A, H2B, H3, and H4. The H1 histone is not part of the octamer; it acts as a linker histone that helps in further compaction of the chromatin fiber.
Given below are a few statements with reference to the accessory ducts of the human male reproductive system :
(i) The seminiferous tubules of the testes open into rete testis then into the vas deferens.
(ii) The vasa efferentia leave the testes and open into the epididymis.
(iii) The epididymis leads to vas deferens that ascends into the abdomen.
(iv) The vas deferens receives a duct from the prostrate gland and opens into the urethra as ejaculatory duct.
(v) The urethra originates from the urinary bladder and extends through the penis to its external opening, urethral meatus.
Choose the option with all true statements from the given options :
Let's evaluate each statement regarding the path of sperm through the male accessory ducts.
Statement (i) is incorrect. The seminiferous tubules open into the rete testis, which in turn leads to the vasa efferentia, not directly to the vas deferens.
Statement (ii) is correct. The vasa efferentia are a series of ducts that transport sperm from the rete testis to the epididymis.
Statement (iii) is correct. The epididymis is a long, coiled tube where sperm mature and are stored. It is continuous with the vas deferens, which ascends into the pelvic cavity.
Statement (iv) is incorrect. The vas deferens joins with the duct from the seminal vesicle, not the prostate gland, to form the ejaculatory duct.
Statement (v) is correct. The urethra is the common passage for urine and semen, originating from the urinary bladder and extending to the external urethral meatus.
Based on the analysis, the true statements are (ii), (iii), and (v).
Quick Tip: To remember the path of sperm, use the mnemonic "SEVEN UP": Seminiferous tubules \(\rightarrow\) Epididymis \(\rightarrow\) Vas deferens \(\rightarrow\) Ejaculatory duct \(\rightarrow\) N(nothing) \(\rightarrow\) Urethra \(\rightarrow\) Penis. Note that this mnemonic skips the rete testis and vasa efferentia, which are between the seminiferous tubules and the epididymis.
The substrate used during DNA replication by the enzyme DNA-dependent DNA polymerase is :
DNA replication is the process of synthesizing new DNA strands, catalyzed by DNA-dependent DNA polymerase.
This enzyme uses deoxyribonucleoside triphosphates (dNTPs) as its substrates.
The dNTPs (dATP, dGTP, dCTP, dTTP) serve a dual purpose in the reaction.
First, they act as the source of the deoxyribonucleotides that are added to the growing DNA chain.
Second, the hydrolysis of the two terminal phosphate groups (pyrophosphate) from the deoxyribonucleoside triphosphate provides the energy required for the formation of the phosphodiester bond.
Therefore, the correct term for the substrate is deoxyribonucleoside triphosphate.
Quick Tip: Carefully distinguish between "nucleoside" and "nucleotide". A nucleoside = sugar + base. A nucleotide = sugar + base + phosphate. The active substrates for DNA synthesis are deoxyribonucleoside triphosphates, which become deoxyribonucleotides (monophosphates) after being incorporated into the DNA chain.
In the given pedigree chart, a cross between a normal couple resulted in a son who was haemophilic and a normal daughter. In course of time, when the daughter was married to a normal man, to their surprise the grandson was also haemophilic. Choose the option that indicates the correct inheritance of trait in the above pedigree chart :
Let's analyze the inheritance pattern from the pedigree chart and the description.
Step 1: In the first generation, two phenotypically normal (unaffected) parents have an affected son. This pattern, where the trait "skips" a generation, is characteristic of a recessive trait. This rules out dominant traits (A and B).
Step 2: The trait is haemophilia, which is a well-known X-linked (sex-linked) recessive disorder. Let's verify this. Let X\(^H\) be the normal allele and X\(^h\) be the allele for haemophilia.
Step 3: The first-generation parents are normal, but their son is affected (X\(^h\)Y). The son receives the Y chromosome from his father and the X chromosome from his mother. Therefore, the mother must be a carrier (X\(^H\)X\(^h\)) and the father is normal (X\(^H\)Y). This is consistent.
Step 4: Their daughter is normal. She receives X\(^H\) from her father. From her carrier mother (X\(^H\)X\(^h\)), she has a 50% chance of inheriting X\(^H\) and a 50% chance of inheriting X\(^h\). So her genotype could be X\(^H\)X\(^H\) or X\(^H\)X\(^h\).
Step 5: This daughter marries a normal man (X\(^H\)Y) and has an affected son (grandson, X\(^h\)Y). For her to have an affected son, she must have passed on the X\(^h\) allele. Therefore, she must be a carrier (X\(^H\)X\(^h\)).
The entire pattern perfectly matches the inheritance of a sex-linked recessive trait.
Quick Tip: Key features of X-linked recessive inheritance in pedigrees: the disorder is more common in males, it is never passed from father to son, and it often skips generations, being passed from an affected grandfather to his grandsons through his carrier daughter.
In which of the following human diseases does the body's self-defence mechanism attack self-cells ?
A disease in which the body's own immune system attacks its own cells and tissues is called an autoimmune disease.
Let's examine the options provided.
(A) Thalassemia is a genetic blood disorder caused by a defect in the synthesis of globin chains of hemoglobin. It is not an autoimmune disease.
(B) Phenylketonuria is an inborn error of metabolism, a genetic disorder, which leads to the accumulation of the amino acid phenylalanine. It is not an autoimmune disease.
(C) Filariasis is an infectious disease caused by a parasitic nematode worm. The immune system attacks the pathogen, not self-cells.
(D) Rheumatoid arthritis is a chronic inflammatory disorder that is a classic example of an autoimmune disease. The immune system attacks the synovium, the lining of the membranes that surround the joints.
Therefore, rheumatoid arthritis is the correct answer.
Quick Tip: Autoimmunity is essentially a case of "mistaken identity" by the immune system, where it fails to distinguish between 'self' and 'non-self'. Other common examples include Myasthenia Gravis, Multiple Sclerosis, and Type 1 Diabetes.
Select the statements that are true for a typical dicotyledonous embryo from the given options.
(i) It consists of an embryonal axis and scutellum.
(ii) The portion of embryonal axis above the level of cotyledon is epicotyl.
(iii) The portion of embryonal axis below the level of cotyledon is coleorhiza.
(iv) The lower end of the embryo has radicle covered with a root cap.
Let us analyze each statement about the structure of a dicot embryo.
Statement (i) is incorrect. A dicot embryo has an embryonal axis and two cotyledons. The scutellum is the large, shield-shaped cotyledon found in a monocot embryo (e.g., grass).
Statement (ii) is correct. The embryonal axis has two main parts. The portion above the level of the cotyledons is the epicotyl, which terminates in the plumule (embryonic shoot).
Statement (iii) is incorrect. The portion of the embryonal axis below the level of the cotyledons is the hypocotyl. The coleorhiza is an undifferentiated sheath that encloses the radicle in a monocot embryo.
Statement (iv) is correct. The lower end of the embryonal axis is the radicle (embryonic root), which is protected by a structure called the root cap.
Therefore, the correct statements are (ii) and (iv).
Quick Tip: To avoid confusion, remember that specialized sheaths like the coleoptile (protecting the plumule) and coleorhiza (protecting the radicle), as well as the scutellum, are characteristic features of monocot embryos, not dicot embryos.
About 15 mya during human evolution, the primates which used to walk like gorillas and chimpanzees were :
Let's consider the timeline of human evolution.
About 15 million years ago (mya), during the Miocene epoch, primates known as Dryopithecus and Ramapithecus were present.
Fossil evidence suggests they were hairy and walked like modern-day gorillas and chimpanzees, using a form of knuckle-walking.
Dryopithecus is considered to be more ape-like, while Ramapithecus was considered more man-like, though its place in the direct human line is now debated.
The other options are from a much later period. Australopithecines appeared around 4 mya, Homo habilis around 2.5 mya, Homo erectus around 1.8 mya, and Neanderthals and Homo sapiens are even more recent.
Therefore, the correct answer for the 15 mya timeframe is Dryopithecus and Ramapithecus.
Quick Tip: Associate key time periods with major hominids: 15 mya (Dryopithecus/Ramapithecus), 3-4 mya (Australopithecines, early bipedalism), 2 mya (Homo habilis, first toolmakers), 1.5 mya (Homo erectus, used fire), < 1 mya (Neanderthals, Homo sapiens).
Use the given information to select the amino acid attached to the 3' end of tRNA during the process of translation, if the coding strand of the structural gene being transcribed has the nucleotide sequence TAC.
Codons for the amino acids :
Step 1: The given DNA sequence is from the coding strand: 5'-TAC-3'.
Step 2: During transcription, the mRNA is synthesized using the template strand as a guide. The mRNA sequence is complementary to the template strand.
Step 3: A key principle is that the mRNA sequence is identical to the coding strand sequence, with the exception that Thymine (T) in DNA is replaced by Uracil (U) in RNA.
Step 4: So, if the coding strand is 5'-TAC-3', the corresponding mRNA codon will be 5'-UAC-3'.
Step 5: According to the provided table of codons, the mRNA codon UAC codes for the amino acid Tyrosine.
Step 6: The tRNA molecule that binds to the UAC codon will carry the amino acid Tyrosine to the ribosome for protein synthesis.
Therefore, the amino acid attached to the tRNA will be Tyrosine.
\begin{quicktipbox
A common mistake is to transcribe the coding strand instead of the template strand. Remember this shortcut: the mRNA sequence is the same as the DNA coding strand, just change every 'T' to a 'U'.
\end{quicktipbox Quick Tip: A common mistake is to transcribe the coding strand instead of the template strand. Remember this shortcut: the mRNA sequence is the same as the DNA coding strand, just change every 'T' to a 'U'.
The technique for the early detection of a disease based on the principle of antigen-antibody interaction is :
The question asks for a detection technique based on the principle of antigen-antibody interaction.
Let's analyze the given techniques:
(A) RNAi (RNA interference) is a biological process for silencing gene expression. It is not based on antigen-antibody interaction.
(B) EST (Expressed Sequence Tags) are short subsequences of transcribed DNA used to identify gene transcripts. This is a genomic tool.
(C) PCR (Polymerase Chain Reaction) is a technique used to amplify a specific segment of DNA. It detects the presence of a pathogen's nucleic acid, but not through antigen-antibody interaction.
(D) ELISA (Enzyme-Linked Immunosorbent Assay) is a widely used immunological assay. Its fundamental principle is the specific binding between an antigen and its corresponding antibody. It can be used to detect either the presence of an antigen (like a viral protein) or an antibody (produced by the body in response to an infection).
Thus, ELISA is the correct technique.
\begin{quicktipbox
Remember the core principle of each technique: PCR amplifies DNA; RNAi silences genes; ELISA detects proteins (antigens/antibodies). When a question mentions "antigen-antibody interaction," ELISA is almost always the answer.
\end{quicktipbox Quick Tip: Remember the core principle of each technique: PCR amplifies DNA; RNAi silences genes; ELISA detects proteins (antigens/antibodies). When a question mentions "antigen-antibody interaction," ELISA is almost always the answer.
The correct depiction of the experiment performed by Matthew Meselson and Franklin Stahl to prove that DNA replicates semi-conservatively on separation of DNA by centrifugation after 40 minutes is :
Meselson and Stahl's experiment used heavy nitrogen (\(^{15}\)N) to label the parent DNA.
Step 1: At the start (time = 0 minutes), all DNA was heavy (\(^{15}\)N/\(^{15}\)N) and formed a single band at the bottom of the centrifuge tube.
Step 2: After one generation (time = 20 minutes) in a medium with light nitrogen (\(^{14}\)N), all DNA molecules were hybrids (\(^{15}\)N/\(^{14}\)N). This resulted in a single band at an intermediate density. This corresponds to diagram (C).
Step 3: After a second generation (time = 40 minutes), the hybrid DNA molecules replicate again in the \(^{14}\)N medium. Each of the two hybrid molecules from the first generation produces one new hybrid molecule (\(^{15}\)N/\(^{14}\)N) and one new light molecule (\(^{14}\)N/\(^{14}\)N).
Step 4: This results in a total of four DNA molecules: two are hybrid and two are light.
Step 5: When centrifuged, this mixture separates into two distinct bands: one at the intermediate density (for the hybrid DNA) and one at the light density (for the light DNA).
Step 6: Since there are equal amounts of hybrid and light DNA (2 molecules each), the two bands should have equal intensity or thickness. This is correctly depicted in diagram (A).
\begin{quicktipbox
To predict the results for any generation in the Meselson-Stahl experiment, remember that there will always be exactly two hybrid (\(^{15}\)N/\(^{14}\)N) molecules. The rest of the molecules (\(2^n - 2\), where n is the number of generations) will be light (\(^{14}\)N/\(^{14}\)N).
\end{quicktipbox Quick Tip: To predict the results for any generation in the Meselson-Stahl experiment, remember that there will always be exactly two hybrid (\(^{15}\)N/\(^{14}\)N) molecules. The rest of the molecules (\(2^n - 2\), where n is the number of generations) will be light (\(^{14}\)N/\(^{14}\)N).
Bioactive molecule Cyclosporin A used for human welfare is derived from :
Let's identify the source of Cyclosporin A by examining the given microorganisms.
(A) Propionibacterium sharmanii is a bacterium used in the ripening of Swiss cheese and production of Vitamin B12.
(B) Monascus purpureus is a fungus used to produce statins, which are blood-cholesterol lowering agents.
(C) Trichoderma polysporum is a fungus from which the bioactive molecule Cyclosporin A is derived.
Cyclosporin A is a potent immunosuppressive agent, widely used in organ transplant patients to prevent organ rejection.
(D) Aspergillus niger is a fungus used for the commercial production of citric acid.
Therefore, the correct source for Cyclosporin A is Trichoderma polysporum.
Quick Tip: Create a table to memorize important microbes and their commercial products: Statins (Monascus), Cyclosporin A (Trichoderma), Citric Acid (Aspergillus), and Swiss Cheese (Propionibacterium). This helps in quick recall during exams.
In a pea plant (Pisum sativum) inflated pod shape is dominant over constricted pod shape. The expected ratio of phenotypes of the offspring in a cross between both the parents with heterozygous inflated pod shape will be :
Step 1: Define the alleles. Let 'I' be the dominant allele for inflated pod shape and 'i' be the recessive allele for constricted pod shape.
Step 2: Determine the genotype of the parents. Both parents have a "heterozygous inflated pod shape," so their genotype is Ii.
Step 3: Set up the cross: Ii \(\times\) Ii.
Step 4: Determine the possible gametes from each parent. Each parent can produce two types of gametes: I and i.
Step 5: Use a Punnett square to find the genotypes of the offspring.
\begin{tabular{c|c|c|
& \multicolumn{1{c{I & \multicolumn{1{c{i
\cline{2-3
I & II & Ii
\cline{2-3
i & Ii & ii
\cline{2-3
\end{tabular
Step 6: Analyze the genotypes and corresponding phenotypes of the offspring.
- Genotype ratio is 1 II : 2 Ii : 1 ii.
- Phenotypes: II (Inflated), Ii (Inflated), ii (constricted).
Step 7: Calculate the phenotype ratio. There are 3 offspring with the inflated phenotype (II, Ii, Ii) and 1 offspring with the constricted phenotype (ii).
The expected ratio of phenotypes is 3 (Inflated) : 1 (constricted).
Quick Tip: A monohybrid cross between two heterozygous parents (like Tt \(\times\) Tt or Ii \(\times\) Ii) will always yield a genotypic ratio of 1:2:1 (homozygous dominant : heterozygous : homozygous recessive) and a phenotypic ratio of 3:1 (dominant phenotype : recessive phenotype).
For Questions number 13 to 16, two statements are given – one labelled as Assertion (A) and the other labelled as Reason (R). Select the correct answer to these questions from the codes (A), (B), (C) and (D) as given below.
(A) Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
(B) Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
(C) Assertion (A) is true, but Reason (R) is false.
(D) Assertion (A) is false, but Reason (R) is true.
Assertion (A) : The meristems are grown ‘in vitro’ to obtain virus-free plants from an infected plant.
Reason (R) : If the plant is infected with a virus, the roots and the stems are free of virus.
Let's analyze the Assertion (A).
Assertion (A) states that meristems (like apical and axillary) are cultured in vitro to get virus-free plants. This is a standard technique in plant biotechnology called meristem culture. The meristematic tissues are actively dividing and are usually devoid of viruses, even in an infected plant. Thus, Assertion (A) is true.
Now let's analyze the Reason (R).
Reason (R) states that in an infected plant, the roots and stems are free of virus. This is incorrect. Viruses are systemic pathogens that typically spread throughout the entire plant, including roots, stems, and leaves, via the vascular tissues (phloem). Therefore, Reason (R) is false.
Since Assertion (A) is true and Reason (R) is false, the correct option is (C).
Quick Tip: Remember that while a virus can infect almost all parts of a plant, the apical and axillary meristems are generally virus-free. This is because the rate of cell division in the meristem is faster than the rate of viral movement and replication.
Assertion (A) : A person infected with malaria suffers from chill and high fever, recurring every three or four days.
Reason (R) : The parasite attacks the RBC resulting in their rupture and release of haemozoin.
Let's evaluate Assertion (A).
Assertion (A) describes the classic symptoms of malaria: cyclical episodes of chills and high fever. The cycle of fever recurrence (every 3-4 days) corresponds to the life cycle of the Plasmodium parasite. This statement is factually correct.
Now, let's evaluate Reason (R).
Reason (R) states that the malarial parasite (Plasmodium) infects red blood cells (RBCs), multiplies within them, and eventually causes them to rupture. Upon rupture, a toxic substance called haemozoin is released into the bloodstream. This statement is also factually correct.
Finally, let's link the Assertion and Reason.
The release of the toxin haemozoin from the ruptured RBCs is the direct trigger for the immune response that causes the characteristic chills and high fever described in the Assertion. The synchronized rupture of a large number of RBCs leads to the cyclical nature of the symptoms.
Therefore, both Assertion (A) and Reason (R) are true, and Reason (R) is the correct explanation for Assertion (A).
Quick Tip: Associate the symptoms of malaria (chills and fever) directly with the release of the toxin haemozoin upon the rupture of Red Blood Cells (RBCs). The cyclical nature of the fever is tied to the synchronized life cycle of the parasite.
Assertion (A) : ‘Saheli’, an oral contraceptive inhibits ovulation and increases phagocytosis of sperms.
Reason (R) : It is a non-steroidal preparation.
Let's analyze Assertion (A).
Assertion (A) claims that 'Saheli' inhibits ovulation and increases phagocytosis of sperms. This is incorrect. 'Saheli' (Centchroman) is a Selective Estrogen Receptor Modulator (SERM). Its primary mechanism of action is to prevent the implantation of the fertilized ovum in the uterus. It does not consistently inhibit ovulation, which is the primary mechanism of conventional steroidal contraceptive pills. Thus, Assertion (A) is false.
Now, let's analyze Reason (R).
Reason (R) states that 'Saheli' is a non-steroidal preparation. This is a well-known fact. It was developed at the Central Drug Research Institute (CDRI) in Lucknow, India, as the world's first and only non-steroidal oral contraceptive pill. Thus, Reason (R) is true.
Since Assertion (A) is false and Reason (R) is true, the correct option is (D).
Quick Tip: Remember the key difference: Conventional birth control pills are steroidal and primarily work by inhibiting ovulation. 'Saheli' is non-steroidal and primarily works by preventing implantation. This distinction is crucial for answering questions about contraceptive methods.
Assertion (A) : ABO blood grouping in humans is an example of multiple allelism.
Reason (R) : More than two genes in a population govern the same character in ABO blood grouping in humans.
Let's evaluate Assertion (A).
Assertion (A) states that ABO blood grouping is an example of multiple allelism. This is correct. Multiple allelism is a condition where more than two alleles of a single gene exist within a population. For the ABO blood group system, the single gene 'I' has three alleles: I\(^A\), I\(^B\), and i. Thus, Assertion (A) is true.
Now, let's evaluate Reason (R).
Reason (R) states that more than two genes govern the character. This is incorrect. The ABO blood group is controlled by a single gene (the 'I' gene). The phenomenon where a character is controlled by multiple genes is called polygenic inheritance, not multiple allelism. The reason confuses the concept of multiple alleles of a single gene with multiple genes. Thus, Reason (R) is false.
Since Assertion (A) is true and Reason (R) is false, the correct option is (C).
Quick Tip: Do not confuse multiple allelism with polygenic inheritance. Multiple Allelism: One gene has more than two alleles in a population (e.g., ABO blood group gene I has alleles I\(^A\), I\(^B\), i). Polygenic Inheritance: One trait is controlled by multiple genes (e.g., human skin color).
(a) Explain how the immunity of a person is affected if there is atrophy (degeneration) of the thymus gland at an early stage of life.
The thymus gland is a primary lymphoid organ essential for the proper functioning of the immune system.
It is the site where immature T-lymphocytes mature and differentiate into functional, antigen-sensitive T-cells.
These mature T-lymphocytes are responsible for cell-mediated immunity (CMI).
If the thymus gland degenerates at an early stage, the production and maturation of T-lymphocytes will be severely impaired.
This leads to a deficient CMI, making the person highly vulnerable to pathogens, particularly those that are dealt with by T-cells, such as viruses, fungi, and some intracellular bacteria.
Additionally, since helper T-cells are required to activate B-cells for antibody production, humoral immunity would also be weakened.
Quick Tip: Remember the roles of primary lymphoid organs: Bone marrow is the site of production of all blood cells including lymphocytes and maturation of B-cells. The thymus is solely for the maturation of T-cells. Atrophy of the thymus primarily affects T-cell immunity.
(b) (i) What are interferons ? Explain their role in providing immunity to a person.
(ii) Which category of innate immunity defence barrier can interferons be classified into ?
(i) Interferons are a type of protein called cytokines that are produced by cells infected with a virus.
These proteins do not save the infected cell but are released to act as a warning signal to nearby healthy cells.
Interferons bind to the surface of neighboring uninfected cells and stimulate them to produce antiviral proteins.
These antiviral proteins inhibit viral replication, thus protecting these neighboring cells from being infected by the virus.
(ii) In the context of innate immunity, interferons are classified as part of the cytokine barrier.
Quick Tip: Innate immunity is composed of four types of barriers: 1. Physical (e.g., skin, mucus) 2. Physiological (e.g., stomach acid, fever) 3. Cellular (e.g., phagocytes like neutrophils, macrophages) 4. Cytokine (e.g., interferons) Memorizing these four categories helps in classifying different components of the innate immune system.
Assume that the given mRNA (start site is not depicted) is theoretically translated in two reading frames.
Frame 1: 5′ – CUCGCUUGCCGAUCAAGGGUUA – 3'
Frame 2: 5'– GUGGCACUCAGUCCUUAAUGGCG – 3'
How many amino acids will be specified in case (a) and case (b) on translation ? Justify your answer.
The genetic code is read in non-overlapping triplets of nucleotides called codons, where each codon specifies an amino acid.
Case (a) - Frame 1:
The mRNA sequence is 5'–CUCGCUUGCCGAUCAAGGGUUA–3'.
The length of this mRNA strand is 22 nucleotides.
To find the number of codons, we divide the total length by 3: 22 / 3 = 7 with a remainder of 1.
This means there are 7 complete codons (CUC, GCU, UGC, CGA, UCA, AGG, GUU) and one incomplete nucleotide (A) at the end.
Therefore, 7 amino acids will be specified.
Case (b) - Frame 2:
The mRNA sequence is 5'–GUGGCACUCAGUCCUUAAUGGCG–3'.
The length of this mRNA strand is 24 nucleotides, which forms 8 complete codons.
The codons are: GUG, GCA, CUC, AGU, CCU, UAA, UGG, GCG.
The sixth codon in this sequence is UAA, which is a termination or stop codon.
Translation of mRNA stops when a stop codon is reached.
Therefore, only the first five codons (GUG, GCA, CUC, AGU, CCU) will be translated into amino acids.
Thus, 5 amino acids will be specified.
Quick Tip: Always check for stop codons (UAA, UAG, UGA) when asked to determine the length of a polypeptide chain from an mRNA sequence. The translation process terminates at the stop codon, and the stop codon itself does not code for an amino acid.
(a) Explain what is meant by the term MTP. What was the main reason to legalize MTP by the Government of India ?
MTP stands for Medical Termination of Pregnancy.
It refers to the voluntary or intentional termination of a pregnancy before the fetus becomes viable (before full term). It is also commonly known as induced abortion.
The main reason for the legalization of MTP by the Government of India under the MTP Act of 1971 was to reduce the high incidence of maternal morbidity and mortality.
This was primarily due to a large number of unsafe, illegal abortions being performed by untrained individuals in unhygienic conditions.
Legalization was a crucial step to provide access to safe and legal abortion services, thereby protecting the health of women.
Quick Tip: Remember that while MTP is legal in India, it is subject to certain conditions and timeframes outlined in the MTP Act. Its purpose is to ensure safe abortion and not as a method of population control.
(b) Name any two STIs which might occur in a human female. State its two early symptoms.
Two Sexually Transmitted Infections (STIs) that can occur in a human female are:
1. Gonorrhoea
2. Chlamydiasis
Two common early symptoms of these STIs in females include:
1. Abnormal vaginal discharge, which might have an unusual odor, color (e.g., yellow, green), or consistency.
2. A burning sensation or pain during urination (dysuria).
Other possible symptoms include itching in the genital area and lower abdominal pain. However, many STIs can be asymptomatic in females in the early stages.
Quick Tip: It is important to remember that many STIs, especially in females, can be asymptomatic (show no symptoms) initially. This is why regular screening is important for sexually active individuals, as untreated STIs can lead to serious complications like Pelvic Inflammatory Disease (PID) and infertility.
The basic scheme of the essential steps involved in the process of recombinant DNA technology is summarized below in the form of a flow diagram. Study the given flow diagram and answer the questions that follow.
(a) Name the enzyme used in Step-1 to join the cut plasmid and alien DNA.
(b) State the technical term used for Step-3.
(c) Justify the use of same Restriction Enzyme EcoR I to cut both the vector DNA and the alien DNA.
(a) The enzyme used to join the cut plasmid (vector) and the alien DNA fragment is DNA Ligase. It acts like a molecular glue, forming phosphodiester bonds to seal the gaps in the DNA backbone.
(b) Step-3 describes the transfer of the recombinant DNA molecule into a host cell (E. coli). The technical term for this process of introducing foreign DNA into a bacterium is Transformation.
(c) Using the same restriction enzyme (EcoR I) for both the vector and the alien DNA is crucial for the following reason:
Restriction enzymes like EcoR I cut the DNA in a way that creates single-stranded overhangs known as "sticky ends".
When the same enzyme is used, the sticky end of the vector DNA is complementary to the sticky end of the alien DNA.
This complementarity allows the two DNA fragments to pair up (anneal) through hydrogen bonds, facilitating the action of DNA ligase to create a stable recombinant DNA molecule.
Quick Tip: Remember the three key tools of recombinant DNA technology: 1. Restriction Enzymes: To cut DNA at specific sites (molecular scissors). 2. Cloning Vector: To carry and replicate the desired DNA fragment (e.g., plasmid). 3. DNA Ligase: To join DNA fragments together (molecular glue).
(a) Explain how the interaction between sea anemone and clownfish is one of the best examples of commensalism in nature.
Commensalism is a type of population interaction where one species benefits, and the other species is neither harmed nor benefited (+/0 interaction).
The relationship between the clownfish and the sea anemone is a classic example of this.
The sea anemone possesses stinging tentacles (nematocysts) which it uses to paralyze prey and defend against predators.
The clownfish has a protective layer of mucus on its skin, which makes it immune to the stings of the anemone.
Benefit to the clownfish (+): By living among the anemone's tentacles, the clownfish gains effective protection from its predators, which are deterred by the stings.
Effect on the sea anemone (0): The sea anemone does not derive any significant benefit from the clownfish's presence, nor is it harmed.
Since one partner benefits and the other is unaffected, this interaction is defined as commensalism.
Quick Tip: To remember the different types of population interactions, use symbols: - Mutualism (+/+) : Both benefit. - Commensalism (+/0) : One benefits, other unaffected. - Predation/Parasitism (+/-) : One benefits, other is harmed. - Amensalism (-/0) : One is harmed, other unaffected. - Competition (-/-) : Both are harmed.
(b) Correctly depict (also indicate the trophic level) and describe the ecological pyramid of biomass in sea with 40 standing crop of phytoplankton supporting 90 standing crop of zooplankton which further supports 120 small fishes.
Description:
The ecological pyramid of biomass for this marine food chain is inverted.
This occurs because the standing crop (the biomass present at a particular time) of producers (phytoplankton) is less than the standing crop of the primary consumers (zooplankton) that feed on them.
This phenomenon is characteristic of many aquatic ecosystems. It is possible because the producers (phytoplankton) have a very short life-span and an extremely high rate of reproduction and turnover.
They are consumed as fast as they are produced, so their biomass at any given moment is small, but they can support a larger biomass of zooplankton over time. The same principle applies to the next trophic level.
Depiction of the Inverted Pyramid:
The pyramid is drawn with the base representing the producers and successive levels on top. The width of each level corresponds to the standing crop.
\fbox{
\begin{minipage{4cm
\centering
T3: Small fishes (Secondary Consumers)
Biomass = 120
\end{minipage
\fbox{
\begin{minipage{5cm
\centering
T2: Zooplankton (Primary Consumers)
Biomass = 90
\end{minipage
\fbox{
\begin{minipage{3cm
\centering
T1: Phytoplankton (Producers)
Biomass = 40
\end{minipage
Quick Tip: Remember that while the pyramid of energy is always upright, the pyramid of numbers and the pyramid of biomass can be inverted. An inverted pyramid of biomass is typically found in aquatic ecosystems, while an inverted pyramid of numbers is often seen in a tree ecosystem (one large tree supporting many insects).
Explain the process of formation of placenta in a human female after the implantation of the blastocyst in the endometrium of the uterus.
Following the implantation of the blastocyst, the process of placenta formation, known as placentation, begins.
Step 1: The outer layer of the blastocyst, the trophoblast, develops finger-like projections called chorionic villi.
Step 2: These chorionic villi grow and penetrate into the uterine wall (endometrium).
Step 3: The uterine tissue and blood vessels in the endometrium surround the chorionic villi.
Step 4: The chorionic villi and the uterine tissue become intimately interlocked (interdigitated) with each other.
Step 5: This combined structure of fetal tissue (chorionic villi) and maternal tissue (uterine wall) develops into the placenta.
The placenta serves as a vital connection, facilitating the supply of oxygen and nutrients to the embryo and the removal of waste products.
Quick Tip: Remember that the placenta is a unique organ of dual origin, formed from both fetal (chorionic villi) and maternal (endometrium) tissues. Its main functions are nutrient exchange, gas exchange, waste removal, and endocrine hormone production (like hCG, hPL).
(a) Why was he successful in his hybridisation experiments ? Give two reasons.
(b) State the law of independent assortment as proposed by Mendel after his dihybrid crosses.
(a) Reasons for Mendel's success:
1. Choice of Experimental Material: Mendel chose the garden pea plant (Pisum sativum), which was ideal because it had many distinct, easily observable contrasting traits (e.g., tall/dwarf, round/wrinkled). It also has a short life cycle and produces a large number of offspring.
2. Methodology and Analysis: He applied mathematical logic and statistical analysis to his results, which was a novel approach at the time. His large sampling size gave greater credibility to his data and helped him formulate general rules of inheritance. He also studied the inheritance of one character at a time.
(b) Law of Independent Assortment:
This law is based on Mendel's dihybrid cross experiments (crosses involving two pairs of contrasting traits).
The law states that when two pairs of traits are combined in a hybrid, the segregation of one pair of characters (alleles) is independent of the other pair of characters (alleles) during the formation of gametes.
In other words, the allele a gamete receives for one gene does not influence the allele it receives for another gene.
Quick Tip: Distinguish Mendel's two main laws: The Law of Segregation is based on the monohybrid cross and deals with a single gene. The Law of Independent Assortment is based on the dihybrid cross and deals with the relationship between two different genes.
Study the given below single strand of deoxyribonucleic acid depicted in the form of a "stick" diagram with 5' – 3' end directionality, sugars as vertical lines and bases as single letter abbreviations and answer the questions that follow.
(a) Name the covalent bonds depicted as (a) and (b) in the form of slanting lines in the diagram.
(b) How many purines are present in the given “stick” diagram ?
(c) Draw the chemical structure of the given polynucleotide chain of DNA.
(a) Naming the covalent bonds:
Based on the standard representation of a polynucleotide chain:
- The slanting line labeled (a) connects the nitrogenous base (A) to the deoxyribose sugar (vertical line). This covalent bond is called the N-glycosidic bond.
- The slanting line labeled (b) connects the deoxyribose sugar to the phosphate group of the next nucleotide, forming the sugar-phosphate backbone. This linkage is the Phosphodiester bond.
(b) Counting the purines:
In DNA, the nitrogenous bases are of two types: Purines and Pyrimidines.
- The Purines are Adenine (A) and Guanine (G).
- The Pyrimidines are Cytosine (C) and Thymine (T).
In the given diagram, the bases shown are A, T, and G.
The purines present are Adenine (A) and Guanine (G). Therefore, there are 2 purines.
(c) Chemical Structure Depiction:
A drawing of the chemical structure would show:
1. A phosphate group attached to the 5' carbon of the first deoxyribose sugar.
2. The nitrogenous base Adenine (A) attached to the 1' carbon of the first sugar.
3. A phosphodiester bond linking the 3' carbon of the first sugar to the 5' carbon of the second sugar via a phosphate group.
4. The base Thymine (T) attached to the 1' carbon of the second sugar.
5. Another phosphodiester bond linking the 3' carbon of the second sugar to the 5' carbon of the third sugar.
6. The base Guanine (G) attached to the 1' carbon of the third sugar.
7. A free hydroxyl (-OH) group at the 3' carbon of the third sugar, defining the 3' end of the chain.
Quick Tip: To remember the bonds in a DNA strand: The "backbone" is made of sugar and phosphate linked by strong phosphodiester bonds. The "rungs" (if it were a double helix) are formed by bases, and the bond linking a base to the sugar is the N-glycosidic bond.
Explain the biological treatment of primary effluent when passed into the large aeration tanks in a sewage treatment plant (STP).
The treatment of primary effluent in large aeration tanks constitutes the secondary or biological treatment stage of sewage treatment.
Step 1: The primary effluent is pumped into large aeration tanks where it is constantly agitated mechanically and air is pumped into it.
Step 2: This vigorous aeration promotes the rapid growth of useful aerobic microbes (mainly bacteria) which associate with fungal filaments to form mesh-like structures called flocs.
Step 3: While growing, these microbes consume the major part of the organic matter present in the effluent as food.
Step 4: This process significantly reduces the Biochemical Oxygen Demand (BOD) of the effluent. BOD is a measure of the organic matter present in the water.
Step 5: Once the BOD is sufficiently reduced, the effluent is passed into a settling tank where the bacterial flocs are allowed to sediment. This sediment is called activated sludge.
Quick Tip: Remember the key terms for secondary treatment: Aeration tanks, Flocs (bacteria + fungi), consumption of organic matter, and reduction of BOD. The goal of this stage is to use microbes to clean the water biologically.
Answer the following questions based on the above diagram :
(a) Name the mode of abiotic pollination that will be adopted by the given plant species in the above picture.
(b) State the need of exposed large feathery stigmas for the flower.
(c) What will be the two important adaptations in the pollen grains of the flowers pollinated by the above mode of pollination ?
(d) What could be the probable reason for the petals being small and non-green ?
(a) The features shown in the flower—well-exposed stamens with versatile anthers and large, feathery stigmas—are characteristic adaptations for pollination by wind. This mode of abiotic pollination is called Anemophily.
(b) The large and feathery stigma serves to increase the surface area of the stigma, making it more efficient at trapping pollen grains that are carried by the wind.
(c) Two important adaptations for wind-borne (anemophilous) pollen grains are:
1. Light weight: So they can be easily carried over long distances by air currents.
2. Non-sticky: So they do not clump together and can be dispersed effectively.
(Pollen grains are also produced in enormous quantities to compensate for the uncertainty of pollination).
(d) The probable reason for the petals being small and inconspicuous (not large or brightly colored) is that the flower does not need to attract animal pollinators like insects or birds. Producing large petals, nectar, or fragrance would be a waste of energy and resources for a wind-pollinated plant.
Quick Tip: Characteristics of wind-pollinated (anemophilous) flowers are the opposite of insect-pollinated ones. They are typically small, inconspicuous, and lack nectar and fragrance, but have features to maximize pollen dispersal and capture, like feathery stigmas and production of vast amounts of light pollen.
According to a recent wildlife report, the biggest threat to the tiger's survival in Mudumalai Tiger Reserve (MTR) was found to be a small, beautiful flower, Lantana camara, a tropical American shrub, that invaded 40% of India's tiger range. Tamil Nadu department's Lantana weed eradication drive helped to restore the dying MTR thereby also reducing human-wildlife conflicts. MTR is home to 25 species of grasses and legumes.
Answer the given questions based on the information given above.
(a) Explain how did the removal of Lantana help in restoring the dying Mudumalai Tiger Reserve.
(b) Why is the invasion of Lantana camara a cause of concern in MTR.
(a) How removal of Lantana helped restore the reserve:
The tiger is an apex predator whose survival depends on a healthy population of its prey, which are herbivores like deer and gaur.
These herbivores, in turn, depend on native grasses and legumes for food, as mentioned in the report.
Lantana camara, being an invasive species, outcompetes and displaces these native plants, reducing the food available for the herbivores.
This leads to a decline in the herbivore population, and consequently, a decline in the tiger population due to starvation.
By removing the invasive Lantana, the native grasses and legumes were able to grow back. This restored the food source for herbivores, their population recovered, and in turn, the prey base for the tigers was restored, helping the entire ecosystem of the tiger reserve to recover.
(b) Why Lantana invasion is a cause of concern:
The invasion of Lantana camara is a major cause of concern for several reasons:
1. Loss of Biodiversity: As an aggressive invasive alien species, it forms dense thickets that prevent the growth of native plant species, leading to a significant loss of local flora.
2. Disruption of Food Web: Most native herbivores do not eat Lantana. By replacing palatable native forage, it disrupts the entire food web, affecting the populations of herbivores and, subsequently, their predators like the tiger.
3. Allelopathy: Lantana releases certain chemicals into the soil (allelopathy) that inhibit the germination and growth of other native plants, making ecosystem restoration difficult even after its removal.
Quick Tip: Invasive alien species are one of the "Evil Quartet" of biodiversity loss. They threaten native ecosystems by competing for resources, disrupting food webs, and altering habitats, as exemplified by Lantana camara in Indian forests.
Enlist one advantage and two disadvantages of green revolution.
The Green Revolution refers to the period of substantial increase in the production of food grains, particularly wheat and rice, in the mid-20th century.
One Advantage:
- Increased Food Production: The main advantage was a dramatic increase in crop yields due to the development of high-yielding varieties (HYVs) of crops. This helped countries like India to achieve self-sufficiency in food grains and avert widespread famine.
Two Disadvantages:
1. Environmental Pollution: The high-yielding varieties required intensive use of chemical fertilizers and pesticides. The runoff of these chemicals from fields led to the pollution of water bodies (eutrophication) and degradation of soil quality over time.
2. Depletion of Groundwater: The HYVs also required large amounts of water for irrigation. This led to the excessive use and unsustainable depletion of groundwater resources in many agricultural regions, lowering the water table significantly.
Quick Tip: The Green Revolution was a double-edged sword. While it solved the immediate problem of food scarcity (a massive advantage), it created long-term environmental problems (disadvantages) like pollution, water depletion, and loss of crop genetic diversity, which are the focus of modern sustainable agriculture.
Read the following passage and answer the questions that follow.
The most convincing evidence to trace evolutionary relationships between humans and different groups of animals come from the basic similarities seen at the molecular level. Study the table given below that depicts the number of amino acid differences between the haemoglobin polypeptide of few animals with that of humans and answer the questions that follow.
(a) To which category of evolution (Divergent or Convergent) do the following evolutionary relationships belong to :
(i) Humans and Macaque
(ii) Humans and Frog
(i) Humans and Macaques share a relatively recent common ancestor in the primate lineage.
Their different characteristics have accumulated since they diverged from this common ancestor.
Evolution from a common ancestral form to produce different forms is called Divergent Evolution.
(ii) Humans and Frogs also share a more distant common ancestor (an early vertebrate).
The differences in their haemoglobin and other traits are the result of evolution along separate paths since their divergence.
This is also an example of Divergent Evolution.
Both relationships are based on descent from a common ancestor, which is the hallmark of divergent evolution.
Quick Tip: Divergent evolution is like a family tree, where related organisms become more different over time. Convergent evolution is when unrelated organisms (like a shark and a dolphin) independently evolve similar features to adapt to similar environments. Homologous structures are evidence for divergent evolution.
(b) What do the biochemical similarities in haemoglobin suggest about the evolutionary relationship between humans, frog and lamprey ?
Haemoglobin is a complex protein essential for oxygen transport in many animals.
The fact that humans, frogs, and lampreys all possess haemoglobin indicates a shared ancestry.
It suggests that they have all evolved from a common ancestor that also had a haemoglobin-like molecule.
The varying number of amino acid differences in their haemoglobin reflects the degree of divergence from this common ancestor.
Fewer differences imply a more recent common ancestor, while more differences imply a more distant one.
Quick Tip: Biochemical evidence, like similarities in proteins (e.g., haemoglobin, cytochrome c) and DNA sequences, provides powerful and quantitative evidence for common descent and evolutionary relationships.
(c) (i) Which one of the two – lampreys' or macaques' evolution is more closely related to humans and why ?
The degree of evolutionary relatedness can be estimated by comparing the number of differences in the amino acid sequences of a common protein like haemoglobin.
According to the table, the number of amino acid differences in haemoglobin compared to humans is:
- Macaque: 08
- Lamprey: 125
A smaller number of differences indicates that fewer mutations have accumulated since the two species diverged from their common ancestor.
This implies a more recent common ancestor and therefore a closer evolutionary relationship.
Since 8 is much smaller than 125, the macaque is more closely related to humans than the lamprey.
Quick Tip: The concept of the "molecular clock" is based on this principle: the number of mutations (and thus amino acid differences) accumulates at a relatively constant rate. By counting these differences, we can estimate how long ago two species shared a common ancestor.
(c) (ii) Which one of the two – frogs' or dogs' evolution is more closely related to humans and why?
To determine which animal is more closely related to humans, we compare the number of amino acid differences in their haemoglobin.
According to the provided table:
- Number of differences between Dog and Human haemoglobin = 32.
- Number of differences between Frog and Human haemoglobin = 67.
A lower number of amino acid differences signifies a closer evolutionary relationship, as it indicates a more recent common ancestor.
Since 32 (for dogs) is less than 67 (for frogs), the dog is more closely related to humans.
This is consistent with our understanding of classification, as both dogs and humans are mammals, while frogs are amphibians.
Quick Tip: Always use the provided data to justify your answer in case-based questions. The principle is simple: fewer molecular differences = closer evolutionary relationship.
Read the following passage and answer the questions that follow.
Deaths related to the use of drugs were estimated at about 5,00,000 in 2019, 17.5 percent more than in 2009. Liver diseases attributed to Hepatitis B are a major cause of drug-related deaths, according to UNODC, accounting for more than half of the total number of deaths attributed to the use of drugs. Drug overdoses account for a quarter of drug-related deaths. Opioids contribute to account for the most severe drug-related harm, including fatal overdoses, when used non-medically. At the global level, two-third of direct drug-related deaths are due to opioids, and in some sub-regions the proportion can be as high as three-quarters of such deaths.
(a) Why are people taking opioids more prone to liver diseases attributed to Hepatitis B ?
Opioids, such as heroin, are often taken by intravenous (IV) injection.
Drug abusers who use this method frequently share needles and syringes.
Hepatitis B is a viral infection that primarily attacks the liver and is transmitted through contact with infected blood or other body fluids.
If one person in a group of IV drug users is infected with Hepatitis B, the virus can easily be transmitted to others through the sharing of contaminated needles.
Therefore, this mode of drug administration creates a high-risk pathway for the spread of blood-borne pathogens like the Hepatitis B virus, making these individuals highly prone to liver diseases.
Quick Tip: Remember the common modes of transmission for major infectious diseases. HIV and Hepatitis B/C are primarily transmitted through sexual contact and the sharing of infected needles, making IV drug use a significant risk factor for both.
(b) What is meant by direct drug-related disease ?
A direct drug-related disease refers to a health condition or death that is a direct consequence of the drug's effect on the body.
This is in contrast to indirect harm, such as contracting an infection from a shared needle.
The most prominent example mentioned in the passage is a drug overdose.
An overdose occurs when a toxic amount of a drug overwhelms the body's systems, leading to severe illness or death.
Other examples include organ damage (like liver or kidney failure) caused by the long-term toxicity of a substance, or addiction itself, which is a chronic brain disease.
Quick Tip: Distinguish between direct and indirect harm from drug abuse. Direct harm comes from the drug's effect (overdose, toxicity). Indirect harm comes from the behaviors associated with drug use (infections from shared needles, accidents while intoxicated).
(c) (i) What is the scientific name of the plant from which the opioids are derived and from which part of the plant is it extracted ?
The natural opioids, such as morphine and codeine, are derived from the opium poppy plant.
The scientific name of this plant is Papaver somniferum.
The psychoactive substance is extracted from the latex of the plant.
This latex is obtained by making incisions in the unripe seed capsule (also known as the poppy pod) of the flower. The latex then seeps out and is collected and dried to produce raw opium.
Quick Tip: Associate common drugs with their plant sources: Opioids (morphine, heroin) from Opium Poppy (Papaver somniferum), Cannabinoids from Cannabis plant (Cannabis sativa), and Cocaine from Coca plant (Erythroxylum coca).
(c) (ii) State two common warning signs of drug abuse among the youth.
There are several behavioral and psychological changes that can serve as warning signs of drug abuse among adolescents. Two common signs are:
1. Drop in Academic Performance: This includes unexplained drops in grades, skipping school or classes, and a general loss of interest in schoolwork and extracurricular activities.
2. Social and Behavioral Changes: This can manifest as withdrawal from family and long-time friends, isolation, secretiveness, sudden changes in friends, and developing a rebellious or hostile attitude. Other signs can include a lack of interest in personal hygiene and unexplained needs for money.
Quick Tip: Warning signs of drug abuse often fall into categories: academic/work-related, social/behavioral, physical, and psychological. Being aware of these signs is crucial for early detection and intervention.
(a) (i) Explain how does double fertilisation take place in a flowering plant.
(ii) Write the fate of the products of double fertilization in these plants.
(i) Process of Double Fertilisation:
After landing on a compatible stigma, a pollen grain germinates and its pollen tube grows down through the style and enters the ovule, typically through the micropylar end.
The pollen tube, carrying two male gametes, then enters one of the synergids of the embryo sac.
The tip of the pollen tube ruptures, releasing the two male gametes into the cytoplasm of the synergid.
One of the male gametes moves towards the egg cell and fuses with its nucleus. This fusion is called syngamy and results in the formation of a diploid cell, the zygote (2n).
The other male gamete moves towards the two polar nuclei located in the large central cell and fuses with them. This fusion of three haploid nuclei is called triple fusion, and it results in the formation of a triploid Primary Endosperm Nucleus (PEN) (3n).
Since two types of fusions—syngamy and triple fusion—take place in the embryo sac, the phenomenon is termed double fertilisation, an event unique to flowering plants.
(ii) Fate of the Products:
- Zygote: The diploid zygote (2n) develops into the embryo, which is the future plant.
- Primary Endosperm Nucleus (PEN): The triploid PEN (3n) develops into the endosperm, a nutritive tissue that provides nourishment to the developing embryo.
- Ovule: After fertilization, the entire ovule matures into the seed.
- Ovary: The ovary develops into the fruit that encloses the seed(s).
Quick Tip: Remember the ploidy levels of the key structures involved in double fertilization: - Male gametes (n) - Egg cell (n) - Polar nuclei (n+n) - Zygote (2n) - from Syngamy - Primary Endosperm Nucleus (PEN) (3n) - from Triple Fusion
(b) (i) Explain the structure of testicular lobules in human male reproductive system. Name the two types of cells present in the seminiferous tubules and state their role.
(ii) Describe the role of hypothalamic hormone GnRH in spermatogenesis.
(i) Structure of Testicular Lobules and Cells of Seminiferous Tubules:
Each testis is covered by a dense fibrous capsule and is internally divided into approximately 250 compartments called testicular lobules.
Each of these lobules contains one to three highly coiled tubes called seminiferous tubules, which are the sites of sperm production.
The inner lining of the seminiferous tubules contains two types of cells:
1. Male germ cells (Spermatogonia): These are the diploid cells that undergo meiotic divisions (spermatogenesis) to produce haploid spermatozoa (sperms).
2. Sertoli cells (or nurse cells): These are large, supportive cells that provide structural support and nutrition to the developing germ cells. They also secrete hormones like inhibin and androgen-binding protein (ABP).
(ii) Role of GnRH in Spermatogenesis:
The process of spermatogenesis begins at puberty due to a significant increase in the secretion of Gonadotropin-releasing hormone (GnRH).
GnRH is a hormone secreted by the hypothalamus.
It acts on the anterior lobe of the pituitary gland and stimulates it to secrete two gonadotropic hormones:
- Luteinizing Hormone (LH): LH acts on the Leydig cells (interstitial cells) located outside the seminiferous tubules, stimulating them to synthesize and secrete androgens, primarily testosterone. Testosterone is essential for initiating and maintaining spermatogenesis.
- Follicle-Stimulating Hormone (FSH): FSH acts on the Sertoli cells within the seminiferous tubules, stimulating them to secrete factors that help in the process of spermiogenesis (the transformation of spermatids into spermatozoa).
Quick Tip: Remember the hormonal axis for male reproduction: Hypothalamus (releases GnRH) \(\rightarrow\) Anterior Pituitary (releases LH & FSH) \(\rightarrow\) LH acts on Leydig cells (to produce Testosterone) & FSH acts on Sertoli cells (to aid spermiogenesis).
(a) Name and explain the biotechnological strategy wherein the infection by the nematode Meloidegyne incognitia can be prevented using Agrobacterium vectors in the roots of tobacco plant by RNA interference.
The biotechnological strategy used is RNA interference (RNAi).
Explanation of the Process:
1. The nematode Meloidogyne incognita infects the roots of tobacco plants, causing severe yield reduction. RNAi is used to create a pest-resistant plant.
2. A nematode-specific gene, which is essential for its survival, is identified and isolated.
3. This gene is introduced into the tobacco plant using an Agrobacterium vector. The gene is inserted in such a way that the plant's cells produce both sense and anti-sense RNA strands corresponding to the nematode's mRNA.
4. These two complementary RNA strands pair up inside the plant cell to form a double-stranded RNA (dsRNA).
5. This formation of dsRNA initiates the RNAi mechanism. The plant's cellular machinery (involving enzymes like Dicer) processes the dsRNA into smaller fragments called small interfering RNAs (siRNAs).
6. When the nematode infests the transgenic tobacco plant and feeds on its root cells, it ingests these siRNAs.
7. Inside the nematode's cells, the siRNAs bind to the nematode's own target mRNA (which is complementary to the siRNA). This leads to the cleavage and degradation of the nematode's mRNA by a complex called RISC.
8. The silencing of this specific, essential mRNA prevents its translation into protein. The lack of this essential protein leads to the death of the nematode.
In this way, the transgenic tobacco plant becomes resistant to the pest.
Quick Tip: The key to understanding RNAi is that double-stranded RNA (dsRNA) is a trigger for gene silencing in many eukaryotes. The presence of dsRNA homologous to a specific mRNA leads to the destruction of that mRNA, effectively "interfering" with its expression.
(b) Explain the amplification of gene of interest using the technique of Polymerase chain reaction (PCR).
Polymerase Chain Reaction (PCR) is a technique used to make multiple copies (amplify) of a specific segment of DNA in vitro. The process involves repeated cycles of three main steps:
Requirements:
- DNA template: The DNA sample containing the target sequence to be amplified.
- Primers: Two sets of short, chemically synthesized DNA sequences that are complementary to the 3' ends of the target DNA segment.
- Taq polymerase: A thermostable DNA polymerase (from Thermus aquaticus) that can withstand high temperatures.
- Deoxyribonucleotides (dNTPs): The building blocks (A, T, C, G) for the new DNA strands.
The Three Steps of a PCR Cycle:
1. Denaturation: The reaction mixture is heated to a high temperature (94-96°C) for about a minute. This breaks the hydrogen bonds holding the two strands of the DNA template together, separating them into single strands.
2. Annealing: The temperature is lowered to about 50-65°C. This allows the primers to move in and bind (anneal) to their complementary sequences on the single-stranded DNA templates.
3. Extension/Polymerization: The temperature is raised to 72°C, the optimal temperature for Taq polymerase. The polymerase binds to the primer-template complex and begins synthesizing a new complementary strand of DNA by adding dNTPs, extending from the primer.
These three steps constitute one cycle. The process is repeated for about 30-40 cycles in a thermal cycler. With each cycle, the number of DNA copies of the target sequence doubles, resulting in an exponential amplification. Billions of copies can be made from a single DNA molecule in a few hours.
Quick Tip: Remember the three key temperature stages of PCR: High temperature (\(\sim\)95°C) for Denaturation, Low temperature (\(\sim\)55°C) for Annealing, and Medium-high temperature (\(\sim\)72°C) for Extension. The use of a thermostable polymerase like Taq is essential because it is not destroyed during the high-temperature denaturation step.
(a) (i) Describe the population growth curve applicable in a population of any species in nature that has limited resources at its disposal.
(ii) Give the equation of this growth curve.
(iii) Name the growth curve and depict a graphical plot for this type of population growth.
(i) Description of the Growth Curve:
In any natural habitat with limited resources, a population exhibits a more realistic growth pattern. The growth curve consists of four distinct phases:
- Lag Phase: Initially, the population growth is slow as the individuals adapt to the new environment.
- Log (Exponential) Phase: This is a phase of rapid growth as resources are abundant and the population has adapted. The growth rate is maximal.
- Deceleration Phase: As the population size increases, resources start to become limited, and environmental resistance (like competition, predation) increases. This causes the growth rate to slow down.
- Asymptote (Stationary Phase): Eventually, the population reaches the maximum size that the environment can sustainably support. This limit is called the carrying capacity (K). At this point, the birth rate equals the death rate, and the population growth becomes zero, leading to a stable plateau.
(ii) Equation of the Growth Curve:
The equation that describes this type of growth is the Verhulst-Pearl Logistic Growth equation:
dN/dt = rN ( (K - N) / K )
Where: N = Population density at time t, r = Intrinsic rate of natural increase, and K = Carrying capacity.
(iii) Name and Graphical Plot:
The name of this growth curve is the Logistic Growth Curve, also known as the S-shaped or Sigmoid curve.
Graphical Plot:
The graph is plotted with Time on the X-axis and Population Density (N) on the Y-axis. The curve starts slowly (lag phase), then rises steeply (log phase), then begins to flatten (deceleration phase), and finally becomes horizontal at a level labeled 'K' (carrying capacity).
Quick Tip: The key difference between exponential (J-shaped) and logistic (S-shaped) growth is the concept of carrying capacity (K) and environmental resistance. Exponential growth assumes unlimited resources, while logistic growth incorporates the reality of limited resources that cap population size.
(b) (i) Explain the Species-Area relationship within a natural forest and also predict the nature of graph when species richness is plotted against the area for a wide variety of taxa.
(ii) Depict the graphical relationship between species richness and area.
(iii) Give the equation of the Species-Area relationship for a wide variety of taxa on a logarithmic scale.
(i) Explanation and Nature of the Graph:
The Species-Area relationship, as observed by the naturalist Alexander von Humboldt, describes a fundamental pattern in ecology.
He observed that within a region (like a natural forest), the number of species found (species richness) increases as the area explored increases, but only up to a certain limit.
When species richness (S) is plotted against area (A) for a wide variety of taxa (like birds, bats, or flowering plants), the resulting graph is a rectangular hyperbola. This means the curve rises steeply at first for smaller areas and then the slope becomes less steep as larger areas are included.
\textbf(ii) Graphical Relationship:
The graph shows Area (A) on the X-axis and Species Richness (S) on the Y-axis. The curve starts from the origin, rises, and then becomes flatter, approaching a plateau. The relationship is described by the equation S = CA\(^Z\).
(iii) Equation on a Logarithmic Scale:
When the same relationship is plotted on a logarithmic scale (log-log plot), the curve becomes a straight line.
The equation for this linear relationship is:
log S = log C + Z log A
Where:
- S = Species richness
- A = Area
- Z = Slope of the line (also called the regression coefficient). It indicates how rapidly species richness increases with area.
- C = Y-intercept.
Quick Tip: The value of 'Z' (the slope) in the species-area relationship equation is ecologically significant. For smaller, similar areas, Z is typically in the range of 0.1 to 0.2. However, for very large areas like entire continents, the slope is much steeper, with Z values in the range of 0.6 to 1.2, indicating that a greater increase in species is found for a given increase in area.
*The article might have information for the previous academic years, please refer the official website of the exam.