Zollege is here for to help you!!
Need Counselling
Sanghamitra Deb's profile photo

Sanghamitra Deb

Content Writer | Updated On - Nov 29, 2025

CBSE Class 12 Biology Question Paper with Solutions PDF Set 2 – 57/4/2 is now available for download. CBSE conducted the Class 12 Biology examination on March 25, 2025. The question paper consists of 33 questions carrying a total of 70 marks. Section A includes 16 MCQs for 1 mark each, Section B contains 5 very short-answer questions for 2 marks each, Section C comprises 7 short-answer questions for 3 marks each, Section D comprises 2 Case-based questions carries 4 marks each and Section E comprises 3 long-answer questions carries 5 marks each. 

CBSE Class 12 Biology Question Paper (Set 2 – 57/4/2) 2025 with Solutions

CBSE Class 12 Biology Question Paper with Solutions Download PDF Check Solutions
CBSE Class 12 Biology Question Paper 2025 with Solutions Set 2 57 4 2

Question 1:

In its extended 'beads-on-string' form of chromatin, the 'beads' are composed of :

  • (A) Histones and linker DNA
  • (B) Histones and about 200 bp of DNA
  • (C) NHC proteins and linker DNA
  • (D) NHC proteins and about 200 bp of DNA
Correct Answer: (B) Histones and about 200 bp of DNA
View Solution



The 'beads-on-string' structure is the first level of DNA packaging in eukaryotes.


Each 'bead' in the structure is a nucleosome.


A nucleosome core consists of a segment of DNA wound around a core of eight histone proteins (a histone octamer).


The 'string' connecting the beads is the linker DNA.


The entire repeating unit, which includes the nucleosome core particle and the linker DNA, contains approximately 200 base pairs (bp) of DNA.


Therefore, the 'bead' and its associated repeating DNA length are best described as being composed of histones and about 200 bp of DNA.
Quick Tip: Remember that the 'bead' is the nucleosome core (histone octamer + core DNA), and the 'string' is the linker DNA. The entire repeating unit (bead + string) is about 200 bp. Questions can be tricky about whether they refer to just the core or the whole unit.


Question 2:

Given below are few statements with respect to the process of oogenesis in a human ovary :

(i) Each granulosa cell gets surrounded by a primary oocyte to form the primary follicle.

(ii) A couple of million of oogonia are formed within each fetal ovary during the embryonic development.

(iii) Tertiary follicle is characterised by antrum and theca layers.

(iv) Secondary follicles form a zona pellucida layer around it.

(v) Mature graafian follicle ruptures to release the secondary oocyte from the ovary.

Choose the option with all true statements from the given options :

  • (A) (i), (ii), (iv)
  • (B) (ii), (iii), (v)
  • (C) (ii), (iv), (v)
  • (D) (i), (iii), (iv)
Correct Answer: (B) (ii), (iii), (v)
View Solution



Let's analyze each statement to identify the correct ones.


Statement (i) is incorrect. The primary oocyte is surrounded by a layer of granulosa cells to form the primary follicle, not the other way around.


Statement (ii) is correct. Oogenesis begins during embryonic development, where millions of oogonia are formed in the fetal ovary.


Statement (iii) is correct. The defining characteristic of a tertiary follicle is the formation of a fluid-filled cavity called the antrum.


Statement (iv) is incorrect. The zona pellucida layer is secreted by the granulosa cells around the primary oocyte during the primary follicle stage.


Statement (v) is correct. The rupture of the mature Graafian follicle to release the secondary oocyte is the process of ovulation.


Thus, the correct statements are (ii), (iii), and (v).
Quick Tip: To master questions on follicular development, create a flowchart of the stages: Primordial follicle \(\rightarrow\) Primary follicle \(\rightarrow\) Secondary follicle \(\rightarrow\) Tertiary follicle \(\rightarrow\) Graafian follicle. For each stage, list the key characteristics, such as the state of the oocyte, number of granulosa layers, presence of zona pellucida, and presence of antrum.


Question 3:

The simplest definition of a gene in eukaryotes is – A unit of DNA that has information to mainly specify the synthesis of :

  • (A) Single polypeptide chain and mRNA only
  • (B) Many polypeptide chains and mRNA only
  • (C) Single polypeptide chain and functional RNA only
  • (D) Many polypeptide chains and functional RNA only
Correct Answer: (C) Single polypeptide chain and functional RNA only
View Solution



A gene is functionally defined as a segment of DNA that codes for a functional product.


This functional product can be a polypeptide chain, which is synthesized via a messenger RNA (mRNA) intermediate.


Alternatively, the functional product can be an RNA molecule itself, which is not translated into a protein. Examples include transfer RNA (tRNA) and ribosomal RNA (rRNA).


The "one gene-one polypeptide" hypothesis is a simple model, so "single polypeptide chain" is appropriate for the simplest definition.


Therefore, the most accurate simple definition must encompass both possibilities: the synthesis of a single polypeptide chain or a functional RNA.


Option (C) correctly includes both "Single polypeptide chain" and "functional RNA".
Quick Tip: The modern definition of a gene is a sequence of DNA that codes for a functional product, which can be either a polypeptide or an RNA molecule. Always remember that genes don't just make proteins; they also make essential functional RNAs like tRNA and rRNA.


Question 4:

A colourblind man marries a woman with normal sight who has no history of colourblindness in her family. What is the probability of their son being colourblind ?

  • (A) 0.5
  • (B) 1
  • (C) Nil
  • (D) 0.25
Correct Answer: (C) Nil
View Solution



Colour blindness is an X-linked recessive disorder. Let \(X^c\) represent the allele for colour blindness and \(X\) represent the allele for normal vision.


The genotype of the colourblind man is \(X^cY\).


The woman has normal sight and no family history of the disorder. This implies that she is homozygous for the normal allele, so her genotype is \(XX\).


A son inherits his X chromosome from his mother and his Y chromosome from his father.


Since the mother's genotype is \(XX\), she can only pass on an \(X\) chromosome (with the normal allele) to her sons.


Therefore, all sons will have the genotype \(XY\) and will have normal vision.


The probability of their son being colourblind (\(X^cY\)) is zero.
Quick Tip: For X-linked recessive traits, remember that a son inherits his X chromosome exclusively from his mother. The father contributes the Y chromosome. Therefore, a son's chance of having an X-linked recessive trait depends entirely on the mother's genotype.


Question 5:

The type of antibodies produced during an immune response to allergens as dust and pollen grains in a person is :

  • (A) IgE
  • (B) IgA
  • (C) IgG
  • (D) IgD
Correct Answer: (A) IgE
View Solution



Allergic reactions are exaggerated immune responses to environmental antigens called allergens.


This type of hypersensitivity reaction is mediated by Immunoglobulin E (IgE) antibodies.


When a person is first exposed to an allergen, their plasma cells produce large amounts of IgE.


This IgE binds to the surface of mast cells and basophils.


Upon subsequent exposure, the allergen cross-links the IgE on these cells, triggering the release of inflammatory mediators like histamine.


This release of mediators causes the symptoms associated with allergies.
Quick Tip: Associate each major immunoglobulin class with a keyword: IgG (General/Greatest amount), IgA (Secretory/Areas like mucosa), IgM (Mega/First responder), IgE (Allergy/Eosinophils). This can help you quickly recall their main functions.


Question 6:

Select the statements that are true for a typical megasporangium of flowering plants.

(i) It is attached to the placenta by hilum.

(ii) It has a chalaza end that represents the basal part of the ovule.

(iii) It has nucellus enclosed by integuments.

(iv) Its micropylar end is known as chalaza.

Choose the correct answer :

  • (A) (i) and (ii)
  • (B) (ii) and (iii)
  • (C) (iii) and (iv)
  • (D) (i) and (iv)
Correct Answer: (B) (ii) and (iii)
View Solution



Let's evaluate each statement about the megasporangium (ovule).


Statement (i) is incorrect. The ovule is attached to the placenta by a stalk called the funicle. The hilum is the junction where the body of the ovule fuses with the funicle.


Statement (ii) is correct. The chalaza is the basal part of the ovule, located opposite to the micropylar end.


Statement (iii) is correct. The nucellus is the main body of the ovule, and it is enclosed and protected by one or two layers called integuments.


Statement (iv) is incorrect. The micropylar end is the opening left by the integuments, and it is distinct from the chalaza.


Therefore, the only true statements are (ii) and (iii).
Quick Tip: Draw a labelled diagram of an anatropous ovule and memorize the function and position of each part: funicle, hilum, micropyle, chalaza, integuments, and nucellus. This visual aid is crucial for answering questions on this topic.


Question 7:

The primates that probably lived in East Africa grasslands about two mya were :

  • (A) Dryopithecus
  • (B) Ramapithecus
  • (C) Australopithecines
  • (D) Neanderthal
Correct Answer: (C) Australopithecines
View Solution



This question asks to identify the hominid group from a specific time and location based on the fossil record.


About 2 million years ago (mya), fossil evidence shows that Australopithecines lived in the East African grasslands.


They are considered early hominids who were bipedal.


Dryopithecus and Ramapithecus were earlier ape-like ancestors, living much before 2 mya.


Neanderthal man (Homo neanderthalensis) lived much later, between about 400,000 and 40,000 years ago, primarily in Europe and Asia.


Therefore, Australopithecines fit the description provided.
Quick Tip: Create a timeline for human evolution, including the major hominids (Australopithecines, Homo habilis, Homo erectus, Neanderthals, Homo sapiens), their approximate time periods, and key characteristics like brain capacity and tool use.


Question 8:

Use the given information to select the amino acid attached to the 3' end of tRNA during the process of translation, if the coding strand of the structural gene being transcribed has the nucleotide sequence 'ATA'.


  • (A) Isoleucine
  • (B) Methionine
  • (C) Tyrosine
  • (D) Serine
Correct Answer: (A) Isoleucine
View Solution



The coding strand of DNA has the sequence 5'-ATA-3'.


During transcription, the template strand is read, but the resulting mRNA sequence is complementary to the template strand and therefore similar to the coding strand.


The mRNA sequence will be the same as the coding strand, with Uracil (U) replacing Thymine (T).


So, the mRNA codon transcribed from the gene will be 5'-AUA-3'.


During translation, the ribosome reads the mRNA codon to determine which amino acid to add to the polypeptide chain.


According to the provided table, the codon AUA codes for the amino acid Isoleucine.


The corresponding tRNA with the anticodon UAU will carry Isoleucine to the ribosome.
Quick Tip: Remember the relationship: DNA coding strand is similar to mRNA (T \(\rightarrow\) U). DNA template strand is complementary to mRNA. The genetic code table always refers to the codons on the mRNA molecule.


Question 9:

Early detection of HIV in suspected AIDS patients can be done using the diagnostic technique of :

  • (A) ELISA
  • (B) PCR
  • (C) EST
  • (D) RNAi
Correct Answer: (B) PCR
View Solution



The question asks for a technique for *early detection* of HIV.


Early in an HIV infection, there is a "window period" where the amount of virus is low and the body has not yet produced a detectable level of antibodies.


Techniques like ELISA (Enzyme-Linked Immunosorbent Assay) primarily detect antibodies against HIV, so they may give a false negative result during this window period.


Polymerase Chain Reaction (PCR) is a molecular technique that can detect the virus's genetic material (viral RNA, after converting it to DNA via reverse transcriptase) directly.


PCR can amplify even very small amounts of this genetic material to detectable levels.


This makes PCR highly sensitive and suitable for early detection of the infection, even before antibodies are formed.


EST (Expressed Sequence Tags) and RNAi (RNA interference) are tools used in molecular biology research, not as primary diagnostic techniques for HIV.
Quick Tip: For diagnostic tests, distinguish between methods that detect the pathogen directly (like PCR detecting genetic material) and those that detect the body's response (like ELISA detecting antibodies). Direct detection methods are generally better for early diagnosis.


Question 10:

The correct depiction of the experiment performed by Matthew Meselson and Franklin Stahl to prove that DNA replicates semi-conservatively on separation of DNA by centrifugation after 40 minutes is :


  • (A) (A)
  • (B) (B)
  • (C) (C)
  • (D) (D)
Correct Answer: (B) (B)
View Solution



Meselson and Stahl's experiment used heavy nitrogen (\(^{15}\)N) and light nitrogen (\(^{14}\)N) to track DNA replication.


Generation 0 (start): E. coli grown in \(^{15}\)N medium. All DNA is heavy/heavy (\(^{15}\)N/\(^{15}\)N). This forms one heavy band on centrifugation.


Generation 1 (after 20 minutes): Bacteria transferred to \(^{14}\)N medium. After one round of replication, all DNA is hybrid (\(^{15}\)N/\(^{14}\)N). This forms one intermediate band. This corresponds to diagram (C).


Generation 2 (after 40 minutes): Bacteria continue to grow in \(^{14}\)N medium. After a second round of replication, half of the DNA molecules are hybrid (\(^{15}\)N/\(^{14}\)N) and the other half are light/light (\(^{14}\)N/\(^{14}\)N).


This results in two bands upon centrifugation: one at the intermediate position and one at the light position, in equal proportions (1:1 ratio).


Let's assume the black bands in the diagrams represent the heavy \(^{15}\)N strand and the white bands represent the light \(^{14}\)N strand.


Diagram (B) shows two hybrid molecules (one black, one white strand) and two light molecules (two white strands), representing a 50% hybrid and 50% light composition. This correctly depicts the state after 40 minutes.
Quick Tip: For the Meselson-Stahl experiment, remember the composition at each generation: Gen 0 = 100% Heavy. Gen 1 = 100% Hybrid. Gen 2 = 50% Hybrid, 50% Light. Gen 3 = 25% Hybrid, 75% Light. The amount of hybrid DNA is always two molecules, while the rest becomes light DNA.


Question 11:

Large holes in ‘Swiss cheese' are formed by the activity of microbes :

  • (A) Streptococcus pneumoniae
  • (B) Monascus purpureus
  • (C) Trichoderma polysporum
  • (D) Propionibacterium sharmanii
Correct Answer: (D) Propionibacterium sharmanii
View Solution



The characteristic large holes in Swiss cheese are produced during the ripening process.


These holes are formed due to the production of a large amount of carbon dioxide (\(CO_2\)) gas.


The bacterium responsible for this fermentation process is Propionibacterium sharmanii.


This bacterium consumes lactic acid and produces propionic acid (which contributes to the flavour), acetic acid, and large bubbles of \(CO_2\).


The other options are incorrect: Streptococcus pneumoniae is a pathogen, Monascus purpureus produces statins, and Trichoderma polysporum produces cyclosporin A.
Quick Tip: For the 'Microbes in Human Welfare' chapter, create a table with four columns: Microbe Name, Category (e.g., Bacterium, Fungus), Product/Process, and Application. This helps in quick revision of facts.


Question 12:

In pea plant (Pisum sativum) axial flower position is dominant over terminal flower position. The expected ratio of phenotypes of the offspring in a cross between both the parents with heterozygous axial flower will be :

  • (A) 3:1
  • (B) 2:1
  • (C) 1:1
  • (D) 1:0
Correct Answer: (A) 3:1
View Solution



Let the allele for the dominant axial flower position be 'A' and the allele for the recessive terminal flower position be 'a'.


Both parents have heterozygous axial flowers, so their genotype is Aa.


The cross is Aa \(\times\) Aa.


We can use a Punnett square to determine the genotypes of the offspring:


\begin{tabular{c|c|c
& A & a
\hline
A & AA & Aa
\hline
a & Aa & aa

\end{tabular



The genotypic ratio of the offspring is 1 AA : 2 Aa : 1 aa.


The phenotypes are determined by these genotypes:

AA (Axial), Aa (Axial), aa (Terminal).


The phenotypic ratio is (1+2) Axial : 1 Terminal, which simplifies to 3 Axial : 1 Terminal.


Therefore, the expected ratio of phenotypes is 3:1.
Quick Tip: Memorize the standard Mendelian ratios. A monohybrid cross between two heterozygotes (like this one) always yields a phenotypic ratio of 3:1 for a dominant-recessive trait. This saves calculation time during an exam.


Question 13:

Assertion (A) : ‘Saheli', an oral contraceptive inhibits ovulation and increases phagocytosis of sperms.

Reason (R) : It is a non-steroidal preparation.

  • (A) Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
  • (B) Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
  • (C) Assertion (A) is true, but Reason (R) is false.
  • (D) Assertion (A) is false, but Reason (R) is true.
Correct Answer: (D) Assertion (A) is false, but Reason (R) is true.
View Solution



Let's evaluate Assertion (A).


The contraceptive 'Saheli' (containing centchroman) primarily works by preventing the implantation of the blastocyst in the endometrium.


It does not inhibit ovulation, which is the mechanism of most conventional combined oral contraceptive pills.


Therefore, Assertion (A) is false.


Now, let's evaluate Reason (R).


'Saheli' is well-known for being a non-steroidal oral contraceptive pill, which distinguishes it from traditional pills that contain synthetic estrogen and progesterone.


Therefore, Reason (R) is true.


Since Assertion (A) is false and Reason (R) is true, the correct option is (D).
Quick Tip: Remember the unique mechanism of 'Saheli'. Unlike most birth control pills that work by inhibiting ovulation through hormonal action, Saheli is non-steroidal and acts as a selective estrogen receptor modulator (SERM), primarily preventing implantation.


Question 14:

Assertion (A): The meristems are grown ‘in vitro' to obtain virus-free plants from an infected plant.

Reason (R): If the plant is infected with a virus, the roots and the stems are free of virus.

  • (A) Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
  • (B) Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
  • (C) Assertion (A) is true, but Reason (R) is false.
  • (D) Assertion (A) is false, but Reason (R) is true.
Correct Answer: (C) Assertion (A) is true, but Reason (R) is false.
View Solution



Let's evaluate Assertion (A).


Meristem culture is a widely used technique in plant tissue culture to recover healthy, virus-free plants from diseased parent plants.


This is effective because the apical and axillary meristems are often free of viruses, even when the rest of the plant is infected, due to their high rate of cell division.


So, Assertion (A) is true.


Now, let's evaluate Reason (R).


Viral infections in plants are typically systemic, meaning the virus spreads throughout the plant's vascular system.


This means that parts like the roots and stems of an infected plant are usually also infected with the virus.


Therefore, Reason (R) is false.


Since Assertion (A) is true and Reason (R) is false, the correct option is (C).
Quick Tip: The key to recovering virus-free plants is using the meristem. Remember why: the rate of cell division in the meristem is faster than the rate of viral translocation and replication, keeping the tip of the shoot virus-free.


Question 15:

Assertion (A) : ABO blood grouping in humans is an example of multiple allelism.

Reason (R) : More than two genes in a population govern the same character in ABO blood grouping in humans.

  • (A) Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
  • (B) Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
  • (C) Assertion (A) is true, but Reason (R) is false.
  • (D) Assertion (A) is false, but Reason (R) is true.
Correct Answer: (C) Assertion (A) is true, but Reason (R) is false.
View Solution



Let's evaluate Assertion (A).


Multiple allelism is a condition where more than two alleles of a single gene exist in a population to govern a character.


The ABO blood group system is controlled by the gene I, which has three alleles: \(I^A\), \(I^B\), and \(i\).


Since there are three alleles for this single gene, it is a classic example of multiple allelism. So, Assertion (A) is true.


Now, let's evaluate Reason (R).


Reason (R) states that "More than two genes" govern the character. This is incorrect.


The ABO blood group is controlled by a single gene (gene I), not multiple genes.


The situation where multiple genes control a single character is called polygenic inheritance, not multiple allelism.


Therefore, Reason (R) is false.


Since Assertion (A) is true and Reason (R) is false, the correct option is (C).
Quick Tip: Do not confuse multiple allelism with polygenic inheritance. Multiple Allelism: One gene, many alleles (e.g., ABO blood type). Polygenic Inheritance: Many genes, one trait (e.g., human skin color).


Question 16:

Assertion (A) : A person infected with malaria suffers from chill and high fever, recurring every three or four days.

Reason (R) : The parasite attacks the RBC resulting in their rupture and release of haemozoin.

  • (A) Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
  • (B) Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
  • (C) Assertion (A) is true, but Reason (R) is false.
  • (D) Assertion (A) is false, but Reason (R) is true.
Correct Answer: (A) Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
View Solution



Let's evaluate Assertion (A).


A characteristic symptom of malaria is the cyclical occurrence of chills followed by high fever. The cycle repeats every 3 to 4 days, depending on the Plasmodium species. So, Assertion (A) is true.


Let's evaluate Reason (R).


In the erythrocytic cycle of malaria, the parasite (Plasmodium) multiplies within Red Blood Cells (RBCs).


These infected RBCs rupture synchronously, releasing new parasites (merozoites) and a toxic substance called haemozoin. So, Reason (R) is true.


Now, let's evaluate the relationship.


The release of the toxin haemozoin into the bloodstream upon RBC rupture is the direct trigger for the immune response that causes the characteristic chills and high fever.


Thus, Reason (R) provides the correct physiological explanation for the symptoms described in Assertion (A).


Since both statements are true and R is the correct explanation for A, the correct option is (A).
Quick Tip: Remember the key trigger for malarial fever: haemozoin. The life cycle of the parasite involves the synchronous rupture of RBCs, and it's the release of this toxic byproduct that causes the classic symptoms of chills and fever.


Question 17:

The basic scheme of the essential steps involved in the process of recombinant DNA technology is summarized below in the form of a flow diagram. Study the given flow diagram and answer the questions that follow.

Step-1 Vector DNA (cut using Restriction Enzyme EcoR I) + Alien DNA (cut using Restriction Enzyme EcoR I) \(\rightarrow\) Enzyme A

Step-2 Recombinant DNA molecule

Step-3 Transfer of recombinant DNA molecule in E. coli (Host)

Step-4 Replication of recombinant DNA molecule in E. coli

(a) Name the enzyme used in Step-1 to join the cut plasmid and alien DNA.

(b) State the technical term used for Step-3.

(c) Justify the use of same Restriction Enzyme EcoR I to cut both the vector DNA and the alien DNA.

Correct Answer:
View Solution



(a) The enzyme A used to join the cut plasmid (vector DNA) and alien DNA is DNA Ligase.


(b) The technical term for Step-3, the transfer of the recombinant DNA molecule into the host cell (E. coli), is Transformation.


(c) Using the same restriction enzyme (EcoR I) to cut both the vector and the alien DNA is essential because it generates identical complementary "sticky ends" on both DNA molecules.


These sticky ends can then pair with each other through hydrogen bonds.


This precise pairing facilitates the action of DNA ligase to form phosphodiester bonds, effectively joining the alien DNA into the vector to create a recombinant DNA molecule.
Quick Tip: Remember the key enzymes in rDNA technology: Restriction enzymes are 'molecular scissors' that cut DNA at specific sites, and DNA ligase is 'molecular glue' that joins DNA fragments by forming phosphodiester bonds.


Question 18:

Explain how the interaction between sea anemone and clownfish is one of the best examples of commensalism in nature.

Correct Answer:
View Solution



The interaction between a sea anemone and a clownfish is a classic example of commensalism.


Commensalism is a type of population interaction in which one species benefits, and the other is neither harmed nor benefited (+/0 interaction).


In this relationship, the clownfish gains a significant benefit.


It gets protection from predators by living amongst the stinging tentacles of the sea anemone, to which the clownfish is immune.


The sea anemone, on the other hand, is neither harmed nor does it derive any apparent benefit from the presence of the clownfish.
Quick Tip: Distinguish between the key symbiotic interactions: Mutualism (+/+), Commensalism (+/0), and Parasitism (+/-). Focusing on whether the effect is positive, negative, or neutral for each partner helps in identification.


Question 19:

Correctly depict (also indicate the trophic level) and describe the ecological pyramid of biomass in sea with 40 standing crop of phytoplankton supporting 90 standing crop of zooplankton which further supports 120 small fishes.

Correct Answer:
View Solution



The ecological pyramid of biomass for the described sea ecosystem is inverted.


Depiction of the Pyramid:


Trophic Level 3 (TC): Small Fishes (Standing Crop = 120 units)


Trophic Level 2 (PC): Zooplankton (Standing Crop = 90 units)


Trophic Level 1 (P): Phytoplankton (Standing Crop = 40 units)


Description:


This pyramid is inverted because the biomass of the producers (phytoplankton) at any given point in time is less than the biomass of the primary consumers (zooplankton) and secondary consumers (small fishes).


This phenomenon occurs in aquatic ecosystems because phytoplankton are microscopic producers with a very short life span and a high turnover rate (they are consumed as fast as they are produced).


Even though their productivity is high over time, their standing crop at any moment is low.
Quick Tip: While the pyramid of biomass can be inverted in aquatic ecosystems, the pyramid of energy is always upright. This is because there is a progressive loss of energy at each successive trophic level according to the 10% law.


Question 20:

Assume that the given mRNA (start site is not depicted) is theoretically translated in two reading frames.

(a) Translation starting from the first nucleotide (Reading frame 1)

Frame 1 : 5' - CUCGCUUGCCGAUCAAGGGUUA – 3'

(b) Translation starting from the second nucleotide (Reading frame 2)

Frame 2 : 5' – GUGGCACUCAGUCCUUAAUGGCG – 3'

Answer the following question :

How many amino acids will be specified in case (a) and case (b) on translation ? Justify your answer.

Correct Answer:
View Solution



The number of amino acids specified is determined by the number of readable codons (triplets of nucleotides) before a stop codon.


Case (a) using Frame 1 mRNA:


The mRNA sequence is 5' - CUCGCUUGCCGAUCAAGGGUUA – 3'.


Grouping into codons from the first nucleotide: CUC, GCU, UGC, CGA, UCA, AGG, GUU.


There are 7 complete codons. Assuming none of these are stop codons, the sequence will code for 7 amino acids.


Case (b) using Frame 2 mRNA:


The question implies using the sequence labeled "Frame 2" for case (b), assuming translation starts from the first nucleotide shown.


The mRNA sequence is 5' – GUGGCACUCAGUCCUUAAUGGCG – 3'.


Grouping into codons: GUG, GCA, CUC, AGU, CCU, UAA, UGC.


The codon UAA is a stop codon, which terminates translation and does not code for an amino acid.


The codons that are translated before the stop codon are GUG, GCA, CUC, AGU, and CCU.


Therefore, the sequence will code for 5 amino acids.
Quick Tip: When asked to find the number of amino acids, always read the mRNA sequence in triplets and be vigilant for the three stop codons: UAA ("U Are Away"), UAG ("U Are Gone"), and UGA ("U Go Away").


Question 21:

Explain how the immunity of a person is affected if there is atrophy (degeneration) of the thymus gland at an early stage of life.

Correct Answer:
View Solution



The thymus gland is a primary lymphoid organ essential for the maturation and differentiation of T-lymphocytes (T-cells).


T-lymphocytes are responsible for cell-mediated immunity (CMI).


If the thymus gland degenerates at an early stage of life, the production of mature, functional T-cells will be severely impaired.


This leads to a deficient cell-mediated immunity.


As a result, the person's ability to fight off certain pathogens, especially intracellular ones like viruses and fungi, would be drastically weakened.


Furthermore, since helper T-cells are crucial for activating B-lymphocytes to produce antibodies, humoral immunity would also be compromised, leading to overall severe immunodeficiency.
Quick Tip: Associate primary lymphoid organs with lymphocyte maturation: Bone marrow for B-cells and Thymus for T-cells. B for Bone, T for Thymus. A defect in these organs affects the production of immune cells.


Question 22:

(i) What are interferons ? Explain their role in providing immunity to a person.

(ii) Which category of innate immunity defence barrier can interferons be classified into ?

Correct Answer:
View Solution



(i) Interferons are a group of signaling proteins called cytokines that are produced and released by virus-infected cells.


Role in immunity: Their primary role is to provide non-specific, innate immunity against viral infections.


When a cell is infected by a virus, it releases interferons.


These interferons bind to receptors on nearby uninfected cells, inducing them to produce antiviral proteins.


These antiviral proteins block viral replication, thus protecting the neighboring cells from becoming infected.


(ii) Interferons are classified under the cytokine barrier of innate immunity.
Quick Tip: Interferons "interfere" with viral replication. They are part of the body's early warning system against viruses, acting as a local alert to protect neighboring cells before the adaptive immune system responds.


Question 23:

Write two features of an ideal contraceptive. Explain any one natural contraceptive method that makes the chances of conception almost nil.

Correct Answer:
View Solution



Two features of an ideal contraceptive are:


1. It should be effective and reliable in preventing pregnancy.


2. It should be user-friendly, easily available, and reversible with minimal or no side-effects.


A natural contraceptive method with very low chances of conception is Lactational Amenorrhea.


This method is based on the biological fact that during the period of intense lactation following childbirth, ovulation and the menstrual cycle do not occur.


The high levels of the hormone prolactin, which stimulates milk production, inhibit the hormones (GnRH, LH, FSH) needed for ovulation.


This method is highly effective for a maximum period of up to six months, but only if the mother is breastfeeding the child fully and her menstrual cycle has not resumed.
Quick Tip: The effectiveness of Lactational Amenorrhea depends critically on three conditions: (1) the mother is less than 6 months postpartum, (2) she is exclusively or fully breastfeeding, and (3) she has not had a menstrual period (amenorrhea).


Question 24:

Explain GIFT and ICSI.

Correct Answer:
View Solution



GIFT (Gamete Intra-Fallopian Transfer):


GIFT is an assisted reproductive technology (ART) for infertility treatment.


In this procedure, eggs are collected from the ovary of a female (either the patient or a donor) and are placed, along with sperm, into her fallopian tube.


Fertilization then occurs inside the body (in vivo) in the fallopian tube, which is the natural site of fertilization.


This method is suitable for women who cannot produce eggs but have at least one functional fallopian tube and a uterus that can support a pregnancy.


ICSI (Intra-Cytoplasmic Sperm Injection):


ICSI is a specialized form of In Vitro Fertilization (IVF).


It is used primarily to overcome problems of severe male infertility, such as very low sperm count or poor sperm motility.


In this laboratory procedure, a single, healthy sperm is selected and injected directly into the cytoplasm of a mature egg.


Once fertilization occurs and an embryo develops, it is transferred into the woman's uterus.
Quick Tip: Remember the key difference by their names: GIFT involves transferring Gametes (sperm and egg) into the fallopian tube for in-vivo fertilization. ICSI involves Injecting a single sperm into the Cytoplasm of an egg for in-vitro fertilization.


Question 25:

Explain the biological treatment of primary effluent when passed into the large aeration tanks in a sewage treatment plant (STP).

Correct Answer:
View Solution



The biological treatment of primary effluent is the secondary treatment stage in an STP.


1. The primary effluent is passed into large aeration tanks where it is constantly agitated mechanically and air is pumped into it.


2. This encourages the vigorous growth of useful aerobic microbes into flocs (masses of bacteria associated with fungal filaments to form mesh-like structures).


3. While growing, these microbes consume the major part of the organic matter in the effluent.


4. This significantly reduces the Biochemical Oxygen Demand (BOD) of the effluent. BOD is a measure of the organic matter present in the water.


5. Once the BOD is reduced, the effluent is passed into a settling tank where the bacterial flocs are allowed to sediment. This sediment is called activated sludge.


6. A small part of the activated sludge is pumped back into the aeration tank to serve as an inoculum, while the remaining major part is pumped into large anaerobic sludge digesters.
Quick Tip: Remember that the core purpose of secondary (biological) treatment is to reduce the BOD. High BOD indicates high pollution potential, so a lower BOD means cleaner water. The key players are the aerobic microbes in the "flocs".


Question 26:

Given below is a flower with its characteristic features specialised for the most common type of abiotic pollination.

Answer the following questions based on the above diagram :





(a) Name the mode of abiotic pollination that will be adopted by the given plant species in the above picture.

(b) State the need of exposed large feathery stigmas for the flower.

(c) What will be the two important adaptations in the pollen grains of the flowers pollinated by the above mode of pollination ?

(d) What could be the probable reason for the petals being small and non-green ?

Correct Answer:
View Solution



(a) The mode of abiotic pollination shown is Anemophily (pollination by wind).


(b) The large, feathery, and exposed stigmas are an adaptation to efficiently trap the light, airborne pollen grains from the wind.


(c) Two important adaptations of the pollen grains are:

1. They are light-weight and non-sticky so they can be easily transported by wind currents.

2. They are produced in very large numbers to compensate for the uncertainty and wastage of pollen during wind transport.


(d) The petals are small and non-green (or inconspicuous) because wind-pollinated flowers do not need to attract pollinators like insects or birds. Therefore, the plant does not expend energy in producing large, colourful, or nectar-filled petals.
Quick Tip: Wind-pollinated (anemophilous) flowers share common features: inconspicuous petals, no nectar, well-exposed stamens, large feathery stigmas, and light, non-sticky pollen produced in huge quantities.


Question 27:

Enlist one advantage and two disadvantages of green revolution.

Correct Answer:
View Solution



One Advantage:


1. Increased Food Production: The green revolution led to a dramatic increase in the production of food grains (like wheat and rice), which helped countries like India achieve self-sufficiency and reduce famine.


Two Disadvantages:


1. Environmental Pollution: The increased use of agrochemicals like fertilizers and pesticides led to soil and water pollution, harming the ecosystem.


2. Depletion of Groundwater: The high-yielding crop varieties required intensive irrigation, leading to the over-utilization and depletion of groundwater resources in many areas.
Quick Tip: Remember that the Green Revolution was based on three pillars: high-yielding varieties (HYVs) of crops, increased use of chemical fertilizers and pesticides, and expanded irrigation facilities. The advantages and disadvantages stem directly from these pillars.


Question 28:

Study the given below single strand of deoxyribonucleic acid depicted in the form of a "stick" diagram with 5' – 3' end directionality, sugars as vertical lines and bases as single letter abbreviations and answer the questions that follow.





(a) Name the covalent bonds depicted as (a) and (b) in the form of slanting lines in the diagram.

(b) How many purines are present in the given “stick” diagram ?

(c) Draw the chemical structure of the given polynucleotide chain of DNA.

Correct Answer:
View Solution



(a) The slanting lines (a) and (b) represent the covalent bonds that form the sugar-phosphate backbone. Both are parts of the phosphodiester bond that links successive nucleotides together. Specifically, bond (b) is the phosphodiester bond linking the 3' carbon of one sugar to the 5' carbon of the next sugar via a phosphate group.


(b) Purines are nitrogenous bases with a double-ring structure. In DNA, the purines are Adenine (A) and Guanine (G). The given strand has the sequence A-T-G. Therefore, there are two purines (A and G) present.


(c) The chemical structure of the polynucleotide chain (5'-ATG-3') is as follows:
Quick Tip: Remember the difference between the two types of bases: Purines (Adenine, Guanine) have a "pure" double ring structure, while Pyrimidines (Cytosine, Thymine, Uracil) have a single ring. You can remember "CUT the Pyramid".


Question 29:

Thomas Hunt Morgan carried out several dihybrid crosses in Drosophila melanogaster to study genes that were sex linked.

(a) Give four major reasons for using the tiny fruit flies by Morgan for his experiments.

(b) How did Morgan and his group explain the physical association of the two genes on a chromosome to the frequency of recombination between gene pairs on the same chromosome ?

Correct Answer:
View Solution



(a) Four major reasons for using Drosophila melanogaster are:

1. Short Life Cycle: They complete their life cycle in about two weeks, allowing for the study of many generations in a short time.

2. High Fecundity: A single mating can produce a large number of offspring, providing a large sample size for statistical analysis.

3. Clear Differentiation of Sexes: The male and female flies are easily distinguishable.

4. Many Heritable Variations: They have many types of easily observable hereditary variations.


(Additional reasons: They can be grown on a simple synthetic medium in the laboratory; they have only four pairs of chromosomes which are large and can be observed under a microscope.)


(b) Morgan and his group explained the relationship as follows:

They coined the term "linkage" to describe the physical association of genes on the same chromosome.


They observed that when two genes in a dihybrid cross were located very close to each other on the same chromosome (tightly linked), the parental gene combinations were much more frequent than the non-parental (recombinant) types. The frequency of recombination was low.


Conversely, when genes were located farther apart on the same chromosome (loosely linked), the frequency of recombination was higher, and more non-parental combinations were observed.


Thus, they concluded that the frequency of recombination between two gene pairs is a measure of the physical distance between them on the chromosome.
Quick Tip: Key takeaway from Morgan's work: Linkage is the tendency of genes on the same chromosome to be inherited together. Recombination frequency is directly proportional to the distance between linked genes.


Question 30:

Explain the process of formation of placenta in a human female after the implantation of the blastocyst in the endometrium of the uterus.

Correct Answer:
View Solution



After implantation, the process of placenta formation begins.


1. The outer layer of the blastocyst, the trophoblast, develops finger-like projections called chorionic villi.


2. These chorionic villi grow and invade the uterine tissue, the endometrium.


3. The chorionic villi and the uterine tissue become intimately interdigitated (interlocked) with each other.


4. This composite structure, formed from both fetal tissue (chorionic villi) and maternal tissue (uterine wall), is called the placenta.


5. The placenta establishes a structural and functional connection between the developing embryo (fetus) and the maternal body.


6. An umbilical cord develops, which connects the embryo to the placenta, facilitating the transport of substances.
Quick Tip: The placenta is a unique organ formed from both maternal and fetal tissues. Remember its major functions: Nutrition, Respiration, Excretion, and as an Endocrine gland (producing hormones like hCG, hPL, estrogens, progesterone).


Question 31:

According to a recent wildlife report, the biggest threat to the tiger's survival in Mudumalai Tiger Reserve (MTR) was found to be a small, beautiful flower, Lantana camara, a tropical American shrub, that invaded 40% of India's tiger range. Tamil Nadu department's Lantana weed eradication drive helped to restore the dying MTR thereby also reducing human-wildlife conflicts. MTR is home to 25 species of grasses and legumes.

Answer the given questions based on the information given above.

(a) Explain how did the removal of Lantana help in restoring the dying Mudumalai Tiger Reserve.

(b) Why is the invasion of Lantana camara a cause of concern in MTR.

Correct Answer:
View Solution



(a) The removal of Lantana helped restore the MTR in the following way:


Lantana camara is an invasive alien species that grows into dense thickets.

It outcompetes and suppresses the growth of native vegetation, including the 25 species of grasses and legumes mentioned.

These native plants are the primary food source for herbivorous animals like deer and gaur, which are the main prey for tigers.

By eradicating Lantana, the native grasses and legumes could regrow, which restored the food base for the herbivores.

A healthy herbivore population in turn supports a healthy tiger population, thus restoring the tiger reserve's ecosystem.


(b) The invasion of Lantana camara is a cause of concern for several reasons:


1. Loss of Biodiversity: It is an invasive species that displaces native flora, leading to a reduction in local plant biodiversity.

2. Disruption of Food Web: By reducing the availability of forage for herbivores, it disrupts the natural food chain, negatively impacting the prey base for carnivores like the tiger.

3. Increase in Human-Wildlife Conflict: When herbivores are unable to find sufficient food within the forest due to Lantana invasion, they may move into human settlements and agricultural fields, increasing the chances of human-wildlife conflict.
Quick Tip: Invasive alien species are a major threat to biodiversity. They cause ecological imbalance by outcompeting native species for resources, which disrupts the entire food web. Lantana camara is a prime example.


Question 32:

Read the following passage and answer the questions that follow.

Deaths related to the use of drugs were estimated at about 5,00,000 in 2019, 17.5 percent more than in 2009. Liver diseases attributed to Hepatitis B are a major cause of drug-related deaths, according to UNODC, accounting for more than half of the total number of deaths attributed to the use of drugs. Drug overdoses account for a quarter of drug-related deaths. Opioids contribute to account for the most severe drug-related harm, including fatal overdoses, when used non-medically. At the global level, two-third of direct drug-related deaths are due to opioids, and in some sub-regions the proportion can be as high as three-quarters of such deaths.

(a) Why are people taking opioids more prone to liver diseases attributed to Hepatitis B ?

(b) What is meant by direct drug-related disease ?

(c) (i) What is the scientific name of the plant from which the opioids are derived and from which part of the plant is it extracted? OR (ii) State two common warning signs of drug abuse among the youth.

Correct Answer:
View Solution



(a) People abusing opioids, particularly those administered intravenously (by injection), are more prone to Hepatitis B.


This is because the Hepatitis B virus is blood-borne and is commonly transmitted through the sharing of infected needles and syringes among drug users.


(b) As mentioned in the passage, direct drug-related disease or death refers to harm caused directly by the pharmacological effects of the substance itself.


For opioids, this primarily means fatal overdoses, which often cause respiratory depression (breathing stops).


(c) (i) The scientific name of the plant from which many opioids are derived is the opium poppy, \textit{Papaver somniferum.


The substance (latex) is extracted from the unripe capsule (fruit) of the plant.


OR


(c) (ii) Two common warning signs of drug abuse among youth are:


1. A sudden drop in academic performance and unexplained absences from school or college.


2. Withdrawal from social and family activities, isolation, and a change in friend circles.
Quick Tip: When answering case-based questions, first try to find the answer directly in the text. If the text provides context but not the direct answer (like in part 'a'), use your biological knowledge that fits the context (e.g., mode of transmission of diseases).


Question 33:

Read the following passage and answer the questions that follow.

The most convincing evidence to trace evolutionary relationships between humans and different groups of animals come from the basic similarities seen at the molecular level. Study the table given below that depicts the number of amino acid differences between the haemoglobin polypeptide of few animals with that of humans and answer the questions that follow.

S.No. & Animal & No. of amino acid differences in

& & haemoglobin with that of humans

1. & Macaque & 08

2. & Dog & 32

3. & Bird & 45

4. & Frog & 67

5. & Lamprey & 125


(a) To which category of evolution (Divergent or Convergent) do the following evolutionary relationships belong to : (i) Humans and Macaque (ii) Humans and Frog

(b) What do the biochemical similarities in haemoglobin suggest about the evolutionary relationship between humans, frog and lamprey ?

(c) (i) Which one of the two – lampreys' or macaques' evolution is more closely related to humans and why? OR (ii) Which one of the two – frogs' or dogs' evolution is more closely related to humans and why?

Correct Answer:
View Solution



(a) The evolutionary relationships between humans and macaques, and humans and frogs, belong to Divergent evolution.


This is because these organisms are believed to have originated from a common ancestor and have accumulated differences (diverged) over time.


(b) The biochemical similarities (i.e., the presence of a structurally similar haemoglobin molecule) in diverse organisms like humans, frogs, and lampreys suggest that they share a common ancestry.


(c) (i) The macaque is more closely related to humans.


Reason: The number of amino acid differences in haemoglobin between macaques and humans is only 8, whereas between lampreys and humans, it is 125.


A smaller number of differences indicates a more recent common ancestor.


OR


(c) (ii) The dog is more closely related to humans.


Reason: The number of amino acid differences between dogs and humans is 32, which is less than the 67 differences between frogs and humans.


Fewer molecular differences imply a closer evolutionary relationship.
Quick Tip: The fundamental principle of molecular evolution: The degree of similarity in the DNA or protein sequences between two species is a measure of their evolutionary relatedness. Fewer differences mean a more recent common ancestor.


Question 34:

(i) Describe the population growth curve applicable in a population of any species in nature that has limited resources at its disposal.

(ii) Give the equation of this growth curve.

(iii) Name the growth curve and depict a graphical plot for this type of population growth.

Correct Answer:
View Solution



(i) When resources are limited, a population initially exhibits a lag phase with slow growth.


This is followed by phases of acceleration (log phase) as the population adapts and begins to grow rapidly.


Eventually, as resources become scarce and environmental resistance increases, the growth rate slows down and the population enters a deceleration phase.


Finally, the growth stops when the population size reaches the carrying capacity (K) of the environment, leading to an asymptote phase.


(ii) The equation for this growth curve is:
\(dN/dt = rN((K-N)/K)\)

Where, N = Population density at time t, r = Intrinsic rate of natural increase, and K = Carrying capacity.


(iii) This growth curve is called the Logistic Growth Curve or S-shaped curve.


Graphical Plot:

The plot shows population density (N) on the Y-axis against time (t) on the X-axis. The curve is S-shaped, starting slow, rising steeply, and then leveling off at the carrying capacity (K).
Quick Tip: Contrast the S-shaped (Logistic) curve with the J-shaped (Exponential) curve. Logistic growth is realistic (limited resources, K), while exponential growth is idealistic (unlimited resources, no K). Remember the equations for both.


Question 35:

(i) Explain the Species-Area relationship within a natural forest and also predict the nature of graph when species richness is plotted against the area for a wide variety of taxa.

(ii) Depict the graphical relationship between species richness and area.

(iii) Give the equation of the Species-Area relationship for a wide variety of taxa on a logarithmic scale.

Correct Answer:
View Solution



(i) The Species-Area relationship, studied by Alexander von Humboldt, states that within a region, species richness increases with increasing explored area, but only up to a certain limit.


When species richness is plotted against area for a wide variety of taxa (like birds, bats, or angiosperms), the graph is a rectangular hyperbola.


(ii) Graphical Relationship:

The plot shows species richness (S) on the Y-axis and area (A) on the X-axis. The curve starts rising steeply and then becomes less steep and flatter.


(iii) On a logarithmic scale, the relationship becomes a straight line. The equation is:
\(log S = log C + Z log A\)

Where, S = Species richness, A = Area, Z = Slope of the line (regression coefficient), and C = Y-intercept.
Quick Tip: Remember that the value of Z (the slope) is important. For small areas, Z is typically 0.1-0.2. For very large areas like entire continents, the slope is much steeper, with Z values in the range of 0.6-1.2.


Question 36:

(i) Explain how does double fertilisation take place in a flowering plant.

(ii) Write the fate of the products of double fertilization in these plants.

Correct Answer:
View Solution



(i) Double fertilization is a unique process in flowering plants (angiosperms).


1. After pollination, the pollen grain germinates on the stigma to form a pollen tube, which grows down through the style and enters the ovule.


2. The pollen tube carries two male gametes. It enters one of the synergids in the embryo sac.


3. The pollen tube then releases the two male gametes into the cytoplasm of the synergid.


4. One male gamete fuses with the egg cell to complete syngamy. This results in the formation of a diploid zygote.


5. The other male gamete moves towards the two polar nuclei located in the central cell and fuses with them to produce a triploid Primary Endosperm Nucleus (PEN). This is called triple fusion.


Since two types of fusions (syngamy and triple fusion) occur in the embryo sac, the phenomenon is termed double fertilization.


(ii) Fate of the products:


1. The diploid Zygote develops into the embryo.


2. The triploid Primary Endosperm Nucleus (PEN) develops into the endosperm, which is a nutritive tissue that provides food for the developing embryo.
Quick Tip: Double Fertilization = Syngamy + Triple Fusion. Syngamy (male gamete + egg) forms the Zygote (2n). Triple Fusion (male gamete + 2 polar nuclei) forms the PEN (3n). The zygote becomes the embryo, and the PEN becomes the endosperm.


Question 37:

(i) Explain the structure of testicular lobules in human male reproductive system. Name the two types of cells present in the seminiferous tubules and state their role.

(ii) Describe the role of hypothalamic hormone GnRH in spermatogenesis.

Correct Answer:
View Solution



(i) Each testis is divided into about 250 compartments called testicular lobules.


Each lobule contains one to three highly coiled seminiferous tubules, which are the sites of sperm production.


The seminiferous tubules are lined on the inside by two types of cells:


1. Spermatogonia (male germ cells): These are the cells that undergo meiotic divisions to eventually form spermatozoa (sperms).


2. Sertoli cells (supporting cells): These cells provide structural support and nutrition to the developing germ cells.


The regions outside the seminiferous tubules, called interstitial spaces, contain Leydig cells which synthesize and secrete androgens like testosterone.


(ii) The hypothalamic hormone, Gonadotropin-releasing hormone (GnRH), plays a crucial role in regulating spermatogenesis.


1. At puberty, there is a significant increase in the secretion of GnRH from the hypothalamus.


2. GnRH acts on the anterior pituitary gland and stimulates the secretion of two gonadotropins: Luteinizing Hormone (LH) and Follicle-Stimulating Hormone (FSH).


3. LH acts on the Leydig cells, stimulating them to produce androgens (testosterone).


4. FSH acts on the Sertoli cells, which in turn stimulate the process of spermiogenesis (the final stage of sperm development). Testosterone is also required for this process.


Thus, GnRH initiates the hormonal cascade essential for spermatogenesis.
Quick Tip: Remember the hormonal axis for male reproduction: Hypothalamus (GnRH) \(\rightarrow\) Anterior Pituitary (LH & FSH). Then, LH \(\rightarrow\) Leydig cells \(\rightarrow\) Testosterone, and FSH \(\rightarrow\) Sertoli cells \(\rightarrow\) Spermiogenesis.


Question 38:

(i) Name the two genes encoding for the Bt toxin protein used in biotechnology for the control of cotton bollworms.

(ii) How does the expression of Bt toxin gene in Bt cotton plant help in providing resistance to cotton bollworms ? Explain.

Correct Answer:
View Solution



(i) The two genes encoding for the Bt toxin protein that control cotton bollworms are cryIAc and cryIIAb.


(ii) The Bt toxin gene, when expressed in the cotton plant, produces a protein crystal called the Cry protein.


This protein exists as an inactive protoxin in the plant.


When a bollworm ingests the plant tissue containing this protoxin, the alkaline pH of its midgut solubilizes the protein crystals.


The gut enzymes then activate the toxin.


The activated toxin binds to the surface of the midgut epithelial cells and creates pores in the cell membrane.


This leads to cell swelling and lysis, which disrupts the insect's digestive system.


Eventually, the insect stops feeding and dies, thus providing the plant with resistance against the bollworm.
Quick Tip: Remember that the Bt toxin is pest-specific and is harmless to humans and other animals because it requires an alkaline gut pH for activation, which is absent in mammals. The specificity comes from the different types of cry genes.


Question 39:

(i) Explain the given methods of introducing the alien DNA in the host cells : (I) Biolistics (II) Microinjection

(ii) How is E. coli made 'competent' to take up a recombinant plasmid or DNA ?

Correct Answer:
View Solution



(i) (I) Biolistics (Gene Gun): This is a method primarily used for transforming plant cells.


In this technique, microscopic particles of a heavy metal like gold or tungsten are coated with the alien DNA.


These particles are then bombarded at high velocity onto the target plant cells or tissues.


The particles penetrate the cell wall and cell membrane, delivering the DNA into the cells.


(II) Microinjection: This is a method where recombinant DNA is directly injected into the nucleus of a target cell.


It is commonly used for animal cells.


A very fine glass micropipette is used under a microscope to hold the target cell, and another fine needle is used to inject the DNA solution.


(ii) E. coli is made 'competent' to take up DNA by a chemical treatment process.


First, the bacterial cells are treated with a specific concentration of a divalent cation, such as calcium chloride (\(CaCl_2\)).


This treatment increases the efficiency with which DNA enters the bacterium by creating transient pores in its cell wall.


The cells are then incubated on ice with the recombinant DNA.


This is followed by a brief heat shock (placing them at about 42°C) and then putting them back on ice.


This sequence of temperature changes enables the bacteria to take up the recombinant DNA.
Quick Tip: For gene transfer, remember: Biolistics (Gene Gun) is for plants. Microinjection is for animal cells. Making bacteria 'competent' involves Calcium Chloride and Heat Shock.

*The article might have information for the previous academic years, please refer the official website of the exam.

Ask your question

Subscribe To Our News Letter

Get Latest Notification Of Colleges, Exams and News

© 2026 Patronum Web Private Limited