From the truth table, we observe that \( Y = 1 \) when:


\( A = 0 \) and \( B = 0 \), or
\( A = 1 \) and \( B = 0 \).


This can be written as: \[ Y = \overline{A} \cdot \overline{B} + A \cdot \overline{B}. \]

Factorizing \( \overline{B} \): \[ Y = \overline{B} (\overline{A} + A). \]

Using the complement property (\( \overline{A} + A = 1 \)): \[ Y = \overline{B}. \]

Thus, the Boolean expression for \( Y \) is \( \overline{B} \). Quick Tip: For Boolean simplifications, always apply complement properties and factorization to reduce the expression efficiently.

When a wheel rolls on a level surface:

The linear speed of the wheel's center of mass is \( v \).
The highest point on the wheel (point \( P \)) has a speed equal to the sum of the linear speed and rotational speed of the wheel: \( v + v = 2v \).
The lowest point on the wheel (point \( Q \)) has zero speed relative to the ground due to the rolling condition.


Therefore: \[ Speed of P = 2v, \quad Speed of Q = 0. \]

Thus, point \( P \) moves faster than point \( Q \). Quick Tip: In rolling motion, the point at the top of the wheel moves fastest, while the point at the bottom (in contact with the ground) has zero speed relative to the ground.

- In this circuit, we need to find the equivalent capacitance between points A and B.
- To do this, we first identify how the capacitors are connected: whether in series or parallel.
- The formula for capacitors in parallel is: \[ C_{eq} = C_1 + C_2 + C_3 + \dots \]
- The formula for capacitors in series is: \[ \frac{1}{C_{eq}} = \frac{1}{C_1} + \frac{1}{C_2} + \frac{1}{C_3} + \dots \]
- By analyzing the circuit, we first calculate the total capacitance for the series combination of the two capacitors, and then add the resulting equivalent capacitance in parallel with another capacitor.
- After solving, the equivalent capacitance between terminals A and B is found to be \( 2 \).

Thus, the correct answer is (1) \( 2 \). Quick Tip: For capacitors in parallel, simply add the capacitances. For capacitors in series, use the reciprocal formula to find the equivalent capacitance.

- The displacement of the particle is given as \( x = 2t - 1 \).
- To find the instantaneous power, we first need to find the velocity of the particle. Velocity is the derivative of displacement with respect to time: \[ v = \frac{dx}{dt} = \frac{d}{dt}(2t - 1) = 2 \, m/s. \]
- Instantaneous power is given by the formula: \[ P = F \cdot v, \]
where \( F \) is the force and \( v \) is the velocity.
- Given that \( F = 5 \, N \) and \( v = 2 \, m/s \), the instantaneous power is: \[ P = 5 \times 2 = 10 \, W. \]

Thus, the correct answer is (1) 10. Quick Tip: To calculate instantaneous power, multiply the force applied to an object by its instantaneous velocity: \( P = F \cdot v \).

The potential at any axial point for a dipole is given by the formula: \[ V = \pm \frac{1}{4 \pi \varepsilon_0} \frac{P}{r^2} \]
Where:
- \(P\) is the dipole moment,
- \(r\) is the distance from the dipole,
- \(\varepsilon_0\) is the permittivity of free space.


Given:
- \(P = 4 \times 10^{-6} \, C m\),
- \(r = 2 \, m\),
- \( \frac{1}{4 \pi \varepsilon_0} = 9 \times 10^9 \, SI units\).


Substituting these values into the formula: \[ V = \pm \frac{9 \times 10^9 \times 4 \times 10^{-6}}{2^2} \] \[ V = \pm \frac{36 \times 10^3}{4} = \pm 9 \times 10^3 \, V \]


Thus, Assertion A is true. However, Reason R is false because it incorrectly states the potential formula. The correct formula is \(V = \pm \frac{1}{4 \pi \varepsilon_0} \frac{P}{r^2}\), but Reason R has an incorrect expression.

Thus, the correct answer is: \(\boxed{3}\). Quick Tip: For the potential due to a dipole at an axial point, the formula is: \[ V = \frac{1}{4 \pi \epsilon_0} \frac{P}{r^3} \] Ensure the correct power of \( r \) is used in dipole-related potential calculations.

In a completely inelastic collision, the two bodies stick together after the collision, and their final velocity is the same.

Using the principle of conservation of momentum:
\[ m v_1 + m \cdot 0 = 2m v_2 \]

where:
- \( m \) is the mass of each body (same mass),
- \( v_1 \) is the velocity of body A before the collision,
- \( v_2 \) is the common velocity of both bodies after the collision.

Simplifying the equation:
\[ m v_1 = 2m v_2 \] \[ v_1 = 2 v_2 \] \[ \frac{v_1}{v_2} = 2 \]

Thus, the ratio \( v_1 : v_2 = 2 : 1 \). Quick Tip: In a completely inelastic collision, the bodies stick together after the collision, and the velocity of the combined mass is found by applying the conservation of momentum.

- The formula for the time period \( T \) of a magnetic needle performing oscillations in a magnetic field is given by: \[ T = 2\pi \sqrt{\frac{I}{mB}}, \]
where:
- \( T \) is the time period,
- \( I \) is the moment of inertia of the needle,
- \( m \) is the mass of the needle,
- \( B \) is the magnetic field strength.

- We are given that the magnetic field \( B = 0.049 \, T \), the moment of inertia \( I = 9.8 \times 10^{-6} \, kg \cdot m^2 \), and the needle completes 20 oscillations in 5 seconds. Thus, the time period \( T \) is: \[ T = \frac{5}{20} = 0.25 \, seconds. \]

- Substituting \( T = 0.25 \, s \) into the formula, we solve for the magnetic moment \( m \): \[ 0.25 = 2\pi \sqrt{\frac{9.8 \times 10^{-6}}{m \cdot 0.049}}, \] \[ m = \frac{9.8 \times 10^{-6}}{(0.25 / (2\pi))^2 \cdot 0.049}. \]
- Solving for \( m \), we find: \[ m = 1280 \pi^2 \times 10^{-5} \, Am^2. \]

Thus, the value of \( x \) is \( 1280\pi^2 \), and the correct answer is (4). Quick Tip: The time period for oscillations of a magnetic needle is related to its moment of inertia and the magnetic field strength. Use the formula \( T = 2\pi \sqrt{\frac{I}{mB}} \) to calculate the magnetic moment.

When unpolarised light strikes a surface at Brewster's angle, the reflected light becomes completely polarised. Brewster's angle \( \theta_B \) is the angle at which the angle of reflection is perpendicular to the angle of refraction. At this angle:

\[ \tan \theta_B = \frac{n_2}{n_1} \]


where:
- \( n_1 \) is the refractive index of the first medium (e.g., air),
- \( n_2 \) is the refractive index of the second medium (e.g., glass).


At Brewster's angle, the reflected light is completely polarised in the plane of incidence, which means all the reflected light vibrates in a single plane.


However, the refracted light is not completely polarised. It remains partially polarised because some of the light waves still retain components of the original unpolarised light.


Thus:
The reflected light is completely polarised.


The refracted light remains partially polarised. Quick Tip: At Brewster's angle, the reflected light is completely polarised, while the refracted light remains partially polarised.

- Statement A: The current-voltage (I-V) characteristics of a solar cell are typically observed in the fourth quadrant (IV quadrant), which is the region where the current is negative (due to the reverse bias), and the voltage is positive.
- Statement B: In a reverse-biased pn junction diode, the current is due to minority charge carriers, not majority charge carriers. In reverse bias, the minority carriers (electrons in p-type and holes in n-type) contribute to the current.

Thus, the correct answer is (1) A is correct, but B is incorrect. Quick Tip: In reverse bias of a pn junction diode, current is due to minority charge carriers. For solar cells, the I-V characteristics are typically plotted in the fourth quadrant.

- The de Broglie wavelength \( \lambda \) is related to the momentum \( p \) of a particle by the equation: \[ \lambda = \frac{h}{p}, \]
where \( h \) is Planck's constant.
- The kinetic energy \( E \) of a particle is related to its momentum by: \[ E = \frac{p^2}{2m}. \]
- Combining these equations, we get a relationship between \( \frac{1}{\lambda} \) and \( E \), which is expected to be linear with a slope proportional to \( \frac{h^2}{2m} \).
- The graph that best matches this relationship is the one where \( \frac{1}{\lambda} \) is directly proportional to the kinetic energy \( E \), which corresponds to option (4).

Thus, the correct answer is (4) Option D. Quick Tip: The de Broglie wavelength is inversely proportional to the momentum of a particle. Since kinetic energy is proportional to the square of momentum, the relationship between \( \frac{1}{\lambda} \) and \( E \) will be linear.

- The total resistance in the circuit is the sum of the internal resistance of the battery (\( r = 1 \, \Omega \)) and the external resistance (\( R = 4 \, \Omega \)).
- The total resistance \( R_{total} \) is: \[ R_{total} = r + R = 1 + 4 = 5 \, \Omega \]
- The current \( I \) flowing in the circuit can be found using Ohm's law: \[ I = \frac{E}{R_{total}} = \frac{10}{5} = 2 \, A. \]
- The terminal voltage \( V_{terminal} \) is the potential difference across the external resistance, which is given by: \[ V_{terminal} = E - I \cdot r = 10 - 2 \cdot 1 = 10 - 2 = 8 \, V. \]

Thus, the correct answer is (3) 8 V. Quick Tip: The terminal voltage of a battery is found by subtracting the voltage drop across the internal resistance from the emf of the battery. Use \( V = E - I \cdot r \) to calculate it.

- Solid angle is a dimensionless quantity. It is defined as the ratio of the area subtended by an object to the square of the distance from the point of observation. Its SI unit is steradian (sr), which has no physical dimensions.
- Strain is a ratio of change in length to original length, and is also dimensionless.
- Angle, like solid angle, is a measure of rotation and is dimensionless.
- Stress, however, has dimensions of force per unit area (i.e., \( ML^{-1}T^{-2} \)) and is not dimensionless.
- Therefore, the only pair that is dimensionless and matches the dimension of solid angle is strain and angle.

Thus, the correct answer is (1) strain and angle. Quick Tip: Solid angle is a dimensionless quantity measured in steradians (sr). Strain and angle are also dimensionless, while stress and angular speed have physical dimensions.

- According to Faraday’s Law of Induction, the movement of a magnet through a coil induces a current in the coil. The direction of the induced current follows Lenz's Law, which states that the induced current will oppose the change that produced it.
- In solenoid-1, as the bar magnet moves towards the solenoid, it induces a current in the direction AB (to oppose the magnet's approach).
- In solenoid-2, the movement of the magnet towards solenoid-1 induces a current in the direction DC (to oppose the change in magnetic flux).

Thus, the correct answer is (1) AB and DC. Quick Tip: When a magnet moves through a solenoid, it induces a current whose direction opposes the motion of the magnet, as per Lenz's Law. The induced current is in such a direction that it opposes the change in the magnetic flux.

The moment of inertia \( I \) of a thin rod about an axis passing through its midpoint and perpendicular to the rod is given by the formula:
\[ I = \frac{1}{12} m L^2 \]

where:
- \( m \) is the mass of the rod,
- \( L \) is the length of the rod.

We are given:
- \( I = 2400 \, g cm^2 \),
- \( m = 400 \, g \).

Substituting the values into the formula:
\[ 2400 = \frac{1}{12} \times 400 \times L^2 \]

Simplifying:
\[ 2400 = \frac{400}{12} \times L^2 \] \[ 2400 \times 12 = 400 \times L^2 \] \[ 28800 = 400 \times L^2 \] \[ L^2 = \frac{28800}{400} = 72 \] \[ L = \sqrt{72} \approx 8.5 \, cm \]

Thus, the length of the rod is nearly 8.5 cm. Quick Tip: The moment of inertia of a thin rod about its midpoint is proportional to the square of its length.

The equation for simple harmonic motion is generally of the form: \[ x(t) = A \sin (\omega t + \phi) \]
Where:
- \(A\) is the amplitude,
- \(\omega\) is the angular frequency, and
- \(\phi\) is the phase constant.


Rewriting the given equation: \[ 5 \sin \left( \frac{\pi}{3} x - t \right) = \pi + \frac{\pi}{2} t \]
Comparing this with the standard SHM equation, we see that the amplitude \(A = 5 \, m\).


To find the time period \(T\), we can use the relation between angular frequency and time period: \[ \omega = \frac{2\pi}{T} \]
From the equation, \(\omega = \pi\). So:


Solving for \(T\): \[ T = 2 \, s \]


Thus, the amplitude is 5 meters and the time period is 2 seconds.


Therefore, the correct answer is: \(\boxed{(2) \, 5 \, m, 2 \, s}\). Quick Tip: For simple harmonic motion, the amplitude is the maximum displacement from the equilibrium position, and the time period is the time for one complete oscillation, given by \( T = \frac{2\pi}{\omega} \).

The acceleration due to gravity \( g \) on the surface of a planet is given by the formula: \[ g = \frac{GM}{R^2} \]


where:
- \( G \) is the gravitational constant,
- \( M \) is the mass of the planet,
- \( R \) is the radius of the planet.


We are given that:


The mass of the planet is \( \frac{1}{10} \)th that of the Earth, so \( M_{planet} = \frac{1}{10} M_{Earth} \),


The diameter of the planet is half that of the Earth, so \( R_{planet} = \frac{1}{2} R_{Earth} \), which implies \( R_{planet}^2 = \frac{1}{4} R_{Earth}^2 \).


Substituting these values into the formula for gravity:

\[ g_{planet} = \frac{G \left( \frac{1}{10} M_{Earth} \right)}{\left( \frac{1}{2} R_{Earth} \right)^2} \] \[ g_{planet} = \frac{G \left( \frac{1}{10} M_{Earth} \right)}{\frac{1}{4} R_{Earth}^2} \] \[ g_{planet} = \frac{4GM_{Earth}}{10 R_{Earth}^2} \] \[ g_{planet} = \frac{4}{10} g_{Earth} \] \[ g_{planet} = 0.4 g_{Earth} \]

Since the acceleration due to gravity on Earth is \( g_{Earth} = 9.8 \, m/s^2 \), we have:
\[ g_{planet} = 0.4 \times 9.8 = 3.92 \, m/s^2 \]

Thus, the acceleration due to gravity on the planet is 3.92 m/s². Quick Tip: The acceleration due to gravity is directly proportional to the mass of the planet and inversely proportional to the square of its radius.

- The total force applied to the system is 10 N. The total mass of the system is \( 2 \, kg + 3 \, kg = 5 \, kg \).
- Using Newton's second law, the acceleration of the system is: \[ a = \frac{F_{total}}{M_{total}} = \frac{10}{5} = 2 \, m/s^2 \]
- Now, the force exerted by block A on block B can be found using \( F = ma \), where \( m = 3 \, kg \) (the mass of block B): \[ F_{A on B} = 3 \times 2 = 6 \, N \]

Thus, the correct answer is (3) 6 N. Quick Tip: When multiple objects are in contact and there is no friction, use Newton’s second law to find the acceleration of the system and then apply \( F = ma \) to each object to find the force exerted.

The path \( bc \) in the cycle corresponds to an isochoric process, where the volume remains constant.


In an isochoric process, no work is done by the gas, because work done is given by \( W = P \Delta V \), and \( \Delta V = 0 \) for isochoric processes.


Therefore, the work done by the gas along path \( bc \) is zero.


Thus, the correct answer is (1) Zero. Quick Tip: In an isochoric process (constant volume), the work done by the gas is always zero, because there is no change in volume.

Statement I: "Atoms are electrically neutral as they contain equal number of positive and negative charges."


- This statement is correct. An atom consists of positively charged protons in the nucleus and negatively charged electrons orbiting around the nucleus. In a neutral atom, the number of protons equals the number of electrons, making the overall charge of the atom zero.


Statement II: "Atoms of each element are stable and emit their characteristic spectrum."


- This statement is incorrect. While atoms of each element have characteristic spectra, they are not necessarily stable in all conditions. For example, excited atoms (when an electron is promoted to a higher energy level) are not stable and will eventually return to the ground state, emitting radiation as they do so. Hence, the atom's emission spectrum is a result of these transitions, but the atom itself is not always in a stable state.


Thus, Statement I is correct but Statement II is incorrect. Quick Tip: Atoms are electrically neutral when the number of protons equals the number of electrons. However, atoms are not always stable and emit characteristic spectra when electrons transition between energy levels.

The given decay sequence involves a series of nuclear emissions, starting from \(^{290}_{82} Pb\), which undergoes decay via the following steps:


1. \( \beta \)-decay (electron emission) occurs, which increases the atomic number by 1 but leaves the mass number unchanged. This transforms \(^{290}_{82} Pb\) into \(^{290}_{83} Bi\).


2. The next emission involves the release of a proton, reducing the atomic number by 1 and the mass number by 4, thus transforming \(^{290}_{83} Bi\) into \(^{286}_{82} Tl\).


3. The final product, \( Q \), involves another emission, which further reduces the atomic number to 81 and mass number by 4, resulting in the isotope \(^{286}_{81} Tl\).


Thus, the correct answer is option (4) \(286, 81\). Quick Tip: In nuclear reactions: - A \( \beta \)-decay increases the atomic number by 1 but keeps the mass number constant. - A proton emission reduces both the atomic number by 1 and the mass number by 4.

When a particle moves with uniform speed along a circular path, the following occurs:


Velocity: Although the speed (magnitude of velocity) remains constant, the direction of the velocity vector keeps changing as the particle moves around the circle. Since velocity is a vector quantity, a change in direction means that the velocity is not constant. Therefore, the particle’s velocity is varying due to the change in direction.


Acceleration: In uniform circular motion, the particle experiences centripetal acceleration directed towards the center of the circle. This acceleration also varies in direction as the particle moves along the path, since it always points towards the center of the circle. The magnitude of acceleration remains constant (because speed is constant), but its direction changes continuously. Therefore, the acceleration is varying in direction.


Thus, the particle maintains varying velocity (due to the change in direction) and varying acceleration (due to the continuously changing direction of the centripetal acceleration). Quick Tip: In uniform circular motion, although the speed is constant, both velocity and acceleration vary because their directions change continuously.

The light ray enters the right-angled prism with an angle of incidence of 30° at point P. As the ray travels parallel to the base BC of the prism, we can apply Snell’s Law at the first interface and at the second interface.


From the condition that the ray travels parallel to the base, we can derive the refractive index of the prism using the concept of total internal reflection.


The critical angle \( \theta_c \) is given by \( \sin \theta_c = \frac{1}{n} \), where \( n \) is the refractive index of the prism.


Using the geometry of the situation and Snell’s Law, the refractive index of the prism is found to be \( \frac{\sqrt{5}}{2} \). Quick Tip: For light to travel parallel to the base of a right-angled prism, the angle of incidence must satisfy the condition for total internal reflection at the second interface.

In a Vernier Calliper, the Vernier Constant (VC) is defined as the smallest length that can be measured using the instrument. It is given by the difference between the value of one main scale division (MSD) and one Vernier scale division (VSD).


We are given that:

\( (N + 1) \) divisions of the Vernier scale coincide with \( N \) divisions of the main scale.


1 MSD represents 0.1 mm.


To calculate the Vernier Constant, we first calculate the value of one Vernier scale division (VSD):

\[ 1 MSD = 0.1 \, mm = 0.01 \, cm \]


The length corresponding to \( (N + 1) \) Vernier scale divisions is equal to the length corresponding to \( N \) main scale divisions. Therefore, the difference between 1 MSD and 1 VSD is:

\[ Vernier Constant (VC) = \frac{Length of N MSDs - Length of (N + 1) VSDs}{N + 1} \] \[ VC = \frac{N \times 0.1 \, mm - (N + 1) \times VSD}{N + 1} \]


Solving for the Vernier Constant, we get:

\[ VC = \frac{1}{100(N + 1)} \, cm \]


Thus, the Vernier constant is \( \frac{1}{100(N + 1)} \, cm \). Quick Tip: The Vernier constant is the difference between one main scale division and one Vernier scale division. It determines the least count of the instrument.

In Young's double slit experiment, when a monochromatic light source is used, the interference fringes formed on the screen are uniform in brightness and colour. However, when white light is used instead of monochromatic light, the situation changes due to the presence of multiple wavelengths in white light.


Central Bright White Fringe: All the wavelengths in white light have constructive interference at the central maximum, so the central fringe will appear white.


Colourful Fringes: Since the different wavelengths of light (corresponding to different colours) produce different fringe positions, the fringes will be coloured. Each colour will have its own interference pattern, leading to a few coloured fringes around the central white fringe.


Nature of the Fringes: The fringes will be of different colours, but their widths will not be uniform because the fringe width is dependent on the wavelength. Longer wavelengths (like red light) will produce wider fringes, while shorter wavelengths (like violet light) will produce narrower fringes.


Thus, when white light is used, we observe a central bright white fringe surrounded by a few coloured fringes. Quick Tip: When white light is used in Young's double slit experiment, the central fringe is white, and coloured fringes appear around it due to the different wavelengths of light in white light.

The energy of a photon is \( E = h\nu \)


This statement is correct. The energy \( E \) of a photon is directly proportional to its frequency \( \nu \), and the constant of proportionality is Planck's constant \( h \). So, \( E = h\nu \).


The velocity of a photon is \( c \)


This statement is also correct. Photons, being particles of light, always travel at the speed of light \( c \) in free space.


The momentum of a photon is \( p = \frac{h}{\nu c} \)


This statement is correct. The momentum \( p \) of a photon is given by \( p = \frac{h}{\lambda} \), where \( \lambda \) is the wavelength. Since \( \lambda = \frac{c}{\nu} \), we can rewrite the momentum as \( p = \frac{h\nu}{c} \).


In a photon-electron collision, both total energy and total momentum are conserved.


This statement is correct. In photon-electron interactions (like Compton scattering), both energy and momentum are conserved.


Photon possesses positive charge


This statement is incorrect. Photons are electrically neutral, meaning they do not possess any charge.

Thus, the correct statements are A, B, C, and D. Quick Tip: Photons have energy \( E = h\nu \), momentum \( p = \frac{h}{\lambda} \), and travel at the speed of light \( c \). They are electrically neutral and do not possess any charge.

- The given circuit diagram represents a logic gate with specific input-output behavior.
- An AND gate outputs 1 only when both its inputs are 1, and outputs 0 in all other cases. This behavior matches the output observed from the given circuit.
- Analyzing the truth table for the given gate confirms that it behaves like an AND gate. Quick Tip: For an AND gate: - Output is 1 only if both inputs are 1. - In all other cases, output is 0.

- The spectral lines of hydrogen are given by the transitions of electrons from higher energy levels to lower energy levels.
- The wavelengths corresponding to these transitions are given by the Rydberg formula. The Balmer series of hydrogen corresponds to transitions where \( n_1 = 2 \).
- By comparing the transition energies with the wavelengths of the lines, we match the following:
\[ \begin{aligned} A. & \quad n_2 = 3 \rightarrow n_1 = 2 \quad corresponds to wavelength \quad 656.3 \, nm
B. & \quad n_2 = 4 \rightarrow n_1 = 2 \quad corresponds to wavelength \quad 486.1 \, nm
C. & \quad n_2 = 5 \rightarrow n_1 = 2 \quad corresponds to wavelength \quad 434.1 \, nm
D. & \quad n_2 = 6 \rightarrow n_1 = 2 \quad corresponds to wavelength \quad 410.2 \, nm \end{aligned} \]

Thus, the correct match is: \[ A-III, B-IV, C-II, D-I \] Quick Tip: The wavelengths of the Balmer series in the hydrogen spectrum correspond to transitions from higher energy levels to the second energy level (\( n_1 = 2 \)).

When the disc is placed gently over the surface of the water, a film of water sticks to the surface of the disc due to surface tension. The excess force required to take the disc away from the water surface is due to the surface tension acting along the perimeter of the disc.

The excess force required to lift the disc is given by:
\[ F = Surface Tension \times Perimeter of the disc \]

The perimeter of the disc (which is a circle) is given by:
\[ Perimeter = 2\pi r \]

Given:
- \( r = 4.5 \, cm = 0.045 \, m \)
- Surface tension \( \sigma = 0.07 \, N/m \)

Now, calculating the perimeter of the disc:
\[ Perimeter = 2 \pi \times 0.045 = 0.2827 \, m \]

So, the excess force required to lift the disc is:
\[ F = 0.07 \times 0.2827 = 0.0198 \, N = 19.8 \, mN \]

Thus, the excess force required to take the disc away from the surface is 19.8 mN. Quick Tip: The excess force required to lift an object from the surface of a liquid is proportional to the surface tension and the perimeter of the object.

In an ideal transformer, the voltage ratio is related to the turns ratio by the following formula:
\[ \frac{V_S}{V_P} = \frac{N_S}{N_P} \]

Where:
- \( V_S \) and \( V_P \) are the voltages on the secondary and primary sides, respectively.


- \( N_S \) and \( N_P \) are the number of turns on the secondary and primary coils, respectively.

Given: \[ \frac{N_P}{N_S} = \frac{1}{2} \]

This implies: \[ \frac{N_S}{N_P} = 2 \]

So, the voltage ratio \( \frac{V_S}{V_P} \) is:
\[ \frac{V_S}{V_P} = 2 \]

Thus, \( V_S : V_P = 2 : 1 \). Quick Tip: In an ideal transformer, the voltage ratio is directly proportional to the turns ratio. If the turns ratio \( \frac{N_P}{N_S} = \frac{1}{2} \), then \( V_S : V_P = 2 : 1 \).

The maximum elongation \( \Delta L \) of the steel wire can be determined using the formula:

\[ \Delta L = \frac{F L}{A Y} \]


Where:

\( F \) is the force applied,

\( L \) is the original length of the wire,

\( A \) is the cross-sectional area of the wire,

\( Y \) is the Young’s modulus of the material.


The force applied \( F \) should not exceed the elastic limit, which is the maximum stress the material can withstand without permanent deformation. The stress is given by:

\[ Stress = \frac{F}{A} = Elastic Limit \]


Thus, the force \( F \) is:
\[ F = Elastic Limit \times A = 8 \times 10^8 \times A \]

The strain in the wire is related to the stress by:
\[ Strain = \frac{Stress}{Y} = \frac{8 \times 10^8}{2 \times 10^{11}} = 4 \times 10^{-3} \]

Strain is also given by:
\[ Strain = \frac{\Delta L}{L} \]

So:
\[ \frac{\Delta L}{L} = 4 \times 10^{-3} \]

Given that \( L = 1 \, m \), we get:
\[ \Delta L = 4 \times 10^{-3} \times 1 = 0.004 \, m = 4 \, mm \]

Thus, the maximum elongation is \( 4 \, mm \). Quick Tip: The maximum elongation of a material is determined by its elastic limit and Young's modulus. The elongation increases with the applied stress until the elastic limit is reached.

- The potential difference between the two points on the spherical shell depends on the electric field and the geometry of the shell.
- In the case of a uniformly charged spherical shell, the electric field outside the shell behaves as if all the charge were concentrated at the center of the shell. Inside the shell, however, the electric field is zero due to spherical symmetry (Gauss's Law).
- Since the points \( C \) and \( P \) are both inside the shell (or at the surface), the potential difference between them is zero.
- Therefore, the correct answer is (4), as there is no electric field inside the spherical shell to create a potential difference. Quick Tip: For a spherical shell with uniform charge distribution: - The electric field inside the shell is zero. - The potential is constant inside the shell, leading to no potential difference between points inside or on the surface.

Given:
- The total resistance of the wire is \( R_{total} = 100 \, \Omega \).
- The wire is divided into 10 equal parts, so the resistance of each part is \( R_{part} = \frac{100}{10} = 10 \, \Omega \).

Now, let’s analyze the combination:


Step 1: Resistance of first 5 parts in series
When resistors are connected in series, the total resistance is the sum of the individual resistances. So, for the first 5 parts connected in series:
\[ R_{series} = 5 \times 10 = 50 \, \Omega \]


Step 2: Resistance of next 5 parts in parallel
For the next 5 parts connected in parallel, the total resistance is given by the formula:
\[ \frac{1}{R_{parallel}} = \frac{1}{R_{part}} + \frac{1}{R_{part}} + \frac{1}{R_{part}} + \frac{1}{R_{part}} + \frac{1}{R_{part}} = \frac{5}{R_{part}} \]

Substituting \( R_{part} = 10 \, \Omega \):
\[ \frac{1}{R_{parallel}} = \frac{5}{10} = 0.5 \]

So, the total resistance of the 5 parts in parallel is:
\[ R_{parallel} = \frac{1}{0.5} = 2 \, \Omega \]


Step 3: Total resistance of the combination
Now, the two combinations (one in series and the other in parallel) are connected in series. When resistances are connected in series, the total resistance is the sum of the individual resistances. So:
\[ R_{final} = R_{series} + R_{parallel} = 50 + 2 = 52 \, \Omega \]

Thus, the resistance of the final combination is \( 52 \, \Omega \). Quick Tip: When combining resistors, remember the rules for series and parallel combinations: - Series: \( R_{total} = R_1 + R_2 + \dots \) - Parallel: \( \frac{1}{R_{total}} = \frac{1}{R_1} + \frac{1}{R_2} + \dots \)

The magnetic field at the centre of a circular coil of \( N \) turns carrying a current \( I \) is given by the formula:
\[ B = \frac{\mu_0 N I}{2R} \]

Where:
- \( B \) is the magnetic field at the centre,
- \( \mu_0 = 4\pi \times 10^{-7} \, N/A^2 \) is the permeability of free space,
- \( N \) is the number of turns,
- \( I \) is the current,
- \( R \) is the radius of the coil.

Given:
- \( N = 100 \),
- \( I = 7 \, A \),
- \( R = 10 \, cm = 0.1 \, m \).

Substitute these values into the formula:
\[ B = \frac{(4\pi \times 10^{-7}) \times 100 \times 7}{2 \times 0.1} \]

Simplifying:
\[ B = \frac{(4\pi \times 10^{-7}) \times 700}{0.2} \]
\[B = \frac{2800\pi \times 10^{-7}}{0.2}\]
\[B = 14000 \pi \times 10^{-7} \, T\]
\[B = 14000 \times 3.1416 \times 10^{-7} \, T\]
\[B \approx 4.4 \times 10^{-3} \, T = 4.4 \, mT\]

Thus, the magnetic field at the centre of the coil is 4.4 mT. Quick Tip: The magnetic field at the centre of a coil depends on the number of turns, the current, and the radius. The formula \( B = \frac{\mu_0 N I}{2R} \) is key to solving these problems.

- Diamagnetic materials have a very small negative susceptibility, which means they are weakly repelled by a magnetic field. Therefore, \( \chi = -1 \) or \( \chi = 0 \), and thus \( \chi \) lies between 0 and -1. This corresponds to option II.
- Ferromagnetic materials have a very large positive susceptibility, much greater than 1. This corresponds to option III.
- Paramagnetic materials have a small positive susceptibility, typically greater than 0 but less than 1, corresponding to option IV.
- Non-magnetic materials have a susceptibility of zero, meaning they are unaffected by a magnetic field, corresponding to option I.

Thus, the correct match is: \[ A-II, B-III, C-IV, D-I \] Quick Tip: - Diamagnetic materials: \( \chi = -1 \) to 0 (weakly repelled). - Ferromagnetic materials: \( \chi \gg 1 \) (strongly attracted). - Paramagnetic materials: \( 0 < \chi < 1 \) (weakly attracted). - Non-magnetic materials: \( \chi = 0 \).

The tension in the string that holds the bob moving in a horizontal circle is related to the centripetal force required to keep the bob in circular motion. The centripetal force \( F_{centripetal} \) is given by the formula:
\[ F_{centripetal} = m \omega^2 r \]

Where:
- \( m \) is the mass of the bob,
- \( \omega \) is the angular velocity (in radians per second),
- \( r \) is the radius of the circular path.

Thus, the initial tension \( T \) is:
\[ T = m \omega^2 r \]

Now, if the speed increases to \( 2\omega \), the new angular velocity becomes \( 2\omega \). The tension in the string at this new speed will be:
\[ T_{new} = m (2\omega)^2 r = m \cdot 4\omega^2 r = 4 m \omega^2 r \]

Since the initial tension is \( T = m \omega^2 r \), we can see that:
\[ T_{new} = 4T \]

Thus, when the speed becomes \( 2\omega \), the tension in the string increases by a factor of 4. Quick Tip: The tension in the string is proportional to the square of the speed (or angular velocity) for circular motion. Doubling the speed results in a fourfold increase in tension.

When a parallel plate capacitor is connected to a battery through a resistor, a current \( I \) flows through the circuit, charging the plates of the capacitor. As the capacitor charges, an electric field builds up between the plates.

However, between the plates of the capacitor, there is no physical current (as the plates are separated by an insulating material), but there is a displacement current. Displacement current \( I_d \) is defined as the rate of change of the electric field between the plates, which is related to the rate of charge accumulation on the plates. The displacement current \( I_d \) is given by:
\[ I_d = \frac{dQ}{dt} = I \]

Where \( Q \) is the charge on the plates and \( I \) is the current in the circuit. The displacement current is equal in magnitude to the current \( I \) in the circuit because it is a result of the charging process of the capacitor.

The displacement current flows in the same direction as the current in the external circuit because the direction of charge accumulation on the plates is consistent with the direction of the current flowing through the resistor and battery.

Thus, the displacement current in the gap between the plates has the same magnitude as the circuit current \( I \) and flows in the same direction. Quick Tip: Displacement current is not a physical current, but a concept introduced to account for the changing electric field between the plates of a capacitor. It is equal in magnitude to the current in the external circuit.

- The current in an AC circuit with a capacitor is given by the formula: \[ I = V_{max} \cdot \omega C \]
where \( V_{max} = 210 \, V \) is the peak voltage, \( \omega = 2 \pi f \) is the angular frequency, and \( C = 10 = 10 \times 10^{-6} \, F \) is the capacitance.
- The angular frequency \( \omega \) for a 50 Hz source is: \[ \omega = 2 \pi \times 50 = 314 \, rad/s \]
- Now, substituting the values into the formula for peak current: \[ I = 210 \times 314 \times 10 \times 10^{-6} = 0.93 \, A \] Quick Tip: The peak current in a capacitive AC circuit depends on the peak voltage, capacitance, and the frequency of the source. Use the formula \( I = V_{max} \cdot \omega C \) to calculate it.

The time period \( T \) of a simple pendulum is given by the formula:

\[ T = 2\pi \sqrt{\frac{L}{g}} \]


Where:
- \( T \) is the time period,
- \( L \) is the length of the pendulum,
- \( g \) is the acceleration due to gravity.


Notice that the time period \( T \) is independent of the mass of the bob, meaning that increasing or decreasing the mass does not affect the time period.


Now, let's analyze the situation where:
- The mass of the bob is increased to three times its original mass, and
- The length of the pendulum is reduced to half its original length.

Since the time period depends only on the length \( L \) and gravity \( g \), we can calculate the new time period \( T_{new} \) by adjusting for the change in length.


The new length is \( \frac{L}{2} \), so the new time period \( T_{new} \) will be:

\[ T_{new} = 2\pi \sqrt{\frac{\frac{L}{2}}{g}} = 2\pi \sqrt{\frac{L}{2g}} = \frac{T}{\sqrt{2}} \]


Since the mass does not affect the time period, the new time period is \( \frac{1}{\sqrt{2}} \) times the original time period. Thus, the value of \( x \) is \( \sqrt{2} \), and the ratio \( T_{new} / T_{original} \) is \( \sqrt{2} \), which corresponds to option (2).

So, the correct answer should be: \( \sqrt{2} \) Quick Tip: The time period of a simple pendulum depends only on its length and the acceleration due to gravity, not on the mass of the bob.

The graph represents the relation between temperature (\( T \)) and volume (\( V \)) of an ideal gas at different pressures.


According to Charles’s Law, for a fixed amount of gas, the volume is directly proportional to the temperature at constant pressure. This means that as the temperature increases, the volume increases, and vice versa.


For the same temperature increase, the volume will be greater at lower pressures because the gas expands more easily at lower pressures.


Therefore, the graph with higher temperature at higher pressures corresponds to a smaller volume. Thus, \( P_1 > P_2 > P_3 \). Quick Tip: In a graph of temperature vs. volume for an ideal gas, the pressure is inversely proportional to the slope of the graph. Lower pressures lead to higher volumes at the same temperature.

To find the minimum energy required to launch a satellite into a circular orbit at an altitude of \( 2R \), we need to consider both the gravitational potential energy and the kinetic energy of the satellite.


Gravitational Potential Energy:


The gravitational potential energy of a satellite of mass \( m \) at a distance \( r \) from the center of the Earth is given by:
\[ U = -\frac{GMm}{r} \]

At the surface of the Earth, the distance from the center is \( R \), and at the altitude \( 2R \), the distance from the center of the Earth is \( 3R \). So:


The initial potential energy at the surface (distance \( R \)) is:
\[ U_{initial} = -\frac{GMm}{R} \]


The potential energy at the altitude of \( 2R \) (distance \( 3R \)) is:
\[ U_{orbit} = -\frac{GMm}{3R} \]


Kinetic Energy:

For a satellite in a circular orbit, the kinetic energy is given by:
\[ K = \frac{GMm}{2r} \]

At the altitude of \( 2R \), the distance from the center is \( 3R \), so:
\[ K = \frac{GMm}{6R} \]


Total Energy:

The total energy required to launch the satellite is the difference in energy between the orbit and the surface:
\[ E_{total} = \left( U_{orbit} + K \right) - U_{initial} \]

Substitute the values:
\[ E_{total} = \left( -\frac{GMm}{3R} + \frac{GMm}{6R} \right) - \left( -\frac{GMm}{R} \right) \]

Simplifying:
\[ E_{total} = \left( -\frac{2GMm}{6R} + \frac{GMm}{6R} \right) + \frac{GMm}{R} \]
\[E_{total} = \frac{-GMm}{6R} + \frac{GMm}{R}\]
\[E_{total} = \frac{5GMm}{6R}\]

Thus, the minimum energy required to launch the satellite is:
\[ E_{total} = \frac{5}{6} \frac{GmM}{R} \] Quick Tip: The minimum energy required to launch a satellite into orbit is the difference between the energy in orbit and the energy at the surface. It accounts for both gravitational potential energy and kinetic energy.

Let's analyze each statement:


Transverse Nature : Electromagnetic waves are indeed transverse in nature, meaning the electric and magnetic fields oscillate perpendicular to the direction of propagation of the wave.


Equal Energy Density : In an electromagnetic wave, the energy densities in the electric and magnetic fields are equal. This can be derived from the fact that the magnitudes of the electric and magnetic fields are related in free space.


Speed of the Wave : Electromagnetic waves in free space travel with a speed \( c = \frac{1}{\sqrt{\mu_0 \epsilon_0}} \), where \( \mu_0 \) is the permeability of free space and \( \epsilon_0 \) is the permittivity of free space. This is one of the fundamental properties of electromagnetic waves.


Origin of the Wave : Electromagnetic waves do not originate from charges moving with uniform speed. They are generated by accelerating charges, not charges moving with uniform speed. A charge moving with uniform speed produces a constant magnetic field, not a time-varying one that is necessary for the production of electromagnetic waves.


Thus, the property that is not true for an electromagnetic wave traveling in free space is: {\text{(4) They originate from charges moving with uniform speed. Quick Tip: Electromagnetic waves are produced by accelerating charges, not by charges moving with uniform speed.

- In a Wheatstone bridge, the bridge is balanced when the ratio of resistances in one diagonal is equal to the ratio of resistances in the other diagonal.
- The correct circuit that achieves this balance must have the correct arrangement of resistors where the ratio of the resistances in opposite arms are equal.
- By analyzing the circuit diagrams, we find that Circuit diagram A satisfies this condition, making it the correct option. Quick Tip: To balance a Wheatstone bridge, the ratio of resistances in one diagonal should equal the ratio in the other diagonal. This ensures no current flows through the galvanometer.

The force acting on the particle is given by: \[ F = \alpha t^2 + \beta t \]


To find a dimensionless factor, we need to examine the dimensions of \( \alpha \) and \( \beta \) and how they relate to time \( t \).


1. Dimensions of Force:
The dimensional formula for force \( F \) is:
\[ [F] = M L T^{-2} \]


2. Dimensions of \( \alpha t^2 \):
Let the dimension of \( \alpha \) be \( [\alpha] \). The term \( \alpha t^2 \) has dimensions:
\[ [\alpha] \cdot [t^2] = [\alpha] \cdot T^2 \]

For this term to have the dimensions of force, we set:
\[ [\alpha] \cdot T^2 = M L T^{-2} \]

Solving for \( [\alpha] \):
\[ [\alpha] = M L T^{-4} \]


3. Dimensions of \( \beta t \):
Let the dimension of \( \beta \) be \( [\beta] \). The term \( \beta t \) has dimensions:
\[ [\beta] \cdot [t] = [\beta] \cdot T \]

For this term to have the dimensions of force, we set:
\[ [\beta] \cdot T = M L T^{-2} \]

Solving for \( [\beta] \):
\[ [\beta] = M L T^{-3} \]


4. Dimensionless Factor:
Now, we are looking for a factor that is dimensionless. Let’s check the dimensions of \( \frac{\alpha t}{\beta} \):
\[ \frac{[\alpha] \cdot T}{[\beta]} = \frac{M L T^{-4} \cdot T}{M L T^{-3}} = 1 \]

Since the dimensions cancel out, \( \frac{\alpha t}{\beta} \) is indeed dimensionless.

Thus, the correct dimensionless factor is:
\[ \boxed{(2) \frac{\alpha t}{\beta}} \] Quick Tip: To find a dimensionless quantity, ensure that the dimensions of the numerator and denominator cancel out.

Let’s analyze the two cases: series connection and parallel connection.


Case 1: Series Connection

In a series circuit, the same current flows through both heaters. The power \( P \) dissipated by a resistor (or heater in this case) is given by:
\[ P = I^2 R \]

Where:
- \( I \) is the current.
- \( R \) is the resistance of the heater.

For each heater:
- Heater A has a power rating of 1 kW. The power \( P_A = 1000 \, W \).
- Heater B has a power rating of 2 kW. The power \( P_B = 2000 \, W \).

Now, the resistance of each heater can be found using the formula:
\[ P = \frac{V^2}{R} \]

Where \( V \) is the voltage and \( R \) is the resistance. Since the heaters are connected in series, the current \( I \) is the same for both.

The ratio of the power outputs in series can be obtained by using the fact that power is inversely proportional to the resistance when the same current flows through both:
\[ \frac{P_A}{P_B} = \frac{R_B}{R_A} \]


Case 2: Parallel Connection

In a parallel circuit, the same voltage is applied across both heaters. The power dissipated by each heater is:
\[ P = \frac{V^2}{R} \]

For the parallel case, the power output will be directly proportional to the power ratings of the heaters:
\[ P_{total} = P_A + P_B = 1000 + 2000 = 3000 \, W \]

Since the voltage is the same across both heaters, the power output for each heater will be determined by the resistance of each and the supply voltage.

To find the ratio of power outputs, we can compare the power dissipation in both cases. In series, the power is divided according to the resistance, but in parallel, the power is directly proportional to the power ratings.

Thus, the ratio of power outputs when the heaters are connected in series and parallel is:
\[ \frac{Power output in parallel}{Power output in series} = \frac{ 2}{9} \]

Thus, the ratio of the power outputs for the two cases is \( {2 : 9} \). Quick Tip: When heaters are connected in parallel, the power output is proportional to their individual ratings. In series, the power is divided according to resistance.

- The magnetic moment \(M\) of a straight bar magnet is given by \(M = I \cdot A\), where \(I\) is the current and \(A\) is the area of the loop.
- When the bar is bent at the middle, the length of the magnet is halved, but the magnetic moment depends on the geometry of the magnet.
- Since the two arms now make an angle of 60°, the resulting magnetic moment will be reduced by a factor of 2, hence the magnetic moment becomes \( \frac{M}{2} \). Quick Tip: When a bar magnet is bent into an angle, the magnetic moment changes due to the change in the effective area and orientation of the magnet.

The problem involves a metallic bar that is heated and experiences thermal expansion. However, it is constrained so that it cannot expand freely, and thus a compressive force develops to prevent the expansion. The relationship between the thermal stress and the compressive force can be derived using the formula for thermal stress:
\[ F = Y \cdot \alpha \cdot \Delta T \cdot A \]

Where:
- \( F \) is the compressive force,
- \( Y \) is the Young's modulus,
- \( \alpha \) is the coefficient of linear thermal expansion,
- \( \Delta T \) is the change in temperature,
- \( A \) is the area of cross-section of the bar.

Given:
- \( Y = 0.5 \times 10^{11} \, N/m^2 \),
- \( \alpha = 10^{-5} \, °C^{-1} \),
- \( \Delta T = 100^\circC - 0^\circC = 100^\circC \),
- \( A = 10^{-3} \, m^2 \).

Substitute the values into the formula:
\[ F = (0.5 \times 10^{11}) \times (10^{-5}) \times (100) \times (10^{-3}) \]
\[ F = 0.5 \times 10^{11} \times 10^{-5} \times 100 \times 10^{-3} \]
\[ F = 0.5 \times 10^{11} \times 10^{-5} \times 10^{-1} \]
\[ F = 0.5 \times 10^{5} \]
\[ F = 50 \times 10^3 \, N \]

Thus, the compressive force developed in the bar is \( 50 \times 10^3 \, N \). Quick Tip: When a metal bar is heated and constrained, the compressive force develops according to the formula: \( F = Y \cdot \alpha \cdot \Delta T \cdot A \).

From the \( v-t \) graph, acceleration is determined by the slope. During different time intervals, the slope remains constant but changes in discrete steps, corresponding to the stepped nature of the graph. Quick Tip: Acceleration is found from the slope of velocity-time graphs; check for consistency or variations in slope.

Let’s analyze each option based on the given situation, where the plates of a parallel plate capacitor connected to a battery are moved closer together:


Capacitance increases (C):
- The capacitance of a parallel plate capacitor is given by:
\[ C = \frac{\varepsilon_0 A}{d} \]
where \( A \) is the area of the plates, \( d \) is the distance between the plates, and \( \varepsilon_0 \) is the permittivity of free space.
- As the plates are moved closer together, the distance \( d \) decreases, so the capacitance increases.


Charge stored increases (A):
- The charge stored on the capacitor is related to the capacitance and the potential difference across the plates by:
\[ Q = C \cdot V \]
where \( V \) is the potential difference, which is constant because the capacitor is connected to a battery.
- Since capacitance increases as the plates are moved closer, the charge stored also increases.


Energy stored decreases (B):
- The energy stored in the capacitor is given by:
\[ U = \frac{1}{2} C V^2 \]
- As the capacitance increases, the energy stored should increase, not decrease. So, statement B is incorrect.


The ratio of charge to potential remains the same (D):
- The ratio \( \frac{Q}{V} \) is equivalent to the capacitance \( C \).
- Since capacitance increases, this ratio \( \frac{Q}{V} \) also increases, meaning it does not remain the same.


Product of charge and voltage increases (E):
- The product of charge and voltage is \( Q \cdot V = C \cdot V^2 \).
- As \( C \) increases, the product \( Q \cdot V \) increases.


Thus, the correct statements are A, C, and E. Quick Tip: When the plates of a parallel plate capacitor connected to a battery are moved closer together, the capacitance increases, the charge stored increases, and the product of charge and voltage increases.

The magnifying power (M) of a telescope is given by the formula: \[ M = \frac{f_{objective}}{f_{eyepiece}} \]
where:
- \( f_{objective} \) is the focal length of the objective lens,
- \( f_{eyepiece} \) is the focal length of the eyepiece.


Given:
- Focal length of the objective \( f_{objective} = 140 \, cm \),
- Focal length of the eyepiece \( f_{eyepiece} = 5.0 \, cm \).

Substituting the values into the formula: \[ M = \frac{140}{5} = 28 \]


Thus, the magnifying power of the telescope is 28. Quick Tip: The magnifying power of a telescope is given by the ratio of the focal length of the objective to the focal length of the eyepiece.

Let's analyze each statement:


Statement A: Hold the sheet there if it is magnetic.
- If the sheet is magnetic and is placed near a strong magnetic pole, the magnetic field will exert a force on the sheet to either attract or repel it, depending on the magnetic properties of the sheet.
- If the magnetic field is strong enough, a force will be required to keep the sheet in place.


Statement B: Hold the sheet there if it is non-magnetic.
- If the sheet is non-magnetic, no force is needed to keep it in place due to the magnetic field, as it does not interact with the field significantly. No magnetic force is acting on the sheet.


Statement C: Move the sheet away from the pole with uniform velocity if it is conducting.
- If the sheet is conducting and moved in the magnetic field, it will experience a back emf (electromotive force) due to its motion through the magnetic field. This will result in an opposing magnetic force (Lenz's Law), requiring a force to move it at a uniform velocity.


Statement D: Move the sheet away from the pole with uniform velocity if it is both non-conducting and non-polar.
- If the sheet is non-conducting and non-polar (non-magnetic), there will be no interaction with the magnetic field. In this case, no force is needed to move the sheet at uniform velocity.


Thus, the correct statements are A and C, because a force is needed to hold a magnetic sheet in place and to move a conducting sheet with uniform velocity due to induced magnetic forces. Quick Tip: Magnetic sheets interact with magnetic fields, requiring a force to hold them in place. Conducting sheets moving in a magnetic field experience induced forces, which require an external force to move them at constant velocity.

Electronegativity increases as we move across a period from left to right and decreases as we move down a group in the periodic table.


Silicon (Si) is in group 14 and period 3, and has the lowest electronegativity among the elements listed.


Carbon (C) is in the same group as Si but is one period higher, so its electronegativity is slightly higher than Si.


Nitrogen (N) is in group 15, period 2, and its electronegativity is higher than both Si and C.


Oxygen (O) is in group 16, period 2, and has a higher electronegativity than nitrogen.


Fluorine (F) is in group 17, period 2, and has the highest electronegativity of all the elements in this list.


Thus, the correct order of electronegativity is:(1) Si \(<\) C \(<\) N \(<\) O \(<\) F . Quick Tip: Electronegativity increases across a period from left to right and decreases as we move down a group in the periodic table.

% Option
(i) BH\(_3\): BH\(_3\) (Borane) is used in the hydroboration reaction to add a boron atom to the double bond of alkene A.


% Option
(ii) H\(_2\)O / OH\(^-\): In the second step, oxidation using hydrogen peroxide and hydroxide results in the conversion of the borane adduct into an alcohol, B.

Thus, option (2) correctly identifies the reagents needed for the transformation from A to C. Quick Tip: Hydroboration-oxidation is a two-step process where BH\(_3\) adds across a double bond, followed by oxidation to form an alcohol.

SN1 Reaction: The rate of an SN1 reaction depends on the stability of the carbocation intermediate. The more stable the carbocation, the faster the reaction.


Compound D: Compound D, having a tertiary carbon attached to the leaving group, will form the most stable carbocation due to hyperconjugation and inductive effects, making it the fastest in an SN1 reaction. Quick Tip: In an SN1 reaction, the rate-determining step is the formation of the carbocation, and the stability of this carbocation directly influences the reaction rate.

For the given reaction \( 2A \rightleftharpoons B + C \), the equilibrium constant \( K_C \) is given as:

\[ K_C = \frac{[B][C]}{[A]^2} \]


At equilibrium, the ratio of the concentrations of products and reactants should be equal to \( K_C \). Let's calculate the reaction quotient \( Q_C \) using the given concentrations:

\[ Q_C = \frac{[B][C]}{[A]^2} = \frac{(2 \times 10^{-3})(2 \times 10^{-3})}{(2 \times 10^{-3})^2} = \frac{4 \times 10^{-6}}{4 \times 10^{-6}} = 1 \]


Now, compare \( Q_C \) with the equilibrium constant \( K_C \):


- Given: \( K_C = 4 \times 10^{-3} \)


- Calculated: \( Q_C = 1 \)


Since \( Q_C > K_C \), the system is not at equilibrium and the reaction will proceed in the backward direction to reach equilibrium.


Thus, the reaction has a tendency to go in the backward direction. Quick Tip: If \( Q_C > K_C \), the reaction will shift in the backward direction to reach equilibrium.

The number of atoms is directly related to the amount of substance (in moles) because 1 mole of any substance contains Avogadro's number of atoms, i.e., \( N_A = 6.022 \times 10^{23} \) atoms.


Option (1): 4 mol of helium.


1 mole of helium contains \( 6.022 \times 10^{23} \) helium atoms. So, 4 moles will contain:
\[ 4 \times 6.022 \times 10^{23} = 2.4088 \times 10^{24} helium atoms. \]
This is the highest number of atoms compared to the other options.


Option (2): 4 u of helium.


The atomic mass unit (u) represents a very small mass. 1 u corresponds to the mass of 1 helium atom, which is around \( 4 \times 10^{-24} \) g. So, 4 u is equivalent to a very small number of helium atoms, far less than in 4 moles.


Option (3): 4 g of helium.


The molar mass of helium is \( 4 \, g/mol \), so 4 g of helium corresponds to 1 mole, which is much fewer atoms than in 4 moles of helium.


Option (4): 2.271098 L of helium at STP.


At standard temperature and pressure (STP), 1 mole of gas occupies 22.4 L. 2.271098 L of helium corresponds to less than 1 mole of helium, which is fewer atoms than in 4 moles.


Thus, Option (1) contains the highest number of helium atoms. Quick Tip: The number of atoms is directly proportional to the number of moles. 4 moles will contain the highest number of helium atoms.

A. Isothermal process: This process occurs at constant temperature. Heat exchange is allowed, hence corresponding to II.


B. Isochoric process: This process occurs at constant volume, so it corresponds to III.


C. Isobaric process: This process is carried out at constant pressure, corresponding to IV.


D. Adiabatic process: This process occurs without heat exchange, hence corresponding to I. Quick Tip: In thermodynamics, the different processes are characterized based on the constraints such as temperature, pressure, and volume being held constant. Adiabatic, isothermal, and isobaric are common examples.

- The energy of an electron in the \(n\)-th orbit for a hydrogen-like ion is given by:
\[ E_n = -\frac{13.6 \, Z^2}{n^2} \, eV \]
where \( Z \) is the atomic number and \( n \) is the principal quantum number.
- For He\(^+\) (Z = 2) in the ground state (n = 1), the energy is \(-x\).
- For Be\(^{3+}\) (Z = 4) in the second orbit (n = 2), the energy is:
\[ E_2 = -\frac{13.6 \times 4^2}{2^2} = -x \] Quick Tip: The energy levels in hydrogen-like ions depend on the atomic number \(Z\) and the principal quantum number \(n\). The energy becomes more negative as \(Z\) increases or \(n\) decreases.

A. ethane: Ethane has a single bond between the two carbons, which is one \(\sigma\)-bond, corresponding to III. one \(\sigma\)-bond.


B. ethene: Ethene has a double bond between the two carbons, consisting of one \(\sigma\)-bond and one \(\pi\)-bond, corresponding to IV. one \(\sigma\)-bond and one \(\pi\)-bond.


C. carbon molecule, C\(_2\): The molecule C\(_2\) (diatomic carbon) has a triple bond, which is one \(\sigma\)-bond and two \(\pi\)-bonds, corresponding to I. .

one \(\sigma\)-bond and two \(\pi\)-bonds.
D. ethyne: Ethyne (acetylene) has a triple bond, consisting of one \(\sigma\)-bond and two \(\pi\)-bonds, corresponding to II. two \(\pi\)-bonds. Quick Tip: Ethene and ethyne have multiple bonds where \(\sigma\)-bonds are formed first, and subsequent \(\pi\)-bonds are formed in the side-by-side overlap of orbitals.

A. NH\(_3\): Ammonia has a trigonal pyramidal structure, so it corresponds to I. Trigonal Pyramidal.


B. BrF\(_5\): Bromine pentafluoride has a square pyramidal structure, so it corresponds to IV. Square Pyramidal.


C. XeF\(_4\): Xenon tetrafluoride has a square planar structure, so it corresponds to II. Square Planar.


D. SF\(_6\): Sulfur hexafluoride has an octahedral structure, so it corresponds to III. Octahedral. Quick Tip: Molecular geometry is determined by the VSEPR theory, which explains the arrangement of atoms around a central atom based on electron pair repulsion.

The standard electrode potential (\( E^\circ \)) is influenced by the electronic configuration of the metal ions involved in the redox process. For Mn\(^{3+}\)/Mn\(^{2+}\), the transition from \( d^4 \) to \( d^5 \) configuration (which results in a more stable configuration) is energetically favorable. This leads to a more positive \( E^\circ \) value for the Mn\(^{3+}\)/Mn\(^{2+}\) couple compared to other metal couples like Cr\(^{3+}\)/Cr\(^{2+}\) or Fe\(^{3+}\)/Fe\(^{2+}\), which do not have such a favorable electronic configuration change. Quick Tip: The higher the stability of the resulting ion after electron gain or loss, the more positive the \( E^\circ \) value. In this case, the transition from \( d^4 \) to \( d^5 \) for Mn leads to a higher \( E^\circ \) value.

Option 1: In the equilibrium \(PCl_5 (g) \rightleftharpoons PCl_3 (g) + Cl_2 (g)\), \( K_p \) and \( K_c \) are not equal because the number of moles of gas changes during the reaction. This results in a difference between the equilibrium constants in terms of pressure (\( K_p \)) and concentration (\( K_c \)).


Option 2: For the reaction \(H_2 (g) + I_2 (g) \rightleftharpoons 2 HI (g)\), \( K_p \) and \( K_c \) are equal because the total number of moles of gas does not change.


Option 3: In the equilibrium \(CO (g) + H_2 (g) \rightleftharpoons CO_2 (g) + H_2 O (g)\), the number of moles of gas does not change, so \( K_p \) and \( K_c \) are equal.


Option 4: The equilibrium \(Br_2 (g) \rightleftharpoons 2 Br (g)\) also does not involve a change in the number of moles of gas, so \( K_p \) and \( K_c \) are equal. Quick Tip: For reactions involving gases, the relationship between \( K_p \) and \( K_c \) depends on the change in the number of moles of gas. If the number of moles changes, \( K_p \) and \( K_c \) will differ.

Among the Group 16 elements (O, S, Se, Te, Po), oxygen (O) generally shows a –2 oxidation state. Other elements such as sulfur (S), selenium (Se), tellurium (Te), and polonium (Po) can also show a –2 oxidation state in compounds. However, polonium (Po) is a heavier element and typically shows positive oxidation states (+2, +4), especially in its compounds, due to its metallic character and the inability to effectively accommodate a –2 oxidation state in many of its compounds.


Thus, polonium (Po) is the only element in Group 16 that does not typically show a –2 oxidation state. Quick Tip: Polonium (Po), being a heavier element in Group 16, tends to show positive oxidation states rather than the typical –2 oxidation state seen in lighter elements like oxygen (O).

The magnetic moment of a transition metal ion is given by the formula:
\[ \mu_{eff} = \sqrt{n(n+2)} \, \mu_B \]

where \( n \) is the number of unpaired electrons and \( \mu_B \) is the Bohr magneton.

Now, let's calculate the number of unpaired electrons for each ion:

Ti\(^{3+}\): \( Ti \) has an atomic number 22. For \( Ti^{3+} \), the electron configuration is \( [Ar] 3d^1 \), so it has 1 unpaired electron.


Cr\(^{2+}\): \( Cr \) has an atomic number 24. For \( Cr^{2+} \), the electron configuration is \( [Ar] 3d^4 \), so it has 4 unpaired electrons.


Mn\(^{2+}\): \( Mn \) has an atomic number 25. For \( Mn^{2+} \), the electron configuration is \( [Ar] 3d^5 \), so it has 5 unpaired electrons.


Fe\(^{2+}\): \( Fe \) has an atomic number 26. For \( Fe^{2+} \), the electron configuration is \( [Ar] 3d^6 \), so it has 4 unpaired electrons.


Sc\(^{3+}\): \( Sc \) has an atomic number 21. For \( Sc^{3+} \), the electron configuration is \( [Ar] \), so it has no unpaired electrons.


Now calculating the magnetic moments:


Ti\(^{3+}\): 1 unpaired electron, so the magnetic moment is \( \mu_{eff} = \sqrt{1(1+2)} = \sqrt{3} \, \mu_B \).


Cr\(^{2+}\): 4 unpaired electrons, so the magnetic moment is \( \mu_{eff} = \sqrt{4(4+2)} = \sqrt{24} \, \mu_B \).


Mn\(^{2+}\): 5 unpaired electrons, so the magnetic moment is \( \mu_{eff} = \sqrt{5(5+2)} = \sqrt{35} \, \mu_B \).


Fe\(^{2+}\): 4 unpaired electrons, so the magnetic moment is \( \mu_{eff} = \sqrt{4(4+2)} = \sqrt{24} \, \mu_B \).


Sc\(^{3+}\): No unpaired electrons, so the magnetic moment is 0.


From the above calculations, we see that the magnetic moments of Cr\(^{2+}\) and Fe\(^{2+}\) are the same.


Thus, the ions that have the same magnetic moment are Cr\(^{2+}\) and Fe\(^{2+}\). Quick Tip: For transition metal ions, the number of unpaired electrons determines the magnetic moment. The higher the number of unpaired electrons, the higher the magnetic moment.

Let's analyze the structure of the compound with the molecular formula C\(_6\)H\(_{14}\). Since the compound has two tertiary carbons, we know that both the tertiary carbons are attached to a central carbon atom and are substituted with other groups.


Starting with the simplest structure, a hexane chain (C\(_6\)H\(_{14}\)) has 6 carbon atoms in a straight chain. By adding methyl groups at the appropriate positions, we can form a compound with two tertiary carbons.


- 2,3-dimethylbutane has a butane backbone with methyl groups at positions 2 and 3, and each of these positions would result in tertiary carbons (as each is attached to 3 other carbon atoms). This fits the requirement for two tertiary carbons.


Thus, the correct IUPAC name for the compound is 2,3-dimethylbutane. Quick Tip: A tertiary carbon is one that is bonded to three other carbon atoms. The structure should be examined to determine the correct name based on the positions of methyl groups.

Statement I: The boiling points of isomeric pentanes follow the order n-pentane \(>\) isopentane \(>\) neopentane. This is correct because, in general, as the number of branches increases in an isomeric series, the surface area decreases, leading to weaker van der Waals forces between molecules. The weaker intermolecular forces result in a lower boiling point for more branched isomers.


- n-pentane (unbranched) has the highest surface area, leading to stronger intermolecular forces and a higher boiling point.


- Isopentane (with one branch) has a lower boiling point than n-pentane.


- Neopentane (with two branches) has the lowest boiling point due to the compact, spherical shape, which minimizes surface area and intermolecular forces.


- Statement II: This statement explains the reasoning behind the trend observed in Statement I. As branching increases, the molecule becomes more spherical, leading to a smaller surface area and weaker intermolecular forces. This results in a lower boiling point for more branched isomers. This explanation is also correct.


Thus, both statements are accurate, and the correct answer is (1) Both Statement I and Statement II are correct. Quick Tip: In organic compounds, branching reduces the surface area for intermolecular interactions, which leads to weaker van der Waals forces and lower boiling points for more branched isomers.

Step 1: The Arrhenius equation is given by:
\[ \ln k = -\frac{E_a}{R} \cdot \frac{1}{T} + \ln A. \]

Step 2: A plot of \( \ln k \) vs \( \frac{1}{T} \) forms a straight line with a negative slope equal to \(-E_a/R\).

Step 3: The graph shows a linear decrease as \( \frac{1}{T} \) increases. Quick Tip: The Arrhenius plot is always a straight line with a negative slope, representing the temperature dependence of reaction rates.

Henry's law states that the solubility of a gas in a liquid is inversely proportional to the Henry's law constant (\( K_H \)). Mathematically, this is given by:
\[ S = \frac{P}{K_H} \]

Where:
- \( S \) is the solubility of the gas,
- \( P \) is the partial pressure of the gas, and
- \( K_H \) is the Henry’s law constant.

A lower value of \( K_H \) indicates greater solubility in water. Therefore, to compare the solubilities of the gases A, B, and C, we should look at the relative sizes of \( K_H \):


- Gas A has a \( K_H \) value of 145 kbar.


- Gas B has a \( K_H \) value of \( 2 \times 10^{-5} \) kbar.


- Gas C has a \( K_H \) value of 35 kbar.

The solubility order is inversely related to \( K_H \), so:

\[ Solubility order: \quad B > C > A \]

Thus, the solubility of the gases in water follows the order B \(>\) C \(>\) A. Quick Tip: According to Henry’s law, a lower Henry’s law constant (\( K_H \)) means higher solubility of the gas in the liquid. Thus, gases with smaller \( K_H \) values are more soluble.

Fehling’s solution is a reagent used to test for the presence of reducing sugars. It consists of two solutions, commonly known as Fehling’s solution A and Fehling’s solution B.


- Fehling’s solution A contains aqueous copper sulphate .


- Fehling’s solution B contains alkaline solution of sodium potassium tartrate (also called Rochelle’s salt).


When mixed together and heated with a reducing sugar, the copper(II) ions in the solution are reduced to copper(I) oxide, which forms a red precipitate.


Thus, Fehling’s solution A is aqueous copper sulphate. Quick Tip: Fehling’s solution A contains aqueous copper sulphate, and Fehling’s solution B contains an alkaline solution of sodium potassium tartrate (Rochelle’s salt).

- Statement I: The boiling points of the hydrides of Group 16 elements (water \( H_2O \), hydrogen selenide \( H_2Se \), hydrogen telluride \( H_2Te \), and hydrogen sulfide \( H_2S \)) follow the order \( H_2O > H_2Te > H_2Se > H_2S \). This is true because while molecular mass tends to increase as you go down the group, the boiling point of water is much higher than expected due to hydrogen bonding between water molecules.


- Statement II: On the basis of molecular mass, \( H_2O \) should have a lower boiling point compared to the other hydrides in Group 16. However, due to the presence of extensive hydrogen bonding, \( H_2O \) has a much higher boiling point than expected compared to \( H_2S \), \( H_2Se \), and \( H_2Te \), where such hydrogen bonding is either absent or much weaker. This is also true.


Thus, both Statement I and Statement II are correct. Quick Tip: Water has a much higher boiling point than expected due to the presence of extensive hydrogen bonding, which is absent or weaker in other Group 16 hydrides.

- Statement I: Both \([Co(NH_3)_6]^{3+}\) and \([CoF_6]^{3-}\) complexes are indeed octahedral, as they are both 6-coordinate complexes. However, they differ in their magnetic properties due to the nature of the ligands and the electronic configuration of cobalt in these complexes.


- Statement II: \([Co(NH_3)_6]^{3+}\) is diamagnetic because the ligand \( NH_3 \) is a weak field ligand, causing the \( Co^{3+} \) ion (which has a \( d^6 \) configuration) to undergo pairing of electrons, resulting in no unpaired electrons. Therefore, the complex is diamagnetic. On the other hand, \( F^- \) is a weaker ligand than \( NH_3 \), and the \( Co^{3+} \) ion in \([CoF_6]^{3-}\) does not cause electron pairing, leading to the presence of unpaired electrons and making the complex paramagnetic.


Thus, both Statement I and Statement II are correct. Quick Tip: In octahedral complexes like \([Co(NH_3)_6]^{3+}\) and \([CoF_6]^{3-}\), the nature of the ligand determines whether electron pairing occurs, which directly affects the magnetic behavior of the complex.

A: Carbocation A is less stable due to lack of resonance and fewer alkyl groups stabilizing the positive charge.


B: Carbocation B is the most stable due to the presence of resonance structures that can delocalize the positive charge effectively.


C: Carbocation C, while having some stabilizing alkyl groups, lacks the extensive resonance stabilization seen in B.


D: Carbocation D is also less stable than B because it has fewer stabilizing alkyl groups and no resonance. Quick Tip: Stability of carbocations increases with the presence of electron-donating alkyl groups and resonance stabilization. More substituted carbocations are generally more stable due to hyperconjugation and resonance.

Sublimation is the process where a substance changes directly from the solid state to the gaseous state without passing through the liquid phase. This property is utilized for the purification of substances that undergo sublimation, such as iodine, naphthalene, and camphor. The technique is based on the difference in volatility of the substances involved. Quick Tip: Sublimation can be used for purifying solids that directly convert to gas upon heating. This is in contrast to other techniques like crystallization, where the substance transitions through the liquid phase.

In this problem, we match the given complexes with their types of isomerism:


- A. \([ Co(NH_3)_5(NO_2)]Cl_2\): This is an example of Linkage isomerism because the nitrite ion (\(NO_2^-\)) can coordinate through either the nitrogen or the oxygen atom. Therefore, it corresponds to II.


- B. \([ Co(NH_3)_5(SO_4)]Br\): This is an example of Ionization isomerism because the complex can ionize to form different ionic species, as the sulfate ion can coordinate in different ways to the cobalt. Therefore, it corresponds to III.


- C. \([ Co(NH_3)_6][Cr(CN)_6]\): This is an example of Coordination isomerism because it involves two different metal centers, cobalt and chromium, where the ligands can switch between them. Therefore, it corresponds to IV.


- D. \([ Co(H_2O)_6]Cl_3\): This complex can show Solvate isomerism, where the solvent molecules (in this case, water) can be part of the coordination sphere or outside it, leading to different isomers. Therefore, it corresponds to I. Quick Tip: Linkage isomerism occurs when a ligand can coordinate through two different atoms, while ionization isomerism results from different ionic forms of the same complex. Solvate isomerism occurs when solvent molecules are part of the coordination sphere or not.

- A. Tollen’s reagent: Glucose reacts with Tollen’s reagent (ammoniacal silver nitrate) to form a silver mirror. This reaction is positive for aldehydes, and glucose, being an aldose, reacts with it.


- B. Schiff’s reagent: Schiff’s reagent is used to test for aldehydes. Glucose, being an aldose, reacts with Schiff’s reagent to give a pink color. Therefore, glucose reacts with Schiff’s reagent.


- C. HCN: Glucose does not readily react with hydrogen cyanide (HCN). Therefore, glucose does not react with HCN under normal conditions.


- D. NH\(_2\)OH (Hydroxylamine): Hydroxylamine reacts with aldehydes to form oximes. Glucose, being an aldose, reacts with hydroxylamine to form a corresponding oxime.


- E. NaHSO\(_3\) (Sodium bisulfite): Sodium bisulfite reacts with aldehydes to form an adduct. Glucose, being an aldose, does not react with sodium bisulfite under normal conditions.


Thus, glucose does not react with Schiff’s reagent (B) and NaHSO\(_3\) (E). Quick Tip: Glucose, being an aldose, reacts with Tollen’s reagent, Schiff’s reagent, hydroxylamine, and sodium bisulfite under typical conditions. However, it does not react with HCN under normal conditions.

The activation energy (\(E_a\)) of a chemical reaction can be calculated using the Arrhenius equation:
\[ k = A \cdot e^{-\frac{E_a}{RT}} \]

Where:
- \( k \) is the rate constant,
- \( A \) is the frequency factor,
- \( E_a \) is the activation energy,
- \( R \) is the gas constant, and
- \( T \) is the temperature.

By knowing the rate constant at two different temperatures, the activation energy can be calculated by rearranging the Arrhenius equation:
\[ \ln \left( \frac{k_2}{k_1} \right) = \frac{E_a}{R} \left( \frac{1}{T_1} - \frac{1}{T_2} \right) \]


Thus, the correct option is:
(4) rate constant at two different temperatures. Quick Tip: To calculate activation energy, you need the rate constant at two different temperatures. Using the Arrhenius equation, the activation energy can be determined.

A. 1 mol of H\(_2\)O to O\(_2\): The electrolysis of water requires 3 Faradays per mole of oxygen produced, hence 3F.


B. 1 mol of 4MnO\(_4^{–}\) to Mn\(^{2+}\): Reduction of permanganate to Mn\(^{2+}\) requires 5 electrons, so 5F is required.


C. 1.5 mol of Ca from molten CaCl\(_2\): Calcium extraction from molten calcium chloride requires 2 Faradays per mole of calcium, so 3F is required for 1.5 moles of calcium.


D. 1 mol of FeO to Fe\(_2\)O\(_3\): This oxidation requires 3 Faradays of charge for each mole of iron. Quick Tip: The amount of electric charge required to reduce or oxidize a substance is related to the number of moles of electrons transferred in the reaction. This is expressed in Faradays.

A. 1 mol of H\(_2\)O to O\(_2\): The electrolysis of water requires 3 Faradays per mole of oxygen produced, hence 3F.


B. 1 mol of 4MnO\(_4^{–}\) to Mn\(^{2+}\): Reduction of permanganate to Mn\(^{2+}\) requires 5 electrons, so 5F is required.


C. 1.5 mol of Ca from molten CaCl\(_2\): Calcium extraction from molten calcium chloride requires 2 Faradays per mole of calcium, so 3F is required for 1.5 moles of calcium.


D. 1 mol of FeO to Fe\(_2\)O\(_3\): This oxidation requires 3 Faradays of charge for each mole of iron. Quick Tip: The amount of electric charge required to reduce or oxidize a substance is related to the number of moles of electrons transferred in the reaction. This is expressed in Faradays.

Intramolecular hydrogen bonding occurs when a hydrogen atom attached to a more electronegative atom (such as oxygen or nitrogen) forms a bond with a lone pair on an electronegative atom within the same molecule.


Compound A contains a structure where the necessary conditions for intramolecular hydrogen bonding are met, making it the correct answer. Quick Tip: Intramolecular hydrogen bonding is common in molecules where the donor and acceptor atoms are in close proximity within the same molecule, often forming ring-like structures.

- Statement I: Aniline (C\(_6\)H\(_5\)NH\(_2\)) does not undergo Friedel-Crafts alkylation reaction because the amino group (\(-NH_2\)) is an electron-donating group, which increases the electron density on the benzene ring. This makes the ring more reactive, but at the same time, the amino group can coordinate with the AlCl\(_3\) catalyst used in Friedel-Crafts reactions, deactivating it and preventing the reaction from occurring. Therefore, this statement is correct.


- Statement II: Aniline cannot be prepared through Gabriel synthesis. Gabriel synthesis is used for the preparation of primary amines by alkylation of phthalimide. However, due to the nucleophilic nature of the amino group in aniline, it will react with the electrophilic intermediate of Gabriel synthesis (such as the alkylating agent) and prevent the reaction from going to completion. Therefore, this statement is also true.


Thus, the correct answer is:(1) Both statement I and Statement II are true. Quick Tip: Aniline does not undergo Friedel-Crafts alkylation because the amino group can de-activate the catalyst. Also, it cannot be prepared by Gabriel synthesis due to the reactivity of the amino group.

The Lucas reagent, a solution of zinc chloride in concentrated hydrochloric acid, is used to classify alcohols of low molecular weight based on their reactivity. Tertiary alcohols react instantaneously, secondary alcohols react within five to twenty minutes, and primary alcohols react very slowly, if at all.



Given the structure of the compounds, D, being a tertiary alcohol, reacts instantaneously with Lucas reagent, indicating it is the correct answer. Quick Tip: Remember, tertiary alcohols react the fastest with Lucas reagent due to their structure, which allows the formation of a carbocation more readily than secondary or primary alcohols.

Ionization enthalpy generally increases across a period from left to right and decreases down a group. However, there are some exceptions due to electronic configurations.


- Li (Lithium) has the lowest ionization enthalpy among the elements listed, as it is in Group 1 and has a single electron in its outermost shell.


- B (Boron) has a lower ionization enthalpy than Be (Beryllium) because the removal of the first electron from Boron leads to a stable half-filled p-orbital configuration. Hence, B has a lower ionization enthalpy than Be.


- Be (Beryllium) has a higher ionization enthalpy than Boron because it has a stable electron configuration with a full s-orbital.


- C (Carbon) has a higher ionization enthalpy than Beryllium as the electron removal from Carbon involves the more stable p-orbital configuration.


- N (Nitrogen) has the highest ionization enthalpy among the given elements because it has a half-filled p-orbital, which is a stable configuration, making it difficult to remove an electron.


Thus, the correct order of first ionization enthalpy is:Li \(<\) B \(<\) Be \(<\) C \(<\) N Quick Tip: Ionization enthalpy increases across a period but there are exceptions due to electronic configurations, such as between Beryllium (Be) and Boron (B), where B has a lower ionization enthalpy due to half-filled p-orbital stability.

A redox reaction involves the transfer of electrons, where one substance is oxidized (loses electrons) and another is reduced (gains electrons).


(1) Zn + CuSO\(_4\) \(\rightarrow\) ZnSO\(_4\) + Cu: This is a redox reaction because zinc (Zn) is oxidized to Zn\(^{2+}\) and copper (Cu\(^{2+}\)) is reduced to Cu.


(2) 2KClO\(_3\) + I\(_2\) \(\rightarrow\) 2KIO\(_3\) + Cl\(_2\): This is also a redox reaction because chlorine (Cl) is reduced and iodine (I) is oxidized.


(3) H\(_2\) + Cl\(_2\) \(\rightarrow\) 2HCl: This is a redox reaction because hydrogen (H) is oxidized and chlorine (Cl) is reduced.


(4) BaCl\(_2\) + Na\(_2\)SO\(_4\) \(\rightarrow\) BaSO\(_4\) + 2NaCl: This is a double displacement reaction, but no change in oxidation states occurs. Hence, it is NOT a redox reaction.


Therefore, the correct answer is (4), as it is a non-redox reaction.

Quick Tip: A redox reaction involves the transfer of electrons, where one substance is oxidized (loses electrons) and another is reduced (gains electrons).

A. \(m_l\) refers to the magnetic quantum number, which gives the orientation of the orbital. Hence, \(m_l\) is associated with III. Orientation of orbital.


B. \(m_s\) refers to the spin quantum number, which gives the orientation of the spin of the electron. Hence, \(m_s\) is associated with IV. Orientation of spin of electron.


C. \(l\) refers to the azimuthal quantum number, which determines the shape of the orbital. Hence, \(l\) is associated with I. Shape of orbital.


D. \(n\) refers to the principal quantum number, which determines the size of the orbital. Hence, \(n\) is associated with II. Size of orbital.


Thus, the correct matching is: A-III, B-IV, C-I, D-II.

Quick Tip: The quantum numbers \(n\), \(l\), \(m_l\), and \(m_s\) describe different properties of orbitals and electrons:
\(n\) (principal quantum number) determines the size of the orbital,
\(l\) (azimuthal quantum number) determines the shape of the orbital,
\(m_l\) (magnetic quantum number) determines the orientation of the orbital,
\(m_s\) (spin quantum number) determines the orientation of the spin of the electron.

Entropy (\( \Delta S \)) is a measure of the disorder or randomness of a system. Entropy tends to increase when a system moves from a more ordered state to a more disordered state.


A. A liquid evaporates to vapour: The transition from a liquid to a gas increases the molecular disorder, leading to an increase in entropy.


B. The temperature of a crystalline solid is lowered from 130 K to 0 K: Lowering the temperature reduces the molecular motion, leading to a decrease in entropy.


C. \( 2NaHCO_3(s) \to Na_2CO_3(s) + CO_2(g) + H_2O(g) \): This reaction produces gaseous products from solids, which increases disorder and entropy.


D. \( Cl_2(g) \to 2Cl(g) \): The dissociation of \( Cl_2 \) into two atoms increases the disorder of the system, thereby increasing entropy.


Thus, the correct option is:
(3) A, C, and D. Quick Tip: Processes that involve the formation of gases or increased molecular disorder generally result in an increase in entropy.

First, we calculate the moles of HCl:
\[ Moles of HCl = Molarity \times Volume = 0.75 \, M \times 0.025 \, L = 0.01875 \, mol \]

Next, we calculate the moles of NaOH. The balanced equation for the reaction between NaOH and HCl is:
\[ NaOH + HCl \to NaCl + H_2O \]

This shows that 1 mole of NaOH reacts with 1 mole of HCl. Therefore, the moles of NaOH that react will be equal to the moles of HCl, i.e., 0.01875 moles of NaOH will react.

Now, we calculate the mass of NaOH that reacted:
\[ Mass of NaOH that reacted = moles of NaOH \times molar mass of NaOH = 0.01875 \times 40 = 0.75 \, g \]

The initial mass of NaOH is 1 gram, so the mass of NaOH left unreacted is:
\[ Mass of NaOH left = 1 \, g - 0.75 \, g = 0.25 \, g = 250 \, mg \]

Thus, the mass of sodium hydroxide left unreacted is \(\mathbf{250 \, mg}\). Quick Tip: To find the amount of a substance left unreacted in a neutralization reaction, first calculate the moles of both reactants and determine the limiting reagent.

In the first reaction, alcohol (\textit{ROH) reacts with phosphorus trichloride (\textit{PCl\(_3\)), yielding alkyl chloride (\textit{RCl) and phosphorous acid (\textit{H\(_3\)PO\(_3\)) as the product A. The reaction is:
\[ 3ROH + PCl_3 \rightarrow 3RCl + H_3PO_3 \]

In the second reaction, alcohol (\textit{ROH) reacts with phosphorus pentachloride (\textit{PCl\(_5\)), producing alkyl chloride (\textit{RCl), hydrogen chloride (\textit{HCl), and phosphorus oxychloride (\textit{POCl\(_3\)) as the product B. The reaction is:
\[ ROH + PCl_5 \rightarrow RCl + HCl + POCl_3 \]


Thus, the correct answer is: {Option (4) Quick Tip: When phosphorus trichloride (\(\text{PCl_3\)) reacts with alcohols, it forms alkyl chlorides and POCl\(_3\). When phosphorus pentachloride (\(PCl_5\)) reacts with alcohols, it also produces alkyl chlorides, HCl, and phosphorous acid (H\(_3\)PO\(_3\)).

The compound "P" formed in the reaction corresponds to the second compound produced based on the chemical reaction and the compounds involved.

The image above depicts the reaction mechanism where reactant A is converted into product C, with compound "P" being the intermediate or final product based on the reaction pathway. Quick Tip: In reaction mechanism questions, visualizing the process with a diagram or flow chart helps in identifying the key intermediates and products formed during the reaction.

The first reaction involves nucleophilic substitution of \(I^-\) with \(CN^-\), leading to the formation of C (phenylpropyl cyanide).


The second step is hydrolysis, which converts the nitrile group into an amide. After hydrolysis, B is the corresponding amine, and C is propylamine. Quick Tip: In nucleophilic substitution reactions, the cyanide ion (\(CN^-\)) replaces the halide ion to form nitriles, which can then be hydrolyzed to form amides or amines.

Mohr's salt (Ferrous ammonium sulphate) is prepared by dissolving ferrous sulphate in a solution of ammonium sulphate, and the presence of dilute sulphuric acid prevents the hydrolysis of Fe\(^{2+}\) ions. The Fe\(^{2+}\) ion is susceptible to oxidation and hydrolysis in the presence of water and oxygen, but the dilute sulphuric acid lowers the pH of the solution, preventing this process. Quick Tip: Dilute sulphuric acid helps to prevent the oxidation and hydrolysis of Fe\(^2+\) ions, maintaining their stability.

The reaction is as follows: \[ 2 NO (g) \rightleftharpoons N_2 (g) + O_2 (g) \]

Initial concentrations of the gases: \[ [NO] = 0.1 \, M, \, [N_2] = 0, \, [O_2] = 0 \]

Let the degree of dissociation of NO be \(\alpha\).

At equilibrium, the change in the concentration of NO will be \(0.1 \alpha\). Therefore, the concentrations at equilibrium will be: \[ [NO] = 0.1 - 0.1\alpha \] \[ [N_2] = 0.05 \alpha \] \[ [O_2] = 0.05 \alpha \]

Using the equilibrium constant expression for the reaction: \[ K_c = \frac{[N_2][O_2]}{[NO]^2} \]

From the given equilibrium concentrations: \[ K_c = 4.2 \times 10^{-3} \]

Solving the quadratic equation, we find that the degree of dissociation, \(\alpha\), is approximately 0.717. Quick Tip: To calculate the degree of dissociation, use the stoichiometry of the reaction and the equilibrium constant expression. Solving for \(\alpha\) involves setting up a quadratic equation.

For an isothermal reversible expansion, the work done (\( W \)) is given by the formula: \[ W = -nRT \ln \frac{P_2}{P_1} \]
Where:
\( n \) = number of moles = 1
\( R \) = gas constant = 2.0 cal K\(^{-1}\) mol\(^{-1}\)
\( T \) = temperature = 25°C = 298 K
\( P_1 \) = initial pressure = 20 atm
\( P_2 \) = final pressure = 10 atm

Substitute the values: \[ W = 1 \times 2.0 \times 298 \times \ln \frac{10}{20} \] \[ W = 2.0 \times 298 \times \ln 0.5 \] \[ W = 2.0 \times 298 \times (-0.693) \] \[ W = -413.14 calories \]
Thus, the work done is \(-413.14\) calories. Quick Tip: In an isothermal expansion, the work done depends on the change in pressure, and a decrease in pressure leads to negative work.

The amount of copper deposited during electrolysis is given by the formula: \[ m = \frac{M I t}{n F} \]
Where:
\( m \) = mass of copper deposited
\( M \) = molar mass of copper = 63 g/mol
\( I \) = current = 9.6487 A
\( t \) = time = 100 s
\( n \) = number of electrons involved in the reaction = 2 (for Cu\(^{2+}\) to Cu)
\( F \) = Faraday constant = 96487 C/mol

Substituting the values: \[ m = \frac{63 \times 9.6487 \times 100}{2 \times 96487} \] \[ m = \frac{60786.1}{192974} \] \[ m = 0.315 g \]

Thus, the mass of copper deposited is 0.315 g. Quick Tip: The mass of a substance deposited during electrolysis is directly proportional to the current, time, and molar mass of the substance.

The rate of a reaction is given by the Arrhenius equation: \[ k = A \exp \left( - \frac{E_a}{RT} \right) \]
For two different temperatures, the ratio of the rate constants is: \[ \frac{k_2}{k_1} = \exp \left( - \frac{E_a}{R} \left( \frac{1}{T_2} - \frac{1}{T_1} \right) \right) \]
Given that the rate quadruples, \( \frac{k_2}{k_1} = 4 \), so: \[ \log 4 = \frac{E_a}{2.303R} \left( \frac{1}{T_1} - \frac{1}{T_2} \right) \]
Substituting the known values: \[ 0.6021 = \frac{E_a}{2.303 \times 8.314} \left( \frac{1}{300} - \frac{1}{330} \right) \]
Simplifying: \[ 0.6021 = \frac{E_a}{19.16} \times \left( \frac{30}{300 \times 330} \right) \] \[ 0.6021 = \frac{E_a}{19.16} \times 0.0030303 \] \[ E_a = \frac{0.6021 \times 19.16}{0.0030303} \] \[ E_a = 38.04 \, kJ/mol \]

Thus, the activation energy is 38.04 kJ/mol. Quick Tip: The rate of a reaction increases exponentially with temperature, and the activation energy can be calculated using the Arrhenius equation.

The relationship between osmotic pressure (\(\Pi\)) and concentration (\(C\)) is given by the formula: \[ \Pi = C R T \]
Where:
- \(\Pi\) is the osmotic pressure (in bar),
- \(C\) is the concentration (in mol/L),
- \(R\) is the ideal gas constant (in L bar mol\(^{-1}\) K\(^{-1}\)),
- \(T\) is the temperature (in Kelvin).


The plot of osmotic pressure (\(\Pi\)) vs concentration gives a straight line with slope \(R T\), so: \[ slope = R \times T \]
Given:
- The slope = 25.73 L bar mol\(^{-1}\),
- \(R = 0.083 \, L bar mol^{-1} K^{-1}\).


We can solve for \(T\): \[ T = \frac{slope}{R} \] \[ T = \frac{25.73}{0.083} = 310 \, K \]
Now, converting from Kelvin to Celsius: \[ T = 310 - 273.15 = 37^\circ C \]


Thus, the temperature is \( \boxed{37^\circ C} \). Quick Tip: The osmotic pressure is directly proportional to the temperature. The slope of the osmotic pressure vs concentration graph can be used to calculate the temperature.

A. Al\(^{3+}\): Group III, since aluminum is in group III of the periodic table.


B. Cu\(^{2+}\): Group II, copper is in group II.


C. Ba\(^{2+}\): Group II, since barium is in group II.


D. Co\(^{2+}\): Group VIII, cobalt belongs to the transition metals in group VIII.


E. Mg\(^{2+}\): Group II, magnesium is in group II. Quick Tip: In inorganic qualitative analysis, ions are identified and grouped based on their solubility, precipitation reactions, and their group number in the periodic table.

Statement I: Correct. A homoleptic complex has only one type of ligand, such as \([Co(NH_3)_6]^{3+}\), whereas a heteroleptic complex has more than one type of ligand, such as \([Co(NH_3)_4Cl_2]^+\).

Statement II: Correct. \([Co(NH_3)_6]^{3+}\) contains only one type of ligand (NH\(_3\)), while \([Co(NH_3)_4Cl_2]^+\) contains two different ligands (NH\(_3\) and Cl). Quick Tip: Homoleptic complexes have identical ligands, while heteroleptic complexes contain more than one type of ligand. The nature of ligands plays a crucial role in determining the stability and properties of the complex.

Diamagnetic ions are those that have all of their electrons paired. This means that there are no unpaired electrons in the ion's electron configuration.


Ce\(^{4+}\): The electron configuration of Ce is \([Xe] 4f^1 5d^1 6s^2\). For Ce\(^{4+}\), 4 electrons are removed, leaving the electron configuration as \([Xe] 4f^0 5d^0 6s^0\), which has no unpaired electrons, making it diamagnetic.


Yb\(^{2+}\): The electron configuration of Yb is \([Xe] 4f^{14} 6s^2\). For Yb\(^{2+}\), 2 electrons are removed, leaving the configuration as \([Xe] 4f^{14} 6s^0\), which also has no unpaired electrons, making it diamagnetic.


Thus, both Ce\(^{4+}\) and Yb\(^{2+}\) are diamagnetic.


Therefore, the correct answer is: \({(1) \, Ce^{4+} and Yb^{2+}}\). Quick Tip: Lanthanoid ions are diamagnetic when they have no unpaired electrons, which occurs when they achieve a stable electron configuration, usually with fully filled f-orbitals.

The compound "P" formed in the reaction corresponds to the second compound produced based on the chemical reaction and the compounds involved.

The image above depicts the reaction mechanism where reactant A is converted into product C, with compound "P" being the intermediate or final product based on the reaction pathway. Quick Tip: In reaction mechanism questions, visualizing the process with a diagram or flow chart helps in identifying the key intermediates and products formed during the reaction.

Let's go through each option:


1. Three resonance structures can be drawn for ozone (O\(_3\)):
- This statement is correct. Ozone has three resonance structures in which the bonding and charge distribution are delocalized over the three oxygen atoms.


2. BF\(_3\) has non-zero dipole moment:
- This statement is incorrect. BF\(_3\) is a trigonal planar molecule and has symmetry such that the dipole moments of the B–F bonds cancel each other out, resulting in a zero dipole moment.


3. Dipole moment of NF\(_3\) is greater than that of NH\(_3\):
- This statement is incorrect. In NF\(_3\), the electronegativity difference between nitrogen and fluorine is greater, but the molecule's geometry results in a smaller dipole moment compared to NH\(_3\), where the lone pair on nitrogen and the hydrogen atoms contribute to a larger dipole moment.


4. Three canonical forms can be drawn for CO\(_3^{2-}\) ion:
- This statement is correct. The carbonate ion (CO\(_3^{2-}\)) has three resonance structures, each of which shows the delocalization of the negative charge over the three oxygen atoms.


Thus, the correct answer is: \({(4) \, Three canonical forms can be drawn for CO_3^{2-} \, ion}\). Quick Tip: Resonance structures represent the delocalization of electrons within a molecule. In cases like CO\(_3^{2-}\), resonance helps in spreading out the charge and stabilizing the ion.

To find the empirical formula, we first assume a 100 g sample of compound X. Then, the masses of A, B, and C in this 100 g sample are:


Mass of A = 32 g,


Mass of B = 20 g,


Mass of C = 100 - (32 + 20) = 48 g.


Next, we convert these masses to moles using the given atomic masses:


Moles of A = \(\frac{32}{64} = 0.5\) mol,


Moles of B = \(\frac{20}{40} = 0.5\) mol,


Moles of C = \(\frac{48}{32} = 1.5\) mol.


Now, we divide each by the smallest number of moles (which is 0.5 mol):


A: \(\frac{0.5}{0.5} = 1\),


B: \(\frac{0.5}{0.5} = 1\),


C: \(\frac{1.5}{0.5} = 3\).


Thus, the ratio of A : B : C is 1 : 1 : 3. Therefore, the empirical formula is ABC\(_3\).


Thus, the correct answer is: \({(2) \, ABC_3}\). Quick Tip: The empirical formula represents the simplest whole-number ratio of elements in a compound. To determine it, convert the mass percentages of elements into moles and then divide by the smallest number of moles.

Let's analyze the terms in List I and match them with their correct counterparts in List II:


A. Rhizopus: This is commonly known as \textit{bread mould. Hence, A corresponds to III.
B. Ustilago: This is a genus of \textit{smut fungi, which causes smut diseases in plants. Thus, B corresponds to II.
C. Puccinia: This genus of fungi causes \textit{rust diseases in plants. Therefore, C corresponds to IV.
D. Agaricus: This is the genus of the \textit{common mushroom. Thus, D corresponds to I.


Thus, the correct matching is:
- A - III (Rhizopus matches with Bread mould)
- B - II (Ustilago matches with Mushroom)
- C - IV (Puccinia matches with Rust fungus)
- D - I (Agaricus matches with Smut fungus)

Therefore, the correct answer is (1) A-III, B-II, C-IV, D-I. Quick Tip: For fungal classifications, remember that Rhizopus is associated with bread mould, Ustilago with smut, Puccinia with rust, and Agaricus with mushrooms.

In seed germination, the part of the seed that forms the root is called the \textit{radicle. The radicle is the part that grows downward and eventually becomes the root system of the plant.


- A. This part is not involved in forming the root.


- B. This is another part of the seed that does not form the root.


- C. The part labeled "C" is the radicle, which will develop into the root when
the seed germinates.


- D. This part also does not form the root.


Thus, the part of the seed destined to form the root is labeled as C. Quick Tip: In seed germination, the radicle (typically labeled "C") is the first part to emerge and forms the root system.

Lecithin is a type of phospholipid, which is a molecule that consists of a glycerol backbone, two fatty acid chains, and a phosphate group attached to a polar head. Phospholipids are essential components of cell membranes and play a critical role in maintaining the structure and function of biological membranes.


Thus, lecithin is a phospholipid : {(2) \, \text{Phospholipids Quick Tip: Phospholipids are amphipathic molecules, meaning they have both hydrophilic (water-loving) and hydrophobic (water-repelling) parts. This property is crucial for forming the lipid bilayer of cell membranes.

Let's analyze each item from List I and match it with the appropriate item from List II:


A. Two or more alternative forms of a gene: The alternative forms of a gene are called alleles. Therefore, A corresponds to III.
B. Cross of F1 progeny with homozygous recessive parent: This is called a \textit{test cross, used to determine the genotype of the F1 progeny. Thus, B corresponds to IV.
C. Cross of F1 progeny with any of the parents: This is known as a \textit{back cross. It helps in studying inheritance patterns by crossing F1 progeny with the parent. Therefore, C corresponds to I.
D. Number of chromosome sets in plant: This refers to \textit{ploidy, which indicates the number of sets of chromosomes in an organism. Thus, D corresponds to II.


Thus, the correct matching is:

A - III (Two or more alternative forms of a gene are Alleles)

B - IV (Cross of F1 progeny with homozygous recessive parent is a Test cross)

C - I (Cross of F1 progeny with any of the parents is a Back cross)

D - II (Number of chromosome sets in a plant is Ploidy)

Therefore, the correct answer is (3) A-III, B-IV, C-I, D-II. Quick Tip: Remember, a \textit{test cross involves crossing with a homozygous recessive parent, while a back cross involves crossing with any parent (either homozygous dominant or recessive).

A transcription unit in DNA refers to the region of the DNA that is transcribed into RNA. This unit is defined by three main regions:


Promoter: The promoter region is located upstream (before) the structural gene and is where the RNA polymerase binds to initiate transcription.
Structural gene: This is the part of the DNA that is transcribed into messenger RNA (mRNA), which will then be translated into protein.
Terminator: The terminator region signals the end of transcription, telling the RNA polymerase to stop transcribing.


Thus, the three key regions that define a transcription unit are the promoter, structural gene, and terminator. Therefore, the correct answer is (4) Promoter, Structural gene, Terminator. Quick Tip: In a transcription unit, the promoter starts transcription, the structural gene is transcribed into RNA, and the terminator ends transcription.

Auxins are a group of plant hormones that promote growth by influencing various physiological processes, including cell elongation and division. They are commonly used by gardeners for various purposes, including controlling weeds.


Option (1): Promotes apical dominance. This is true for auxins, but it does not explain why grass is not affected. Apical dominance is more relevant to the growth of lateral buds, not the ability to control weeds.


Option (2): Promotes abscission of mature leaves only. Auxins are known to prevent leaf abscission, not promote it. This is incorrect in the context of the question.


Option (3): Does not affect mature monocotyledonous plants. This is the correct answer. Auxins tend to affect dicotyledonous plants more than monocotyledonous plants. Grass, which is a monocot, is not harmed by the application of auxins because monocots do not respond to auxins in the same way as dicots do.


Option (4): Can help in cell division in grasses, to produce growth. While auxins do promote cell division, the specific reason why they do not harm grasses is their lack of effect on mature monocotyledonous plants, not due to stimulation of growth in grasses.


Thus, the correct answer is (3) because auxin generally does not harm mature monocotyledonous plants like grass, while it effectively controls broadleaf weeds, which are dicotyledonous. Quick Tip: Auxin affects dicot plants more strongly than monocots, making it useful in controlling weeds without harming grasses, which are monocots.

Biodiversity loss is primarily driven by a number of human-induced and natural factors. Let's evaluate the causes mentioned in the options:


A. Over exploitation: Over-exploitation, such as overfishing, hunting, and deforestation, can lead to the depletion of species, thus contributing significantly to biodiversity loss.


B. Co-extinction: Co-extinction refers to the loss of a species due to the extinction of another species that it depends on. This is a direct cause of biodiversity loss, as the extinction of one species can cause a cascade effect on other dependent species.


C. Mutation: While mutations are a natural part of evolution and contribute to genetic diversity, they do not directly cause biodiversity loss. In fact, mutations are generally a source of genetic variation, not a cause of extinction.


D. Habitat loss and fragmentation: Habitat destruction and fragmentation are among the leading causes of biodiversity loss. When ecosystems are destroyed or broken into smaller, isolated patches, many species struggle to survive, leading to population declines and extinctions.


E. Migration: Migration does not directly cause biodiversity loss. In fact, migration is a natural process that allows species to adapt to changing environments, and is generally beneficial for genetic diversity.


Therefore, the correct causes of biodiversity loss from the given options are over-exploitation, co-extinction, and habitat loss and fragmentation. Thus, the correct answer is (4) A, B and D only. Quick Tip: Over-exploitation, co-extinction, and habitat loss are significant threats to biodiversity, while mutation and migration are natural processes that do not directly cause biodiversity loss.

Let's analyze the correct matching for the organisms and their respective products:


A. Clostridium butylicum: This bacterium is known for producing \textit{butyric acid as a by-product of fermentation. Therefore, A corresponds to III.


B. Saccharomyces cerevisiae: This yeast is widely used in the production of \textit{ethanol through fermentation. Thus, B corresponds to I.


C. Trichoderma polysporum: This fungus is known for producing \textit{Cyclosporin-A, an immunosuppressive drug used in organ transplant procedures. Therefore, C corresponds to IV.


D. Streptococcus sp.: Streptococcus species, especially \textit{Streptococcus pyogenes, produce \textit{streptokinase, an enzyme used to dissolve blood clots. Hence, D corresponds to II.


Thus, the correct matching is:

- A - III (Clostridium butylicum produces Butyric acid)

- B - I (Saccharomyces cerevisiae produces Ethanol)

- C - IV (Trichoderma polysporum produces Cyclosporin-A)

- D - II (Streptococcus sp. produces Streptokinase)

Therefore, the correct answer is (3) A-III, B-I, C-IV, D-II. Quick Tip: Know the key products of industrial microbiology: Saccharomyces cerevisiae for ethanol, Clostridium butylicum for butyric acid, Trichoderma polysporum for Cyclosporin-A, and Streptococcus sp. for streptokinase.

During cell division, the spindle fibers attach to the kinetochores of chromosomes during metaphase. The kinetochores are protein structures on the centromeres of chromosomes. The spindle fibers, which are microtubules, attach to the kinetochores to align the chromosomes at the metaphase plate.


Thus, the correct answer is (2) Metaphase. Quick Tip: Remember, spindle fibers attach to kinetochores and align chromosomes during \textit{metaphase, which is crucial for proper chromosome segregation.

An \textit{actinomorphic flower is one that is radially symmetrical, meaning it can be divided into equal halves along any plane passing through the center. Among the given options:

- Datura is an actinomorphic flower because it exhibits radial symmetry.
- Cassia, Pisum, and Sesbania are examples of flowers with bilateral symmetry (zygomorphic), not actinomorphic.


Thus, the correct answer is (1) Datura. Quick Tip: Actinomorphic flowers have radial symmetry, and they can be divided into two identical halves by multiple planes.

Carboxypeptidase is an enzyme that requires a \textit{zinc ion as a cofactor for its activity. Zinc plays a crucial role in the catalytic mechanism of the enzyme, particularly in the hydrolysis of peptide bonds in proteins.

;
Thus, the correct answer is (1) Zinc. Quick Tip: Zinc is a common cofactor for enzymes involved in protein digestion and hydrolysis, such as carboxypeptidase.

-A. Nucleolus: The nucleolus is the site of active ribosomal RNA (rRNA) synthesis, which is crucial for the formation of ribosomes. Therefore, A corresponds to III.


-B. Centriole: Centrioles are responsible for organizing microtubules and have a characteristic "cartwheel" structure. Hence, B corresponds to II.


-C. Leucoplasts: Leucoplasts are plastids that are involved in storing nutrients, particularly starches and oils. Therefore, C corresponds to IV.


-D. Golgi apparatus: The Golgi apparatus is involved in the formation of glycolipids and the modification of proteins. Hence, D corresponds to I.


Thus, the correct matching is:
- A - III (Nucleolus: site for active rRNA synthesis)
- B - II (Centriole: organization like the cartwheel)
- C - IV (Leucoplasts: for storing nutrients)
- D - I (Golgi apparatus: site of formation of glycolipids)


Therefore, the correct answer is (1) A-III, B-II, C-IV, D-I. Quick Tip: The nucleolus is key for rRNA synthesis, centrioles have a cartwheel structure, leucoplasts store nutrients, and the Golgi apparatus forms glycolipids.

Totipotency refers to the ability of a single plant cell to develop into a whole new plant. This is a fundamental property used in plant tissue culture, where any somatic cell can regenerate into a complete plant under appropriate conditions.


Thus, the correct answer is (1) Totipotency. Quick Tip: Totipotency is the ability of a single plant cell to regenerate into a whole plant, essential in plant breeding and tissue culture.

Hind II is a restriction enzyme that cuts DNA at a specific recognition sequence. The recognition sequence for Hind II consists of 6 base pairs (bp), specifically the sequence:
\[ 5' - AAGCTT - 3' \]

Therefore, the correct answer is (2) 6 bp. Quick Tip: Hind II cuts at the 6-base pair recognition sequence 5' - AAGCTT - 3', which is a common feature of many restriction enzymes.

A. The flowers of Vallisneria are not colorful and do not produce nectar. This statement is incorrect.


B. The flowers of water lily are typically not pollinated by water; instead, they are pollinated by insects. This statement is correct.


C. In water-pollinated species, the pollen grains are often protected from wetting, especially in species like water lilies, to ensure successful fertilization. This statement is correct.


D. Some hydrophytes, like those in aquatic environments, produce long, ribbon-like pollen grains to facilitate their movement in water. This statement is correct.


E. In some hydrophytes, pollen grains are carried passively inside the water, which is another form of water pollination. This statement is correct.


Thus, the correct answer is (4) B, C, D and E only. Quick Tip: Water-pollinated species have specialized adaptations like long, ribbon-like pollen grains and protection against wetting for successful fertilization.

Statement I: Parenchyma is a living tissue, but collenchyma is also a living tissue, not dead. Therefore, Statement I is false.


Statement II: Gymnosperms lack xylem vessels (they have tracheids for water conduction), while angiosperms have xylem vessels. This statement is true.

Thus, the correct answer is (4) Statement I is false but Statement II is true. Quick Tip: Remember, collenchyma is living, and gymnosperms lack xylem vessels, while angiosperms have them.

Dedifferentiation is the process in which mature, differentiated cells revert to a less specialized state, allowing them to divide and form new tissues. The formation of interfascicular cambium from parenchyma cells is an example of dedifferentiation, as the parenchyma cells, which are normally non-dividing, regain the ability to divide and form cambium.


Thus, the correct answer is (3) Dedifferentiation. Quick Tip: Dedifferentiation is when mature cells lose their specialized features and revert to a more primitive state to divide and form new tissues.

Malonate is a molecule that resembles succinate, the natural substrate of succinic dehydrogenase. When malonate binds to the active site of the enzyme, it competes with succinate for binding. This type of inhibition, where a molecule similar in structure to the substrate competes for the active site, is called competitive inhibition.


In competitive inhibition, the inhibitor (malonate) can be overcome by increasing the concentration of the substrate (succinate), since both molecules are competing for the same binding site on the enzyme.


Thus, the correct answer is (3) Competitive inhibition. Quick Tip: In competitive inhibition, an inhibitor competes with the substrate for the active site of the enzyme, and its effects can be reversed by increasing substrate concentration.

The terms epigynous, hypogynous, and perigynous describe the position of the floral parts (calyx, corolla, androecium) relative to the ovary:

- Epigynous: The floral parts are above the ovary, i.e., the ovary is inferior.

- Hypogynous: The floral parts are below the ovary, i.e., the ovary is superior.

- Perigynous: The floral parts are attached around the ovary at the same level, i.e., the ovary is semi-inferior.

In the given figures:

- Figure (a) shows a flower where the calyx, corolla, and androecium are attached around the ovary, indicating perigynous positioning.

- Figure (b) also shows a similar arrangement, with the floral parts positioned around the ovary, indicating perigynous positioning.


Thus, both flowers in the figures are perigynous, and the correct answer is (4) (a) Perigynous; (b) Perigynous. Quick Tip: In perigynous flowers, the floral parts are attached around the ovary at the same level, making the ovary appear semi-inferior.

To determine the genotype of the black-seeded plant, we need to perform a test cross. A test cross involves crossing the plant with a known homozygous recessive genotype (bb).

- If the black seed plant is homozygous dominant (BB), all offspring will have black seeds (Bb).

- If the black seed plant is heterozygous (Bb), the offspring will have a 1:1 ratio of black and white seeds (Bb:bb).


Thus, crossing with a bb plant will allow us to observe the offspring and determine whether the black-seeded plant is homozygous (BB) or heterozygous (Bb).


Thus, the correct answer is (2) bb. Quick Tip: A test cross with a homozygous recessive plant (bb) is the best way to determine the genotype of a dominant phenotype plant.

The tropical regions are known for their high species richness due to several factors:

- A: Tropical latitudes have remained relatively undisturbed for millions of years, providing more time for species to evolve and diversify.

- C: More solar energy is available in the tropics, supporting a greater variety of life forms.

- D: The constant environment in tropical regions allows for specialized niches to develop, leading to greater biodiversity.

- E: The predictability and stability of the tropical environment provide optimal conditions for many species to thrive.


Thus, the correct answer is (1) A, C, D and E only. Quick Tip: Tropical regions have high biodiversity due to time for diversification, abundant energy, stable conditions, and niche specialization.

In the Verhulst-Pearl logistic growth equation, \( K \) represents the carrying capacity of the environment. This is the maximum population size that the environment can sustain over the long term, considering available resources and space.

- \( r \) represents the intrinsic rate of natural increase or biotic potential.

- The term \( \frac{N}{K} \) accounts for the effect of the population size relative to the carrying capacity.


Thus, the correct answer is (3) Carrying capacity. Quick Tip: In logistic growth, \( K \) represents the carrying capacity, the maximum population size an environment can support.

The component described as having thin outer walls and highly thickened inner walls is characteristic of xylem vessels. Xylem vessels are specialized structures in plants for the conduction of water and minerals.

- The outer walls of the xylem vessels are thin to allow for easier passage of water, while the inner walls are highly thickened with lignin, providing structural support and preventing collapse under the pressure of water transport.


Thus, the correct answer is (1) C, as it matches the description of the xylem vessel. Quick Tip: Xylem vessels have thickened inner walls and thin outer walls, which allow efficient water conduction and structural integrity.

- Statement I is true. During the leptotene stage of meiosis, chromosomes start to condense and become visible under a light microscope as thin threads.

- Statement II is also true. The beginning of the diplotene stage is marked by the dissolution of the synaptonemal complex, leading to the separation of homologous chromosomes.


Thus, both statements are correct, so the correct answer is (1). Quick Tip: In meiosis, leptotene marks the first visible stage of chromosomes, while diplotene is recognized by the dissolution of the synaptonemal complex.

The International Union for Conservation of Nature (IUCN) is the organization responsible for maintaining the Red List, which classifies species based on their conservation status, including those that are endangered or critically endangered.


Thus, the correct answer is (4) IUCN. Quick Tip: The IUCN Red List is the most comprehensive source for information on the conservation status of species worldwide.

The dark reaction of photosynthesis, also known as the Calvin cycle, involves the fixation of carbon dioxide (CO2) into organic molecules, which requires the following components:

- CO2 (C) is the substrate for the Calvin cycle.

- ATP (D) provides the energy required for the reactions.

- NADPH (E) provides the reducing power needed for the conversion of 3-phosphoglycerate into glyceraldehyde-3-phosphate.


While light is required for the light reactions and chlorophyll is involved in capturing light energy, neither is directly used in the dark reaction.


Thus, the correct answer is (3) C, D, and E only. Quick Tip: The dark reaction of photosynthesis uses ATP, NADPH, and CO2 to synthesize glucose, but does not require light.

The type of conservation in which species are removed from their natural habitat and placed in special settings for protection and care is referred to as ex-situ conservation.


Biodiversity conservation is a broader term that includes both in-situ and ex-situ methods of conservation. Ex-situ conservation involves taking species out of their natural habitats and protecting them in controlled environments such as zoos, botanical gardens, or aquariums.


Thus, the correct answer is (B) Biodiversity conservation as it is a broader term that can include this method. Quick Tip: Ex-situ conservation involves protecting species outside their natural habitats, such as in zoos or botanical gardens.

When a piece of DNA containing the gene of interest is transferred into an alien organism (through genetic engineering), it may have the following outcomes:

- It may get integrated into the genome of the recipient (B). This is common in genetically modified organisms (GMOs), where the foreign DNA becomes part of the host’s chromosome.

- It may multiply and be inherited along with the host DNA (C), if the gene is successfully integrated into the genome.


The other possibilities such as the DNA multiplying independently in progeny cells or not becoming an integral part of the chromosome are less likely in the context of genetic modification aimed at stable inheritance of the gene.


Thus, the correct answer is (C) B and C only. Quick Tip: When transferring foreign DNA into an organism, it may integrate into the host genome and be inherited by future generations.

Lactose is transported across the bacterial cell membrane by the action of permease, which is a membrane-bound protein. Beta-galactosidase is an enzyme that breaks down lactose into glucose and galactose, but it is not responsible for transporting lactose into the cell. Quick Tip: Permease is the protein responsible for the transport of lactose into bacterial cells.

Mendel's Law of Dominance states that when two contrasting traits are crossed, only one of the parental traits will be expressed in the F1 generation, and the recessive trait will reappear in the F2 generation. The key concepts of this law include:

- A dominant allele masks the expression of a recessive allele (A).

- Factors (genes) occur in pairs in diploid organisms (C).

- The discrete unit controlling a character is called a factor (D).

- Only one of the parental characters is expressed in the F1 generation of a monohybrid cross (E). Quick Tip: Mendel's Law of Dominance explains that one allele can mask the expression of another, leading to the dominance of one trait over the other.

Fungi are primarily classified based on:

- Morphology of mycelium (1)

- Mode of spore formation (3)

- Presence or absence of a fruiting body (4)


Mode of nutrition (2), though important in understanding fungal biology, is not a primary criterion for classification. Fungi can be saprophytic, parasitic, or symbiotic, but these aspects do not play a central role in their classification. Quick Tip: Fungi are classified primarily based on their mycelium structure, spore formation, and fruiting body, not on their mode of nutrition.

Statement I: Bt toxins are insect group specific and coded by a gene cry IAc.


- This statement is correct. Bt toxins are indeed insect group-specific, and the gene cry IAc codes for one type of Bt toxin that targets specific insects.


Statement II: Bt toxin exists as inactive protoxin in B. thuringiensis. However, after ingestion by the insect, the inactive protoxin gets converted into active form due to acidic pH of the insect gut.


- This statement is incorrect. While Bt toxins exist as inactive protoxins in Bacillus thuringiensis, they are activated not only due to acidic pH but also by proteases in the insect gut, which cleave the protoxin into its active form.


Thus, Statement I is true but Statement II is false. Quick Tip: The Bt toxin is activated by proteolytic cleavage in the insect gut, not just due to acidic pH.

Bulliform cells are specialized cells found in the leaves of monocots. These cells control the folding and unfolding of the leaf by regulating turgor pressure. When the plant is under water stress, bulliform cells lose turgor pressure, causing the leaf to curl inward, reducing the surface area and water loss. Quick Tip: Bulliform cells help in the inward curling of leaves to reduce water loss in monocots under stress conditions.

This is an example of incomplete dominance, where the heterozygous condition results in an intermediate phenotype. The cross between a red-flowered plant (RR) and a pink-flowered plant (Rr) will yield both red (RR) and pink (Rr) flowered progeny. Quick Tip: Incomplete dominance results in an intermediate phenotype in the F1 generation, producing both red and pink flowers.

In the Calvin cycle, the fixation of one molecule of CO\textsubscript{2 requires 3 molecules of ATP and 2 molecules of NADPH. These molecules are used in the reduction phase of the cycle to convert 3-phosphoglycerate (\( 3-PGA \)) into glyceraldehyde-3-phosphate (\( G3P \)). Quick Tip: The Calvin cycle requires 3 ATP and 2 NADPH molecules for each CO\textsubscript{2} molecule fixed during the reduction phase.

A. Robert May is associated with Global species diversity at about 7 million species, making it III.

B. Alexander von Humboldt is associated with the Species-Area relationship, making it I.

C. Paul Ehrlich is linked with the Rivet popper hypothesis, making it IV.

D. David Tilman is known for conducting Long term ecosystem experiments using outdoor plots, making it II.


Thus, the correct match is:(2) A-III, B-I, C-IV, D-II Quick Tip: Robert May is known for his work on global species diversity. Alexander von Humboldt's work laid the foundation for the species-area relationship.

The description that best fits the given figure (not shown here) is that of a wind-pollinated plant inflorescence, which typically has well-exposed stamens to release pollen efficiently into the air for dispersal.

- In wind-pollinated plants, the flowers are often small and not brightly colored, as they do not need to attract pollinators like insects or birds.


Thus, the correct description is: Wind pollinated plant inflorescence showing flowers with well exposed stamens. Quick Tip: Wind-pollinated plants have flowers with exposed stamens to release pollen into the air.

A. Frederick Griffith is known for his discovery of transformation, making it III.


B. Francois Jacob and Jacque Monod are known for their work on the Lac operon, making it IV.


C. Har Gobind Khorana is associated with the genetic code, making it I.


D. Meselson and Stahl are credited with the discovery of the semi-conservative mode of DNA replication, making it II.


Thus, the correct match is:(2) A-III, B-IV, C-I, D-II Quick Tip: Frederick Griffith is known for discovering transformation, and Meselson and Stahl provided evidence for the semi-conservative mode of DNA replication.

- Gibberellin is known for promoting stem elongation, increasing the length of stems and internodes. This results in an increase in the yield of crops like sugarcane.
- Auxins, cytokinins, and abscisic acid have different roles in plant growth regulation but are not specifically known for increasing stem length in the same way as gibberellins.


Thus, the correct answer is (2) Gibberellin. Quick Tip: Gibberellin promotes stem elongation, leading to increased crop yield, especially in crops like sugarcane.

A. Rose has twisted aestivation, making it I.

B. Pea has marginal placentation, making it IV.

C. Cotton produces a drupe, making it III.

D. Mango has a perigynous flower, making it II.

Thus, the correct match is:(1) A-II, B-IV, C-I, D-III. Quick Tip: The aestivation type and placentation pattern are important for identifying specific plant families and their floral characteristics.

A. Asexual reproduction occurs usually by biflagellate zoospores. This is true for many members of Phaeophyceae.


B. Sexual reproduction is by oogamous method only. This is not always true for all Phaeophyceae, as some species exhibit isogamous or anisogamous reproduction as well.


C. Stored food is in the form of carbohydrates such as mannitol or laminarin. This is correct for Phaeophyceae.


D. The major pigments found are chlorophyll a, c, carotenoids, and xanthophyll. This is true for Phaeophyceae.


E. Vegetative cells have a cellulosic wall, usually covered by a gelatinous coating of algin. This is also true for many members of Phaeophyceae.


Thus, the correct set of statements is A, C, D, and E only. Quick Tip: Phaeophyceae (brown algae) are characterized by their unique pigments, carbohydrate storage, and gelatinous coatings like algin.

The conversion of Succinyl-CoA to Succinic acid is a substrate-level phosphorylation step, which does not involve oxidation. The other steps involve oxidation of the substrate, such as the conversion of Isocitrate to \(\alpha\)-ketoglutaric acid (option 4). Quick Tip: In the tricarboxylic acid cycle, most steps involve oxidation reactions except for the conversion of Succinyl-CoA to Succinic acid, which is a substrate-level phosphorylation.

Statement I is true as in C3 plants, photorespiration occurs due to RuBisCO binding with O\(_2\) instead of CO\(_2\). This reduces CO\(_2\) fixation efficiency. Statement II is false because in C4 plants, both mesophyll and bundle sheath cells show little photorespiration, but the main advantage comes from the spatial separation of CO\(_2\) fixation. Quick Tip: In C3 plants, photorespiration reduces the efficiency of CO\(_2\) fixation, while in C4 plants, the separation of processes in mesophyll and bundle sheath cells reduces photorespiration.

A. GLUT-4 is a transporter that enables glucose transport into cells, so it matches with IV.

B. Insulin is a hormone, so it matches with I.

C. Trypsin is an enzyme, so it matches with II.

D. Collagen is part of the intercellular ground substance, so it matches with III.

Thus, the correct match is: (1) A-IV, B-I, C-II, D-III. Quick Tip: GLUT-4 is a glucose transporter, Insulin is a hormone, Trypsin is an enzyme, and Collagen is an intercellular component.

A. Monoadelphous stamens are found in China-rose, so it matches with IV.

B. Diadelphous stamens are found in Pea, so it matches with II.

C. Polyadelphous stamens are found in Citrus, so it matches with I.

D. Epiphyllous stamens are found in Lily, so it matches with III.

Thus, the correct match is: (1) A-IV, B-II, C-I, D-III. Quick Tip: The arrangement of stamens (monadelphous, diadelphous, etc.) helps classify plants into different categories.

Chloroplasts contain circular, double-stranded DNA, similar to the DNA found in prokaryotic cells. Quick Tip: Chloroplast DNA is similar to the DNA in bacteria, as chloroplasts are thought to have evolved from endosymbiotic bacteria.

The GPP of the ecosystem can be determined by the flow of energy through trophic levels. Typically, energy decreases as it moves up the trophic levels due to loss in respiration and other processes. Quick Tip: The GPP of higher trophic levels is typically lower than the NPP of the first trophic level due to energy loss.

In somatic hybridization, protoplasts (cells with their cell walls removed) from two different plant varieties are fused to create hybrid plants. Quick Tip: Somatic hybridization is a technique used to combine genetic material from different plant varieties by fusing their protoplasts.

Citric acid cycle occurs in the mitochondrial matrix.
Glycolysis occurs in the cytoplasm.
Electron transport system is located in the inner mitochondrial membrane.
Proton gradient is formed across the intermembrane space of mitochondria. Quick Tip: The citric acid cycle and electron transport system are both key processes in cellular respiration, occurring within mitochondria.

In E. coli, the DNA dependent DNA polymerase catalyzes the addition of nucleotides in the 5’ → 3’ direction during DNA replication. Quick Tip: DNA polymerases always synthesize new DNA strands in the 5’ → 3’ direction.

Glucagon is a peptide hormone, not a steroid hormone. Cortisol, testosterone, and progesterone are all steroid hormones, derived from cholesterol. Quick Tip: Steroid hormones are lipophilic and are derived from cholesterol. Peptide hormones like glucagon are water-soluble.

Statement I is true because hymen can naturally tear due to physical activities or exercise, not necessarily the first coitus. Statement II is false because the hymen may tear due to various reasons, not only during the first sexual intercourse. Quick Tip: The hymen can tear due to activities like cycling, sports, or medical examination, not just during coitus.

Bio-reactors are typically used for large-scale production of microorganisms, not just small-scale bacterial cultures. They are designed to maintain optimal conditions for high-yield production. Quick Tip: Bio-reactors are essential for large-scale fermentation processes, such as the production of antibiotics or biofuels.

The correct RNA sequence transcribed from the template strand is 5' AUGUACCGUUUAUAGGUAAGU 3'. RNA polymerase synthesizes the RNA strand in the 5’ → 3’ direction, complementary to the DNA template. Quick Tip: DNA-dependent RNA polymerase uses the DNA template strand to synthesize an RNA strand complementary to the template.

Statement I is false because FSH acts on granulosa cells in females and Sertoli cells in males, not on Leydig cells. Statement II is true as estrogen is secreted by growing ovarian follicles and androgens by Leydig cells. Quick Tip: FSH stimulates the granulosa cells in females and Sertoli cells in males, while LH stimulates the Leydig cells in males.

A. Typhoid is caused by \textit{Salmonella typhi, a bacteria.

B. Leishmaniasis is caused by \textit{Leishmania, a protozoa.

C. Ringworm is caused by a fungus.

D. Filariasis is caused by \textit{Wuchereria bancrofti, a nematode.

Thus, the correct match is: (2) A-IV, B-III, C-I, D-II. Quick Tip: Leishmaniasis and Filariasis are protozoal and nematode infections, respectively, while Ringworm and Typhoid are fungal and bacterial infections.

The correct sequence for conduction of an action potential in the heart is: \[ SA node \rightarrow AV node \rightarrow AV bundle \rightarrow Bundle branches \rightarrow Purkinje fibers \]
Thus, the correct sequence is: (1) E-C-A-D-B. Quick Tip: The action potential in the heart follows a specific sequence to ensure coordinated contraction: SA node → AV node → AV bundle → Bundle branches → Purkinje fibers.

Diakinesis involves terminalisation of chiasmata (II).
Pachytene is marked by the appearance of recombination nodules (IV).
Zygotene is when the synaptonemal complex forms (I).
Leptotene is characterized by chromosomes appearing as thin threads (III). Quick Tip: Prophase I of meiosis has distinct stages: leptotene, zygotene, pachytene, diplotene, and diakinesis.

Skeletal muscles (voluntary) are attached to bones like triceps.
Smooth muscles (involuntary) are found in organs like the stomach.
Cardiac muscles are located in the heart. Quick Tip: Muscles are classified into skeletal, smooth, and cardiac based on structure, control, and location.

Non-medicated IUD is Lippes loop (III).
Copper releasing IUD is Multiload 375 (I).
Hormone releasing IUD is LNG-20 (IV).
Implants contain Progestogens (II). Quick Tip: IUDs (Intrauterine Devices) are either medicated or non-medicated and work by releasing copper or hormones to prevent pregnancy.

Lipase acts on ester bonds (II).
Nuclease acts on phosphodiester bonds (IV).
Protease breaks peptide bonds (I).
Amylase acts on glycosidic bonds (III). Quick Tip: Lipase, Nuclease, Protease, and Amylase are enzymes that break down different bonds in molecules like fats, nucleic acids, proteins, and carbohydrates.

Breast-feeding is essential for infant health, and colostrum contains antibodies that help develop resistance against infections, making both statements true. The reason correctly explains the assertion. Quick Tip: Breast-feeding provides crucial nutrients and antibodies through colostrum, which is the first milk produced after birth.

Homo habilis (A) was one of the earliest members of the genus Homo, followed by Homo erectus (D), then Homo neanderthalensis (C), and finally Homo sapiens (B). Quick Tip: Human evolution is a continuous process, with different species evolving over time.

Axoneme is associated with cilia and flagella (II).
Cartwheel pattern is found in centrioles (I).
Crista is a feature of mitochondria (IV).
Satellite is associated with chromosomes (III). Quick Tip: The structure and function of cell components like mitochondria, centrioles, and cilia are crucial for cellular processes.

Pterophyllum is the Angel fish (III).
Myxine is the Hag fish (I).
Pristis is the Saw fish (II).
Exocoetus is the Flying fish (IV). Quick Tip: Fish species vary widely, and each has unique adaptations like flight or deep-sea living.

\(\alpha\)-I antitrypsin deficiency leads to emphysema (III).
Cry IAb is associated with cotton bollworm (I).
Cry IAc is associated with corn borer (IV).
Enzyme replacement therapy is used for ADA deficiency (II). Quick Tip: Cry proteins are insecticidal and are used in genetically modified crops to protect them from pests like bollworm and corn borer.

The Ti plasmid in Agrobacterium tumefaciens induces the formation of tumors in plants by transferring part of the plasmid DNA to the plant genome. Quick Tip: The Ti plasmid is a key tool in plant genetic engineering, used to insert foreign genes into plant cells.

Pleurobrachia is a ctenophore (II).
Radula is a characteristic of Mollusca (I).
Stomochord is a feature of Hemichordata (IV).
Air bladder is found in Osteichthyes (III). Quick Tip: Ctenophores are marine invertebrates, and the radula is a feeding organ found in mollusks.

Vaults are not a natural or traditional contraceptive method. Coitus interruptus, periodic abstinence, and lactational amenorrhea are all traditional methods. Quick Tip: Traditional contraceptive methods are those that do not involve modern medical interventions but rely on behavior or biological processes.

The correct sequence of stages in cell division is:

1. Gap 1 phase (E)

2. Synthesis phase (C)

3. Gap 2 phase (A)

4. Karyokinesis (D)

5. Cytokinesis (B)
Quick Tip: Cell division includes interphase (G1, S, G2) and mitosis (karyokinesis and cytokinesis).

A constant gene pool means no changes in allele frequencies, so it does not affect the Hardy-Weinberg equilibrium. Genetic recombination, genetic drift, and gene migration all influence allele frequencies. Quick Tip: The Hardy-Weinberg equilibrium assumes that no evolutionary forces are acting on the population (no genetic drift, migration, mutation, or natural selection).

Pons connects different regions of the brain (III).
Hypothalamus has neurosecretory cells (IV).
Medulla controls respiration and gastric secretions (II).
Cerebellum provides additional space for neurons, regulates posture and balance (I). Quick Tip: The pons and medulla are part of the brainstem, which controls vital functions like respiration and heartbeat.

Expiratory capacity = Tidal volume + Expiratory reserve volume (II).
Functional residual capacity = Expiratory reserve volume + Residual volume (IV).
Vital capacity = Expiratory reserve volume + Tidal volume + Inspiratory reserve volume (I).
Inspiratory capacity = Tidal volume + Inspiratory reserve volume (III). Quick Tip: Vital capacity is the maximum amount of air a person can exhale after a maximum inhalation.

Myasthenia gravis, rheumatoid arthritis, and systemic lupus erythematosus (SLE) are autoimmune disorders.
Gout and muscular dystrophy are not autoimmune disorders. Quick Tip: Autoimmune diseases occur when the immune system mistakenly attacks the body’s own cells.

The Fallopian tube consists of components like the isthmus, infundibulum, and ampulla, but not the uterine fundus. Quick Tip: The Fallopian tube helps in transporting eggs from the ovaries to the uterus and is not associated with the uterine fundus.

Fibrous joints are immovable like those in the skull (III).
Cartilaginous joints are slightly movable, such as between adjacent vertebrae (I).
Hinge joints allow movement like in the knee (IV).
Ball and socket joints allow rotational movement like in the humerus and pectoral girdle (II). Quick Tip: Joints in the human body are classified based on their structure and the type of movement they allow.

The flippers of penguins and dolphins are examples of convergent evolution, where species from different evolutionary backgrounds evolve similar traits. Quick Tip: Convergent evolution results in the development of similar traits in unrelated species due to similar environmental pressures.

Statement I is false: The descending limb of the loop of Henle is permeable to water and impermeable to electrolytes.


Statement II is also false: The proximal convoluted tubule is lined by cuboidal epithelium with a brush border, not simple columnar. Quick Tip: The loop of Henle plays a critical role in the concentration of urine and the proximal convoluted tubule aids in reabsorption.

In cockroaches, anal cerci are present on the 10th segment in both sexes, which help in sensory functions. Quick Tip: The anal cerci in cockroaches play a role in detecting air currents and vibrations.

High partial pressure of oxygen (pO2) and lower concentration of hydrogen ions (H+) favour the formation of oxyhaemoglobin in the alveoli. Quick Tip: Oxyhaemoglobin is formed when oxygen binds to hemoglobin, primarily in the lungs where oxygen levels are high and pH is less acidic.

Gene 'X' in the plasmid pBR322 is responsible for controlling the copy number of the plasmid, while Gene 'Y' is involved in the replication process. Quick Tip: pBR322 is a commonly used plasmid vector in genetic engineering that contains antibiotic resistance genes and replication control mechanisms.

Down’s syndrome is caused by a trisomy of the 21st chromosome (III).
α-Thalassemia is associated with mutations on the 16th chromosome (IV).
β-Thalassemia is caused by mutations on the 11th chromosome (I).
Klinefelter’s syndrome is linked to the ‘X’ chromosome (II). Quick Tip: Down’s syndrome is characterized by an extra chromosome 21. Klinefelter’s syndrome results from the presence of an extra X chromosome in males.

Annelids are true coelomates, meaning they have a body cavity completely lined with mesoderm (A).
Poriferans are neither coelomates nor pseudocoelomates, they lack a true body cavity.
Aschelminthes (roundworms) are pseudocoelomates, not acoelomates.
Platyhelminthes (flatworms) are acoelomates, lacking a body cavity. Quick Tip: Coelomates have a true coelom, pseudocoelomates have a false cavity, and acoelomates lack a body cavity.

Common cold is caused by Rhinoviruses (III).
Haemozoin is released in blood due to ruptured RBCs after Plasmodium infection (I).
Widal test is used to confirm typhoid fever (II).
Allergy is caused due to dust mites (IV). Quick Tip: Rhinoviruses are the main cause of common cold, while Haemozoin is produced in Plasmodium infection.

Cocaine is derived from Erythroxylum (III).
Heroin is derived from Papaver somniferum (IV).
Morphine is an effective sedative in surgery (I).
Marijuana is derived from Cannabis sativa (II). Quick Tip: Morphine and heroin are derived from the opium poppy, while marijuana comes from Cannabis sativa.

Statement I is false because Gause's competitive exclusion principle states that two species competing for the same limiting resource cannot coexist indefinitely, not necessarily for different resources.


Statement II is true as, according to Gause's principle, the inferior competitor is often eliminated when resources are limited. Quick Tip: Gause's principle highlights that no two species can occupy the same niche for long if they are competing for the same resources.

Statement A is incorrect because the pharynx is not perforated by gill slits in all non-chordates; it is characteristic of chordates.


Statement B is correct as non-chordates lack a notochord.


Statement C is incorrect because the central nervous system in non-chordates is typically ventral.


Statement D is correct as the heart, if present, is dorsal in non-chordates.


Statement E is correct as many non-chordates lack a post-anal tail. Quick Tip: Non-chordates lack a notochord and the dorsal position of the heart, unlike chordates.

Statement I is correct because the cerebral hemispheres are indeed connected by the corpus callosum, which allows communication between the two hemispheres.


Statement II is incorrect because the brainstem consists of the medulla oblongata, pons, and midbrain, not the cerebrum. Quick Tip: The corpus callosum is essential for the exchange of information between the two cerebral hemispheres.

A. The structures used for storing of food: The crop is the part of the cockroach's digestive system responsible for storing food.


B. Ring of 6-8 blind tubules at junction of foregut and midgut: These are the gastric caeca, which help in digestion by secreting digestive enzymes.


C. Ring of 100-150 yellow coloured thin filaments at junction of midgut and hindgut: These are the Malpighian tubules, responsible for excretion and osmoregulation.


D. The structures used for grinding the food: The gizzard grinds food, breaking down particles mechanically. Quick Tip: In cockroaches, the crop stores food, the gastric caeca aids in digestion, the gizzard grinds food, and the Malpighian tubules are responsible for excretion and waste removal.

-A. Exophthalmic goiter: Caused by hypersecretion of thyroid hormone, resulting in protruding eyeballs.

-B. Acromegaly: Resulting from excessive secretion of growth hormone, causing abnormal growth.

-C. Cushing’s syndrome: Caused by excess secretion of cortisol, leading to symptoms like moon face and hyperglycemia.

-D. Cretinism: Due to hypo-secretion of thyroid hormone, leading to stunted growth and developmental issues.
Quick Tip: Exophthalmic goiter, acromegaly, Cushing's syndrome, and cretinism are conditions caused by abnormal hormone secretion, each with distinct symptoms related to the over- or under-production of thyroid or growth hormones.

-A. Incorrect: Juxta medullary nephrons are located at the junction of the cortex and medulla, not in the columns of Bertini.
-B. Incorrect: The renal corpuscle of juxta medullary nephrons is located in the outer cortex, not in the outer medulla.
-C. Correct: The loop of Henle of juxta medullary nephrons extends deep into the medulla, which helps in concentrating the urine.
-D. Incorrect: Juxta medullary nephrons are fewer in number compared to cortical nephrons. Quick Tip: The juxta medullary nephrons are vital for water conservation as their deep loop of Henle helps in the concentration of urine.

-E. The substrate binds to the active site of the enzyme, initiating the catalytic process.


-A. The enzyme-substrate complex is formed after the substrate binds to the active site.


-D. The enzyme catalyzes the breaking of chemical bonds in the substrate, facilitating the transition state.


-C. The product is released from the enzyme after the reaction.


-B. The enzyme is now free and ready to bind with a new substrate. Quick Tip: The enzyme catalytic cycle involves the binding of substrate, conversion into products, and release. The enzyme is reused in subsequent cycles.

A. Unicellular glandular epithelium: Goblet cells in the alimentary canal secrete mucus.


B. Compound epithelium: Found on the moist surface of the buccal cavity.


C. Multicellular glandular epithelium: Includes salivary glands which secrete saliva.


D. Endocrine glandular epithelium: Found in the pancreas, involved in hormone secretion. Quick Tip: Glandular epithelium includes unicellular (e.g., goblet cells), multicellular (e.g., salivary glands), and endocrine glands that secrete hormones (e.g., pancreas).

A. Mesozoic Era: Known as the age of reptiles and birds, including dinosaurs.


B. Proterozoic Era: Dominated by lower invertebrates.


C. Cenozoic Era: Age of mammals, characterized by their rise.


D. Paleozoic Era: Dominated by fish and amphibians. Quick Tip: The Mesozoic era is known for dinosaurs, the Cenozoic era for mammals, and the Paleozoic era for early vertebrates like fish and amphibians.

Statement I: Correct. Both mitochondria and chloroplasts are double membrane-bound organelles.


Statement II: Incorrect. The inner membrane of mitochondria is more impermeable compared to the outer membrane, but chloroplast membranes also have selective permeability, so this statement is not entirely correct. Quick Tip: Mitochondria and chloroplasts have double membranes. The inner membrane of mitochondria is highly impermeable to ions, whereas chloroplast membranes vary in permeability to facilitate photosynthesis.

A. P wave: Represents the depolarisation of the atria.


B. QRS complex: Represents the depolarisation of ventricles.


C. T wave: Represents the repolarisation of ventricles.


D. T-P gap: Indicates a period where heart muscles are electrically silent, representing no electrical activity. Quick Tip: The P wave, QRS complex, and T wave are key components of the electrocardiogram (ECG) that correspond to different phases of heart muscle electrical activity.

Statement I: Correct. Bone marrow is indeed the primary lymphoid organ responsible for the production of blood cells, including lymphocytes.


Statement II: Correct. The bone marrow produces T-lymphocytes, which mature in the thymus. Both organs provide the necessary environments for T-cell development. Quick Tip: Bone marrow is the site of hematopoiesis (blood cell production), while the thymus is responsible for the maturation of T-lymphocytes, essential for the adaptive immune response.

FSH (Follicle Stimulating Hormone) stimulates Sertoli cells, which support the process of spermatogenesis.


Leydig cells secrete testosterone, which is essential for spermatogenesis.


Spermiogenesis refers to the maturation of spermatids into sperm. Quick Tip: Spermatogenesis involves the transformation of spermatogonia into mature sperm cells through a series of stages, including spermiogenesis.

The father with blood group B+ could have a genotype IBi or IBIB, while the mother with blood group A+ could have IAi or IAIA.


The child with blood group O+ must inherit an i allele from both parents, making the father’s genotype IBi and the mother’s genotype IAi. Quick Tip: In the ABO blood group system, O blood type is recessive, and both parents must carry the i allele to produce a child with blood group O.

- A. RNA polymerase III: It synthesizes tRNA and small RNAs such as snRNAs.
- B. Termination of transcription: Rho factor is involved in terminating transcription in prokaryotes.
- C. Splicing of Exons: snRNPs (small nuclear ribonucleoproteins) are involved in splicing introns and exons in eukaryotic mRNA processing.
- D. TATA box: The TATA box is a promoter region that plays a role in the initiation of transcription in eukaryotes. Quick Tip: RNA polymerase III is responsible for the synthesis of small RNAs such as tRNA, while the TATA box in the promoter region is essential for the initiation of transcription in eukaryotes.