
NEET 2024 R1 Question Paper with Solution PDF is available for download. NTA conducted the exam successfully on May 5, 2024, from 2:00 PM to 5:20 PM in pen-paper mode. As per the students’ initial reaction, NEET 2024 Question Paper for R1 was reported as moderate. The Zoology section in NEET 2024 R1 Question Paper was reported as easy, Botany as easy, Physics as moderate, and Chemistry as moderate.
Candidates can download the official NEET 2024 Question Paper with Solution and Answer Key PDFs for R1 using the link below.
| NEET 2024 Question Paper with Answer Key (R1) | Check Solution |

A wheel of a bullock cart is rolling on a level road as shown in the figure below. If its linear speed is \( v \) in the direction shown, which one of the following options is correct (P and Q are any highest and lowest points on the wheel, respectively)?
The velocity of a point on a rolling wheel is the vector sum of the linear velocity of the wheel’s center and the tangential velocity of the point due to rotation.
For the topmost point \( P \), the tangential velocity due to rotation is in the same direction as the linear velocity. Thus, its speed is \( v + v = 2v \).
For the bottommost point \( Q \), the tangential velocity is opposite to the linear velocity, resulting in a net speed of \( v - v = 0 \).
Thus, point \( P \) moves faster than point \( Q \). Quick Tip: For a wheel rolling without slipping:
- Topmost point speed = \( 2v \) (linear speed + rotational speed).
- Bottommost point speed = \( 0 \) (linear speed - rotational speed).
Match List I with List II:
The spectral lines of hydrogen follow the Balmer series. Using the wavelengths given:
Transition \( n_2 = 3 \to n_1 = 2 \) corresponds to \( 656.3 \, nm \) (III).
Transition \( n_2 = 4 \to n_1 = 2 \) corresponds to \( 486.1 \, nm \) (IV).
Transition \( n_2 = 5 \to n_1 = 2 \) corresponds to \( 434.1 \, nm \) (II).
Transition \( n_2 = 6 \to n_1 = 2 \) corresponds to \( 410.2 \, nm \) (I). Quick Tip: For the Balmer series, the spectral transitions correspond to visible light, and the wavelength decreases as \( n_2 \) increases.
A thermodynamic system is taken through the cycle \( abcd \). The work done by the gas along the path \( bc \) is:
Work done along \( bc \) is calculated using the formula \( W = P \Delta V \).
Here, the volume remains constant along \( bc \) (\( \Delta V = 0 \)).
Therefore, \( W = 0 \). Quick Tip: For isochoric processes (\( \Delta V = 0 \)), no work is done as the gas volume does not change.
The terminal voltage of the battery, whose emf is \( 10 \, V \) and internal resistance \( 1 \, \Omega \), when connected through an external resistance of \( 4 \, \Omega \) as shown in the figure is:
The terminal voltage is given by: \[ V_{terminal} = E - I r \]
where \( E \) is the emf, \( I \) is the current, and \( r \) is the internal resistance.
Total resistance, \( R_{total} = 4 \, \Omega + 1 \, \Omega = 5 \, \Omega \).
Current, \( I = \frac{E}{R_{total}} = \frac{10}{5} = 2 \, A \).
Terminal voltage, \( V_{terminal} = 10 - 2 \times 1 = 8 \, V \). Quick Tip: To calculate terminal voltage, remember: external resistance affects current flow, and \( I r \) represents the voltage drop inside the battery.
In an ideal transformer, the turns ratio is \( \frac{N_P}{N_S} = \frac{1}{2} \). The ratio \( V_S : V_P \) is equal to (the symbols carry their usual meaning):
In an ideal transformer, the voltage ratio is directly proportional to the turns ratio: \[ \frac{V_S}{V_P} = \frac{N_S}{N_P} \]
Given \( \frac{N_P}{N_S} = \frac{1}{2} \), it follows that \( \frac{V_S}{V_P} = 2 \). Hence, \( V_S : V_P = 2 : 1 \). Quick Tip: For an ideal transformer: \[ \frac{V_S}{V_P} = \frac{N_S}{N_P}, \quad \frac{I_S}{I_P} = \frac{N_P}{N_S}. \]
A light ray enters through a right-angled prism at point \( P \) with an angle of incidence \( 30^\circ \) as shown in the figure. It travels through the prism parallel to its base \( BC \) and emerges along the face \( AC \). The refractive index of the prism is:
In a prism, the relationship between the angles is given by:
\[ r_1 + c = A \quad (1) \]
where:
- \( r_1 \) is the angle of refraction inside the prism,
- \( c \) is the angle of incidence on the face of the prism,
- \( A \) is the angle of the prism.
Also, from geometry, we have:
\[ r_1 = 90^\circ - c \quad (2) \]
Applying Snell's Law
On the incidence surface, applying Snell's law gives:
\[ \mu = \frac{\sin i}{\sin r_1} \]
Given that the angle of incidence \( i = 30^\circ \) and the angle of refraction is \( r_1 = 90^\circ - c \), we substitute into Snell’s law:
\[ 1 \cdot \sin(30^\circ) = \mu \cdot \sin(90^\circ - c) \]
Since \( \sin(30^\circ) = \frac{1}{2} \) and \( \sin(90^\circ - c) = \cos(c) \), we have:
\[ \frac{1}{2} = \mu \cdot \cos(c) \]
Rearranging this equation:
\[ \mu = \frac{1}{2 \cos(c)} \quad (3) \]
Squaring the equation
Now, we square both sides of equation (3):
\[ \mu^2 = \frac{1}{4 \cos^2(c)} \]
Next, applying the relationship for \( \mu \), we substitute into equation (1) and simplify:
\[ \mu^2 = \frac{5}{4} \quad \Rightarrow \quad \mu = \frac{\sqrt{5}}{2} \]
Thus, the refractive index of the prism is:
\[ \mu = \frac{\sqrt{5}}{2} \] Quick Tip: For light to travel parallel to the base of a prism, calculate the refractive index using Snell's law and geometric constraints.
The quantities that have the same dimensions as those of a solid angle are:
Solid angle is dimensionless, as are strain (change in dimensions) and angle (arc length to radius ratio). Quick Tip: Dimensionless quantities such as strain and angle are unitless and often used for ratios or relative measures.
A thin flat circular disc of radius \( 4.5 \, cm \) is placed gently over the surface of water. If the surface tension of water is \( 0.07 \, N/m \), then the excess force required to take it away from the surface is:
Excess force is calculated as: \[ F = 2 \pi r \cdot T = 2 \pi (0.045) (0.07) = 19.8 \, mN. \] Quick Tip: Use \( F = 2 \pi r \cdot T \) to calculate the force due to surface tension for circular objects.
Given below are two statements:
\textbf{Assertion A:} The potential \( (V) \) at any axial point, at \( 2 \, m \) distance \( (r) \) from the center of a dipole with dipole moment vector \( \mathbf{P} \) of magnitude \( 4 \times 10^{-6} \, C \cdot m \), is \( \pm 9 \times 10^3 \, V \).
Reason R: \( V = \pm \frac{2P}{4 \pi \epsilon_0 r^2} \), where \( r \) is the distance of the axial point.
In the light of the above statements, choose the correct answer from the options given below:
Substitute values into \( V = \pm \frac{2P}{4 \pi \epsilon_0 r^2} \): \[ V = \pm \frac{2 (4 \times 10^{-6})}{4 \pi (9 \times 10^9) (2)^2} = \pm 9 \times 10^3 \, V. \]
Assertion A is true, but Reason R fails to consider directionality. Quick Tip: For dipole potential calculations, use \( V = \pm \frac{2P}{4 \pi \epsilon_0 r^2} \) for axial points and \( \frac{P}{4 \pi \epsilon_0 r^3} \) for equatorial points.
In a uniform magnetic field of \( 0.049 \, T \), a magnetic needle performs \( 20 \) oscillations in \( 5 \) seconds. The moment of inertia of the needle is \( 9.8 \times 10^{-6} \, kg \cdot m^2 \). If the magnitude of the magnetic moment of the needle is \( x \times 10^{-5} \, Am^2 \), the value of \( x \) is:
Using the formula for oscillation frequency: \[ T = 2\pi \sqrt{\frac{I}{MB}}, \quad M = \frac{4\pi^2 I}{T^2 B}. \]
Substitute values: \[ M = \frac{4\pi^2 (9.8 \times 10^{-6})}{(5/20)^2 (0.049)} = 1280\pi^2 \times 10^{-5}. \] Quick Tip: For magnetic moment calculations, remember \( M = \frac{4\pi^2 I}{T^2 B} \) for harmonic motion in a magnetic field.
If the monochromatic source in Young's double slit experiment is replaced by white light, then:
With white light, all wavelengths interfere. The central fringe is white due to constructive interference, while other fringes are coloured due to wavelength dependence. Quick Tip: In white light interference, the central fringe is white, and other fringes are coloured because of wavelength-specific path differences.
Given below are two statements:
\textbf{Statement I:} Atoms are electrically neutral as they contain equal numbers of positive and negative charges.
\textbf{Statement II:} Atoms of each element are stable and emit their characteristic spectrum.
In the light of the above statements, choose the correct answer from the options given below:
Atoms are neutral due to balanced charges, making Statement I correct. However, not all atoms are stable; only specific configurations (e.g., inert gases) are stable, making Statement II incorrect. Quick Tip: Remember: Neutrality refers to charge balance, but stability depends on the electronic configuration.
The maximum elongation of a steel wire of \( 1 \, m \) length if the elastic limit of steel and its Young's modulus are \( 8 \times 10^8 \, N/m^2 \) and \( 2 \times 10^{11} \, N/m^2 \), respectively, is:
Maximum elongation is calculated using \( \Delta L = \frac{\sigma L}{Y} \). Substituting values: \[ \Delta L = \frac{8 \times 10^8 \times 1}{2 \times 10^{11}} = 4 \, mm. \] Quick Tip: Use \( \Delta L = \frac{\sigma L}{Y} \) to calculate elongation under stress. Ensure all units are consistent.
Consider the following statements:
A: For a solar cell, the I-V characteristics lie in the IV quadrant of the given graph.
B: In a reverse-biased \( pn \) junction diode, the current measured (in \( \muA \)) is due to majority charge carriers.
For solar cells, the I-V characteristics are in the IV quadrant due to negative current and positive voltage. In a reverse-biased \( pn \) diode, current arises from minority carriers. Quick Tip: Solar cell currents are negative under load conditions; reverse-biased currents in diodes are due to minority carriers.
A particle moving with uniform speed in a circular path maintains:
In circular motion, the direction of velocity changes continuously, causing varying acceleration despite uniform speed. Quick Tip: In uniform circular motion, velocity varies due to direction change, resulting in centripetal acceleration.
If \( c \) is the velocity of light in free space, the correct statements about photons are:
A: The energy of a photon is \( E = h\nu \).
B: The velocity of a photon is \( c \).
C: The momentum of a photon, \( p = \frac{h\nu}{c} \).
D: In a photon-electron collision, both total energy and total momentum are conserved.
E: Photon possesses positive charge.
Photons are chargeless (eliminating E) and follow \( E = h\nu \) and \( p = \frac{h\nu}{c} \), with energy and momentum conserved in collisions. Quick Tip: Photon properties: \( E = h\nu \), \( p = \frac{h\nu}{c} \), no charge, and energy-momentum conservation.
Two bodies \(A\) and \(B\) of the same mass undergo completely inelastic one-dimensional collision. Body \(A\) moves with velocity \(v_1\) while body \(B\) is at rest. After collision, the velocity ratio \(v_1 : v_2\) is:
Using momentum conservation: \[ v_2 = \frac{m_1 v_1 + m_2 v_2}{m_1 + m_2} = \frac{v_1}{2}. \]
Thus, \(v_1 : v_2 = 2:1\). Quick Tip: In inelastic collisions, combine momentum conservation with shared mass velocities.
The graph showing the variation of \(\frac{1}{\lambda^2}\) with kinetic energy \(E\) of a free particle is:
Correct Answer: (3)
Using \(\lambda = \frac{h}{\sqrt{2mE}}\), we find \(\frac{1}{\lambda^2} \propto E\), yielding a linear graph. Quick Tip: The relation \(\frac{1}{\lambda^2} \propto E\) ensures a straight-line graph for free particles.
An unpolarised light beam strikes a glass surface at Brewster's angle. Then:
At Brewster's angle, the reflected light becomes completely polarised perpendicular to the plane of incidence. This happens because the angle between the reflected and refracted rays becomes \(90^\circ\).
The refracted light, however, remains partially polarised because it contains components of both polarisation states. Quick Tip: The Brewster angle is given by \(\tan i = n\), where \(i\) is the Brewster angle and \(n\) is the refractive index of the medium.
At any instant of time \(t\), the displacement of a particle is given by \(x = 2t - 1\) (SI unit) under the influence of a force of \(5 \, N\). The instantaneous power is:
The velocity is given by the derivative of displacement with respect to time: \[ v = \frac{dx}{dt} = \frac{d(2t - 1)}{dt} = 2 \, m/s. \]
The instantaneous power is calculated as: \[ P = F \cdot v = 5 \times 2 = 10 \, W. \] Quick Tip: Instantaneous power is calculated using \(P = F \cdot v\), where \(F\) is the applied force, and \(v\) is the instantaneous velocity.
A tightly wound 100-turn coil of radius \( 10 \, cm \) carries a current of \( 7 \, A \). The magnetic field at the centre is:
(Take \( \mu_0 = 4\pi \times 10^{-7} \, SI units \))
The magnetic field at the centre of a circular coil is given by: \[ B = \frac{\mu_0 N I}{2R}, \]
where \( N \) is the number of turns, \( I \) is the current, \( R \) is the radius, and \( \mu_0 \) is the permeability of free space. Substituting the values: \[ B = \frac{(4\pi \times 10^{-7}) \times 100 \times 7}{2 \times 0.1} = 4.4 \, mT. \] Quick Tip: For a solenoid or circular coil, the magnetic field strength is proportional to the number of turns and current.
The moment of inertia of a thin rod about an axis passing through its midpoint and perpendicular to the rod is \( 2400 \, g cm^2 \). The length of the rod is:
The moment of inertia of a rod is given by: \[ I = \frac{1}{12} M L^2. \]
Here, \( I = 2400 \, g cm^2 = 2400 \times 10^{-7} \, kg m^2 \), \( M = 400 \, g = 0.4 \, kg \). Rearrange to find \( L \): \[ L = \sqrt{\frac{12I}{M}} = \sqrt{\frac{12 \times 2400 \times 10^{-7}}{0.4}} = 8.5 \, cm. \] Quick Tip: For rods, use \( I = \frac{1}{12}ML^2 \) when the axis is perpendicular and passes through the centre.
A bob is whirled in a horizontal plane at an initial speed \( \omega \). The tension in the string is \( T \). If the speed doubles, the tension becomes:
Tension in the string is proportional to the square of the velocity: \[ T \propto v^2. \]
If \( v \to 2v \), then \( T \to 4T \). Quick Tip: In circular motion, tension or centripetal force varies with the square of the velocity: \( F_c = m\frac{v^2}{r} \).
Match List-I with List-II:
Magnetic materials are characterised by their susceptibility:
- Diamagnetic: \( \chi = 0 \).
- Ferromagnetic: \( \chi \gg 1 \).
- Paramagnetic: \( 0 < \chi \ll 1 \).
- Non-magnetic: \( 0 < \chi < \epsilon \). Quick Tip: Material susceptibilities help classify substances into diamagnetic, paramagnetic, and ferromagnetic.
In the circuit, the equivalent capacitance between terminals \( A \) and \( B \) is:
The equivalent capacitance is calculated as:
- First, combine series capacitors: \( C_s = \frac{1}{\frac{1}{2} + \frac{1}{2}} = 1 \, \mu F \).
- Combine with parallel capacitors: \( C_p = 1 + 1 = 2 \, \mu F \).
Quick Tip: For capacitors in series, use \( C_s = \frac{1}{\sum \frac{1}{C}} \). For capacitors in parallel, use \( C_p = \sum C \).
A horizontal force \( 10 \, N \) is applied to a block \( A \) as shown. The mass of blocks \( A \) and \( B \) are \( 2 \, kg \) and \( 3 \, kg \) respectively. The blocks slide over a frictionless surface. The force exerted by block \( A \) on block \( B \) is:
The total acceleration of the system is: \[ a = \frac{F}{m_A + m_B} = \frac{10}{2 + 3} = 2 \, m/s^2. \]
The force exerted by \( A \) on \( B \) is: \[ F_{AB} = m_B \cdot a = 3 \times 2 = 6 \, N. \] Quick Tip: Use \( F = ma \) to calculate forces between objects in systems with known acceleration.
In the nuclear emission stated, the mass number and atomic number of the product \( Q \) are: \[ {}^{290}_{82}X \xrightarrow{\alpha} Y \xrightarrow{e^+} Z \xrightarrow{\beta^-} P \xrightarrow{e^-} Q \]
1. \( 286, 80 \)
2. \( 288, 82 \)
3. \( 286, 81 \)
4. \( 280, 81 \)
Correct Answer: (3) \( 286, 81 \)
- After \( \alpha \) decay, mass number reduces by 4, atomic number by 2: \( 286, 80 \).
- After \( \beta^+ \) emission, atomic number reduces by 1: \( 286, 79 \).
- After \( \beta^- \) emission, atomic number increases by 1: \( 286, 80 \).
- After electron capture, atomic number reduces by 1: \( 286, 81 \). Quick Tip: In nuclear reactions, track changes in mass and atomic numbers systematically for each decay step.
In a vernier calliper, \( (N+1) \) divisions of the vernier scale coincide with \( N \) divisions of the main scale. If 1 MSD represents \( 0.1 \, mm \), the vernier constant (in cm) is:
The vernier constant is defined as the difference in length between one main scale division (MSD) and one vernier scale division (VSD).
Given:
- \( N+1 \) divisions of the vernier scale coincide with \( N \) divisions of the main scale.
- 1 MSD represents \( 0.1 \, mm \).
Step 1: The total length corresponding to \( N \) divisions of the main scale is \( N \times 0.1 \, mm = 0.1N \, mm \).
Step 2: The total length corresponding to \( N+1 \) divisions of the vernier scale is \( (N+1) \times VSD \).
Step 3: Since both lengths are equal (as the \( N+1 \) divisions of the vernier scale coincide with \( N \) divisions of the main scale), we have: \[ 0.1N = (N+1) \times VSD \]
Step 4: Solve for the VSD: \[ VSD = \frac{0.1N}{N+1} \]
Step 5: The vernier constant is the difference between 1 MSD and 1 VSD: \[ Vernier constant = MSD - VSD = 0.1 \, mm - \frac{0.1N}{N+1} \, mm \] \[ Vernier constant = \frac{1}{100(N+1)} \, cm \]
Thus, the vernier constant is \( \frac{1}{100(N+1)} \, cm \). Quick Tip: Vernier constant: Subtract one vernier scale division from one main scale division to find the least count.
If \( x = 5 \sin \left( \pi t + \frac{\pi}{3} \right) \) represents the motion of a particle executing SHM, the amplitude and time period of motion, respectively, are:
The amplitude is the coefficient of \( \sin \): \( 5 \, m \). The angular frequency \( \omega = \pi \), and time period \( T = \frac{2\pi}{\omega} = \frac{2\pi}{\pi} = 2 \, s \). Quick Tip: In SHM, amplitude is the maximum displacement, and \( T = \frac{2\pi}{\omega} \) determines the period.
In the diagram, a strong bar magnet is moving towards solenoid-2 from solenoid-1. The direction of induced current in solenoid-1 and solenoid-2, respectively, are:
Using Lenz's law:
- In solenoid-1, induced current opposes the motion of the magnet, flowing \( AB \).
- In solenoid-2, induced current supports the approach of the magnet, flowing \( DC \). Quick Tip: Apply Lenz's law: Induced current always opposes the cause of its generation.
A logic circuit provides the output \( Y \) as per the truth table:
The expression for the output \( Y \) is:
From the truth table:
- When \( A = 0, B = 0 \), \( Y = 1 \).
- When \( A = 0, B = 1 \), \( Y = 0 \).
- When \( A = 1, B = 0 \), \( Y = 1 \).
- When \( A = 1, B = 1 \), \( Y = 0 \).
From the table, \( Y \) is \( 1 \) when \( B = 0 \), irrespective of \( A \). This indicates \( Y = \overline{B} \).
Thus, the Boolean expression for \( Y \) is \( \overline{B} \). Quick Tip: For truth tables, write expressions by observing the conditions under which output is \(1\) or \(0\).
A wire of length \( l \) and resistance \( 100 \, \Omega \) is divided into 10 equal parts. The first 5 parts are connected in series, while the next 5 parts are connected in parallel. The two combinations are again connected in series. The resistance of this final combination is:
Each part of the wire has resistance \( R_1 = \frac{100}{10} = 10 \, \Omega \).
- The first 5 parts connected in series: \[ R_s = 5 \cdot 10 = 50 \, \Omega. \]
- The next 5 parts connected in parallel: \[ R_p = \frac{10}{5} = 2 \, \Omega. \]
- Total resistance: \[ R_{total} = R_s + R_p = 50 + 2 = 52 \, \Omega. \] Quick Tip: For series combinations, add resistances. For parallel combinations, use \( R_p = \frac{R}{n} \) for identical resistors.
The output (\( Y \)) of the given logic gate is similar to the output of an:
To analyze the given circuit, let's break it step-by-step:
1. The circuit consists of two logic gates connected to form the output \( Y \).
2. The input signals \( A \) and \( B \) are passed through an OR gate, producing \( A + B \).
3. The output of the OR gate is then inverted (NOT gate), resulting in \( \overline{A + B} \).
4. Finally, \( \overline{A + B} \) is passed through another OR gate with the input \( A \cdot B \), which gives:
\[ Y = (A \cdot B) \cdot (\overline{A + B}). \]
The resulting operation is equivalent to the output of an AND gate. Quick Tip: Logic gates can often be simplified by analyzing their truth tables step-by-step.
A thin spherical shell is charged by some source. The potential difference between two points \( C \) and \( P \) (in V) is:
- A charged spherical shell has the same potential at all points inside the shell and on its surface. This property arises because the electric field inside the shell is zero.
- The potential \( V \) at any point inside the shell (including the center \( C \)) and on the surface \( P \) is given by:
\[ V = \frac{1}{4 \pi \epsilon_0} \cdot \frac{q}{R}, \]
where \( q = 1 \, \mu C = 1 \times 10^{-6} \, C \), \( R = 3 \, cm = 0.03 \, m \), and \( \frac{1}{4 \pi \epsilon_0} = 9 \times 10^9 \, SI units \).
- Since the potential \( V \) is the same at both points \( C \) and \( P \), the potential difference \( \Delta V = V_P - V_C = 0 \).
Thus, the potential difference between \( C \) and \( P \) is \(\mathbf{Zero}\). Quick Tip: The potential inside a spherical shell is constant, regardless of the position.
The mass of a planet is \( \frac{1}{10} \) that of Earth, and its diameter is half that of Earth. The acceleration due to gravity is:
The acceleration due to gravity (\( g \)) on a planet is given by the formula: \[ g = \frac{GM}{R^2} \]
Where:
- \( G \) is the gravitational constant,
- \( M \) is the mass of the planet,
- \( R \) is the radius of the planet.
Step 1: Let the mass of the planet be \( \frac{1}{10} \) that of Earth.
So, if the mass of Earth is \( M_{Earth} \), then: \[ M_{planet} = \frac{1}{10} M_{Earth} \]
Step 2: The diameter of the planet is half that of Earth, so the radius of the planet is: \[ R_{planet} = \frac{1}{2} R_{Earth} \]
Since the acceleration due to gravity is inversely proportional to the square of the radius, the radius term in the formula becomes: \[ R_{planet}^2 = \left( \frac{1}{2} R_{Earth} \right)^2 = \frac{1}{4} R_{Earth}^2 \]
Step 3: Now, substituting into the formula for gravity: \[ g_{planet} = \frac{G \times \frac{1}{10} M_{Earth}}{\left( \frac{1}{2} R_{Earth} \right)^2} = \frac{G \times \frac{1}{10} M_{Earth}}{\frac{1}{4} R_{Earth}^2} = \frac{4}{10} \times \frac{GM_{Earth}}{R_{Earth}^2} \]
Step 4: The acceleration due to gravity on Earth is \( g_{Earth} = \frac{GM_{Earth}}{R_{Earth}^2} = 9.8 \, m/s^2 \), so: \[ g_{planet} = \frac{4}{10} \times 9.8 \, m/s^2 = 3.92 \, m/s^2 \]
Thus, the acceleration due to gravity on the planet is \( 3.92 \, m/s^2 \). Quick Tip: Gravity depends directly on mass and inversely on the square of the radius.
The minimum energy required to launch a satellite into a circular orbit at \( 2R \) altitude is:
The total energy in orbit is: \[ E = \frac{-GMm}{2r} = \frac{-GMm}{2(3R)} = \frac{-GMm}{6R}. \]
Minimum energy to escape is: \[ \Delta E = \frac{GMm}{R} - \frac{GMm}{6R} = \frac{5GMm}{6R}. \] Quick Tip: The minimum energy to launch includes the escape velocity and potential energy change.
A telescope with an objective focal length of \( 140 \, cm \) and eyepiece focal length \( 5 \, cm \) has magnifying power:
The magnifying power \( M \) of a telescope for a distant object is given by the formula: \[ M = \frac{f_o}{f_e}, \]
where:
- \( f_o = 140 \, cm \) is the focal length of the objective lens.
- \( f_e = 5.0 \, cm \) is the focal length of the eyepiece.
Substituting the values: \[ M = \frac{140}{5.0} = 28. \]
Thus, the magnifying power of the telescope is \( 28 \). Quick Tip: For distant objects, magnifying power is the ratio of objective to eyepiece focal lengths.
The velocity (\( v \))-time (\( t \)) plot of a body is shown.
The acceleration (\( a \))-time (\( t \)) graph is:
Correct Answer: (2)
From the \( v-t \) graph, acceleration is the slope. During intervals, slope is constant and changes in steps, matching the stepped graph. Quick Tip: Acceleration is the slope of velocity-time graphs; look for constancy or changes.
Two heaters \( A \) and \( B \) have power ratings of \( 1 \, kW \) and \( 2 \, kW \), respectively. They are connected in series and then in parallel. The power ratio is:
Let the resistances of the heaters \( A \) and \( B \) be \( R_A \) and \( R_B \), respectively. From the formula for power \( P = \frac{V^2}{R} \), the resistance can be expressed as: \[ R = \frac{V^2}{P}. \]
So: \[ R_A = \frac{V^2}{1 \, kW} \quad and \quad R_B = \frac{V^2}{2 \, kW}. \]
1. **Case 1: Series Connection**
The total resistance in series is:
\[ R_series = R_A + R_B. \]
The power output is inversely proportional to the resistance, so:
\[ P_series = \frac{V^2}{R_series} = \frac{V^2}{R_A + R_B}. \]
2. **Case 2: Parallel Connection**
The total resistance in parallel is:
\[ R_parallel = \frac{R_A R_B}{R_A + R_B}. \]
The power output for parallel connection is:
\[ P_parallel = \frac{V^2}{R_parallel} = \frac{V^2}{\frac{R_A R_B}{R_A + R_B}} = \frac{V^2 (R_A + R_B)}{R_A R_B}. \]
3. **Ratio of Power Outputs**
The ratio of power outputs for series and parallel connections is:
\[ \frac{P_series}{P_parallel} = \frac{\frac{V^2}{R_A + R_B}}{\frac{V^2 (R_A + R_B)}{R_A R_B}} = \frac{R_A R_B}{(R_A + R_B)^2}. \]
Substituting \( R_A = \frac{V^2}{1} \) and \( R_B = \frac{V^2}{2} \):
\[ \frac{P_series}{P_parallel} = \frac{\left(\frac{V^2}{1}\right) \left(\frac{V^2}{2}\right)}{\left(\frac{V^2}{1} + \frac{V^2}{2}\right)^2} = \frac{\frac{V^4}{2}}{\left(\frac{3V^2}{2}\right)^2}. \]
Simplifying:
\[ \frac{P_series}{P_parallel} = \frac{\frac{1}{2}}{\frac{9}{4}} = \frac{2}{9}. \]
Thus, the ratio of power outputs is \( 2 : 9 \). Quick Tip: Power in series is inversely proportional, while power in parallel is directly proportional to resistance.
A force defined by \( F = \alpha t^2 + \beta t \) acts on a particle at time \( t \). The factor which is dimensionless, if \( \alpha \) and \( \beta \) are constants, is:
For \( \frac{\alpha t}{\beta} \) to be dimensionless:
- Dimensions of \( \alpha \): \( [F] \cdot [t]^{-2} = \frac{MLT^{-2}}{T^2} = MLT^{-4} \).
- Dimensions of \( \beta \): \( [F] \cdot [t]^{-1} = \frac{MLT^{-2}}{T} = MLT^{-3} \).
- \( \frac{\alpha t}{\beta} \) is dimensionless since \( \frac{MLT^{-4} \cdot T}{MLT^{-3}} = 1 \).
Quick Tip: To check for dimensionless quantities, ensure all units cancel out in the given ratio.
A \(10 \, \mu F\) capacitor is connected to a \(210 \, V, 50 \, Hz\) source. The peak current in the circuit is:
The capacitive reactance is given by: \[ X_c = \frac{1}{\omega C} = \frac{1}{2\pi f C}. \]
Substituting values: \[ X_c = \frac{1}{2 \cdot 3.14 \cdot 50 \cdot 10 \cdot 10^{-6}} = 318.31 \, \Omega. \]
The peak current: \[ I_{peak} = \frac{V_{peak}}{X_c} = \frac{210 \sqrt{2}}{318.31} \approx 0.93 \, A. \] Quick Tip: For AC circuits, use \( X_c = \frac{1}{\omega C} \) to find capacitive reactance and peak current.
A metallic bar of Young's modulus \( 0.5 \times 10^{11} \, N/m^2 \) and coefficient of linear expansion \( 10^{-5} , \degree C^{-1} \), heated from \( 0\degree C \) to \( 100\degree C \). The compressive force developed is:
Thermal stress is: \[ Stress = Y \cdot \alpha \cdot \Delta T. \]
The force is: \[ F = Stress \cdot A = Y \cdot \alpha \cdot \Delta T \cdot A. \]
Substituting values: \[ F = 0.5 \times 10^{11} \cdot 10^{-5} \cdot 100 \cdot 10^{-3} = 50 \times 10^3 \, N. \] Quick Tip: Thermal stress depends on Young's modulus, thermal expansion coefficient, and temperature change.
A parallel plate capacitor is charged through a resistor. If \( I \) is the current, then in the gap between the plates:
- When a parallel plate capacitor is connected to a battery, current flows in the circuit, and the capacitor starts charging.
- In the gap between the plates of the capacitor, a displacement current flows. This current arises due to the changing electric field and is given by:
\[ I_d = \epsilon_0 \frac{d\Phi_E}{dt}, \]
where \( I_d \) is the displacement current, \( \epsilon_0 \) is the permittivity of free space, and \( \Phi_E \) is the electric flux.
- In a charging capacitor, the displacement current \( I_d \) is equal in magnitude to the conduction current \( I \) in the external circuit and flows in the same direction as \( I \).
Thus, the displacement current is of the same magnitude as \( I \) and flows in the same direction. Quick Tip: For capacitors, displacement current bridges the gap between the plates, maintaining continuity.
Choose the correct circuit which achieves bridge balance:
Correct Answer: (4)
The condition for a Wheatstone bridge to be balanced is: \[ \frac{R_1}{R_2} = \frac{R_3}{R_4}, \]
where \( R_1, R_2, R_3, \) and \( R_4 \) are the resistances in the respective branches of the bridge.
Analyzing each circuit:
1. In Circuit (1): The ratio \( \frac{R_1}{R_2} \) is not equal to \( \frac{R_3}{R_4} \).
2. In Circuit (2): Similarly, the ratios are not equal.
3. In Circuit (3): The ratios are not balanced, and hence the bridge does not balance.
4. In Circuit (4): The ratio of resistances satisfies the balance condition:
\[ \frac{10 \, \Omega}{15 \, \Omega} = \frac{10 \, \Omega}{15 \, \Omega}. \]
Therefore, the bridge is balanced in this configuration.
Hence, the correct answer is Circuit (4). Quick Tip: In a balanced Wheatstone bridge, the ratio of resistances in one branch equals the other.
A sheet is placed near a magnetic pole. A force is needed to:
A. hold the sheet there if it is magnetic.
B. hold the sheet there if it is non-magnetic.
C. move the sheet away from the pole with uniform velocity if it is conducting.
D. move the sheet away from the pole with uniform velocity if it is both, non-conducting and non-polar.
Choose the correct statement(s) from the options given below:
(1) A and C only
(2) A, C and D only
(3) C only
(4) B and D only
Correct Answer: (1) A and C only
Analyzing the force on a magnetic sheet.
- If the sheet is magnetic, there will be an attractive force due to the magnetic field at the pole. This force must be counteracted to keep the sheet held in place. Hence, option A is correct.
Analyzing the force on a non-magnetic sheet.
- A non-magnetic sheet would not experience any significant force in the vicinity of the magnetic pole unless it is conducting. Therefore, option B is incorrect.
Force on a conducting sheet.
- If the sheet is conducting, a current will be induced in it due to the magnetic field. This current will interact with the magnetic field and create a force that would oppose the motion of the sheet. To move it away with uniform velocity, a force is required, making option C correct.
Force on a non-conducting, non-polar sheet.
- A non-conducting and non-polar sheet would not interact with the magnetic field in any significant way. Therefore, there is no need for a force to move the sheet with uniform velocity, making option D incorrect.
Thus, the correct statements are A and C only. Quick Tip: Magnetic or conducting materials near a magnetic field experience forces due to induced currents or direct attraction.
If plates of a parallel plate capacitor connected to a battery are moved closer:
A. the charge stored in it, increases.
B. the energy stored in it, decreases.
C. its capacitance increases.
D. the ratio of charge to its potential remains the same.
E. the product of charge and voltage increases.
Choose the most appropriate answer from the options given below:
(1) A, C and E only
(2) B, D and E only
(3) A, B and C only
(4) A, B and E only
Correct Answer: (1) A, C and E only
When the plates of a parallel plate capacitor connected to a battery are moved closer:
- The capacitance \( C \) of the capacitor increases because \( C = \frac{\epsilon_0 A}{d} \), where \( d \) is the separation between the plates, and \( d \) decreases.
- Since the capacitor is connected to a battery, the voltage \( V \) remains constant. The increased capacitance leads to an increase in the charge \( Q = CV \).
- The product of charge and voltage, \( Q \cdot V \), increases as the charge \( Q \) increases.
Thus, statements A, C, and E are correct. Quick Tip: Capacitance depends inversely on plate separation; reducing separation increases charge.
The following graph represents the \(T-V\) curves of an ideal gas (where \(T\) is the temperature and \(V\) the volume) at three pressures \(P_1\), \(P_2\), and \(P_3\), compared with Charles's law (dotted lines). Then the correct relation is:
According to the ideal gas law: \[ P V = nRT \implies V = \frac{nRT}{P}. \]
For a fixed number of moles, \(V \propto T/P\). At a given temperature, as pressure increases, the slope of the \(T-V\) curve (from the origin) decreases. Thus: \[ P_1 > P_2 > P_3 \quad (higher pressure corresponds to a steeper curve). \] Quick Tip: In \(T-V\) graphs, higher pressure corresponds to steeper curves because \(V \propto \frac{1}{P}\) at constant \(T\).
The property which is \textbf{not} of an electromagnetic wave travelling in free space is:
Electromagnetic waves are generated by charges undergoing acceleration, not by charges moving with uniform speed. All other properties are characteristics of electromagnetic waves:
- Energy densities of electric and magnetic fields are equal.
- Their speed is \( \frac{1}{\sqrt{\mu_0 \epsilon_0}} \).
- They are transverse waves.
Quick Tip: Electromagnetic waves are produced by accelerated charges, not by charges in uniform motion.
An iron bar of length \( L \) has magnetic moment \( M \). It is bent at the middle to make two arms at an angle \( 60^\circ \). The magnetic moment of this new magnet is:
The magnetic moment \( M \) of the original iron bar is given by: \[ M = I \times A \]
where \( I \) is the current (or the effective magnetic pole strength), and \( A \) is the area of the magnetic loop.
Effect of bending the bar.
When the iron bar is bent at the middle to form two arms, the magnetic moment is distributed across the two arms. The two arms are now at an angle of \( 60^\circ \) to each other, and their contributions to the magnetic moment are combined vectorially.
Since the arms are at an angle, the effective magnetic moment becomes: \[ M' = M \times \cos(30^\circ) = M \times \frac{1}{2} \]
Conclusion.
Thus, the magnetic moment of the new magnet after bending is \( \frac{M}{2} \), which corresponds to option (A). Quick Tip: When a magnetic bar is bent, the magnetic moment depends on the angle between the arms.
If the mass of a simple pendulum's bob is increased to thrice its original mass, and its length is halved, the new time period is \( \frac{x}{2} \) times the original. Find \( x \):
The time period of a pendulum is: \[ T = 2\pi \sqrt{\frac{L}{g}}. \]
If the length \( L \) is halved, the new time period becomes: \[ T_{new} = 2\pi \sqrt{\frac{L/2}{g}} = 2\pi \cdot \frac{1}{\sqrt{2}} \sqrt{\frac{L}{g}} = \frac{T}{\sqrt{2}}. \]
Comparing with \( \frac{x}{2} \): \[ \frac{T}{\sqrt{2}} = \frac{x}{2}T \implies x = \sqrt{2}. \] Quick Tip: Time period depends on pendulum length, not mass. Changes in length directly affect \( T \).
The reagents with which glucose does not react to give the corresponding tests/products are:
A. Tollen’s reagent
B. Schiff’s reagent
C. HCN
D. NH\(_2\)OH
E. NaHSO\(_3\)
- Glucose reacts with Tollen's reagent (A), HCN (C), and \(NH_2OH\) (D) to form characteristic products.
- It does not react with Schiff's reagent (B) because it is a mild oxidizing agent, and glucose is a reducing sugar.
- Sodium bisulfite (\(NaHSO_3\)) (E) does not react with glucose.
Thus, glucose does not react with B and E. Quick Tip: For organic chemistry questions, remember the functional group reactivity of glucose. Reducing sugars generally react with oxidizing agents, but Schiff's reagent and bisulfite don't show reactions with glucose.
The energy of an electron in the ground state (\(n=1\)) for \(He^+\) ion is \(-x\) J. Then, that for an electron in \(n=2\) state for \(Be^{3+}\) ion in J is:
The energy of an electron in a hydrogen-like atom is given by:
\[ E_n = -\frac{13.6 Z^2}{n^2} \, eV, \]
where \(Z\) is the atomic number and \(n\) is the energy level.
For \(He^+\), \(Z = 2\), and for \(Be^{3+}\), \(Z = 4\). The ratio of energies in the ground state and \(n=2\) for \(Be^{3+}\) gives:
\[ E = -\frac{x}{1} = -x. \] Quick Tip: For calculating energy levels in hydrogen-like atoms, always consider \(Z^2\) dependence for different atoms. Divide by \(n^2\) for excited states.
Which reaction is \textbf{NOT} a redox reaction?
- A redox reaction involves the transfer of electrons, leading to oxidation and reduction.
- In option (3), there is no change in oxidation states of elements; it is a simple double displacement reaction.
- In other options, electron transfer occurs, qualifying them as redox reactions.
Quick Tip: Always check the oxidation states of elements before and after a reaction to identify if it is redox. No change in oxidation states means no redox.
Match List-I with List-II: \[ \begin{array}{|l|l|} \hline List-I (Process) & List-II (Conditions)
\hline A. Isothermal process & I. No heat exchange
B. Isochoric process & II. Carried out at constant temperature
C. Isobaric process & III. Carried out at constant volume
D. Adiabatic process & IV. Carried out at constant pressure
\hline \end{array} \]
- Isothermal: Temperature constant \(\rightarrow\) II
- Isochoric: Volume constant \(\rightarrow\) III
- Isobaric: Pressure constant \(\rightarrow\) IV
- Adiabatic: No heat exchange \(\rightarrow\) I
Thus, the correct matching is \(A-II, B-III, C-IV, D-I\). Quick Tip: For thermodynamic processes, remember the definitions: - Iso- refers to "constant," and the suffix determines the variable (temperature, volume, or pressure).
For the reaction \(2A \rightleftharpoons B + C\), \(K_c = 4 \times 10^{-3}\). At a given time, \([A] = [B] = [C] = 2 \times 10^{-3}\). Which of the following is correct?
The reaction quotient \(Q_c\) is calculated as:
\[ Q_c = \frac{[B][C]}{[A]^2} = \frac{(2 \times 10^{-3})(2 \times 10^{-3})}{(2 \times 10^{-3})^2} = 1. \]
Since \(Q_c > K_c\), the reaction will shift in the backward direction to establish equilibrium. Quick Tip: Compare \(Q_c\) and \(K_c\):
- \(Q_c > K_c\): Reaction moves backward.
- \(Q_c < K_c\): Reaction moves forward.
- \(Q_c = K_c\): Reaction is at equilibrium.
Match List I with List II:
- Complex A exhibits ionization isomerism because NO\(_2^-\) can ionize.
- Complex B shows solvate isomerism due to SO\(_4^{2-}\) exchange with water molecules.
- Complex C shows coordination isomerism between the two metal centers.
- Complex D shows linkage isomerism because Cl\(^-\) can bind in multiple ways.
Quick Tip: For identifying isomerism in complexes, focus on possible ligand exchanges or binding modes: solvate, linkage, ionization, or coordination.
In which of the following processes entropy increases?
- A: A liquid evaporating to vapor increases entropy because gas has higher randomness.
- C: Decomposition of NaHCO\(_3\) increases entropy as solid converts to gases (CO\(_2\), H\(_2\)O).
- D: Dissociation of Cl\(_2\) into 2Cl increases entropy due to an increase in the number of particles.
- B: Lowering temperature decreases entropy as randomness decreases.
Quick Tip: Entropy increases in processes involving phase changes (solid to liquid to gas) or an increase in the number of gaseous molecules.
Identify the correct reagents that would bring about the following transformation:
- BH\(_3\) performs hydroboration of the double bond.
- H\(_2\)O\(_2\)/OH\(^-\) oxidizes the boron intermediate to an alcohol.
- PCC selectively oxidizes the alcohol to an aldehyde.
Quick Tip: For transformations involving aldehydes, use PCC for controlled oxidation of primary alcohols. Hydroboration ensures anti-Markovnikov addition.
Match List I with List II:
- Reaction A uses KMnO\(_4\)/KOH for oxidation.
- Reaction B uses CrO\(_3\) for oxidation of aldehydes.
- Reaction C involves Friedel-Crafts alkylation with AlCl\(_3\).
- Reaction D involves ozonolysis.
Quick Tip: Remember common reagents for oxidation (KMnO\(_4\), CrO\(_3\)) and special conditions for Friedel-Crafts and ozonolysis.
In which of the following equilibria, \(K_p\) and \(K_c\) are NOT equal?
- \(K_p = K_c (RT)^{\Delta n}\), where \(\Delta n = moles of gas products - moles of gas reactants\).
- For equilibrium (4), \(\Delta n \neq 0\), hence \(K_p \neq K_c\).
Quick Tip: For \(K_p = K_c\), ensure \(\Delta n = 0\). If not, the values will differ.
Which one of the following alcohols reacts instantaneously with Lucas reagent?
Tertiary alcohols react instantly with Lucas reagent due to the formation of a stable tertiary carbocation intermediate. Quick Tip: Lucas test distinguishes alcohols: tertiary (instant), secondary (few minutes), and primary (no reaction or very slow).
Given below are two statements:
Statement I: The boiling point of three isomeric pentanes follows the order: \(n\)-pentane \(>\) isopentane \(>\) neopentane.
Statement II: When branching increases, the molecule attains a spherical shape, reducing surface area and intermolecular forces, thereby lowering the boiling point.
In light of the above statements, choose the correct option:
The boiling point decreases with increased branching because branched-chain alkanes have less surface area for intermolecular forces.
Statement II accurately explains the phenomenon of lower boiling points in branched isomers. Quick Tip: Boiling points of isomers depend on the degree of branching. More branching leads to reduced surface area, weaker van der Waals forces, and lower boiling points.
Given below are two statements:
Statement I: Aniline does not undergo Friedel-Crafts alkylation.
Statement II: Aniline cannot be prepared through Gabriel synthesis.
Choose the correct answer:
Aniline does not undergo Friedel-Crafts alkylation because the NH\(_2\) group forms a complex with the Lewis acid (AlCl\(_3\)), deactivating the reaction.
Gabriel synthesis cannot prepare aniline because it involves alkyl halides, and aryl halides like chlorobenzene do not undergo this reaction. Quick Tip: Always consider steric and electronic factors when analyzing why a compound does not participate in a reaction.
The \(E^\circ\) value for the Mn\(^{3+}\)/Mn\(^{2+}\) couple is more positive than Cr\(^{3+}\)/Cr\(^{2+}\) or Fe\(^{3+}\)/Fe\(^{2+}\) due to:
Mn\(^{3+}\) has a \(d^4\) configuration, which upon reduction to Mn\(^{2+}\) becomes \(d^5\), a half-filled stable configuration.
This stability contributes to the more positive \(E^\circ\) value for Mn\(^{3+}\)/Mn\(^{2+}\) compared to Cr or Fe. Quick Tip: Reduction potential increases for transitions leading to half-filled or fully filled stable configurations.
On heating, some solid substances change directly to vapor without passing through the liquid state. This technique is called:
Sublimation is the direct transition from solid to vapor, bypassing the liquid phase.
Examples include iodine and naphthalene. Quick Tip: Sublimation is a quick method for purifying substances like camphor and iodine that sublime upon heating.
Fehling’s solution ‘A’ is:
Fehling’s solution is a mixture of Fehling's solution A (aqueous copper sulfate) and Fehling’s solution B (alkaline potassium sodium tartrate).
It is used for testing aldehydes, which reduce Cu\(^{2+}\) to Cu\(_2\)O. Quick Tip: Fehling's test is commonly used to detect reducing sugars like glucose and fructose.
Match List I with List II:
Ethane has a single \(\sigma\)-bond.
Ethene has one \(\sigma\)-bond and one \(\pi\)-bond.
C\(_2\) has two \(\pi\)-bonds due to unique bonding.
Ethyne has one \(\sigma\)-bond and two \(\pi\)-bonds. Quick Tip: For hydrocarbons, identify bond types by analyzing hybridization: single bonds are \(\sigma\), and double or triple bonds include \(\pi\).
Intramolecular hydrogen bonding is present in:
Intramolecular hydrogen bonding occurs when a hydrogen atom forms a bond within the same molecule between a donor (e.g., OH, NH) and an acceptor (e.g., NO\(_2\), CO).
Option (4) has OH and NO\(_2\) groups in close proximity, allowing intramolecular hydrogen bonding.
The other options lack this spatial arrangement. Quick Tip: To identify intramolecular hydrogen bonding, look for groups that are geometrically close within a molecule and can form H-bonds.
The highest number of helium atoms is in:
4 u of helium corresponds to one atom of helium (atomic mass unit).
4 g of helium corresponds to 1 mole, which is \(6.022 \times 10^{23}\) atoms.
At STP, 1 mole of helium occupies 22.4 L. Hence, 2.271098 L corresponds to approximately \(0.1 \, mol\), or \(6.022 \times 10^{22}\) atoms.
4 moles of helium correspond to \(4 \times 6.022 \times 10^{23}\), the highest number of atoms. Quick Tip: Remember: 1 mole = \(6.022 \times 10^{23}\) particles. Use Avogadro's number for quick calculations.
Match List I with List II:
For \(H_2O \rightarrow O_2\), 4 electrons are needed per oxygen atom. Hence, 2 moles of \(H_2O\) require 4F for 1 mole of \(O_2\).
For \(MnO_4^- \rightarrow Mn^{2+}\), 5 electrons per mole are required, so 5F.
For CaCl\(_2\), 2 electrons are required per Ca, so 1.5 moles require 3F.
For \(FeO \rightarrow Fe_2O_3\), 2 moles of \(FeO\) require 2F. Quick Tip: Faraday calculations depend on electrons transferred in redox reactions. Use \(Q = n \cdot F\), where \(n\) is the number of moles of electrons.
Among Group 16 elements, which one does NOT show \(-2\) oxidation state?
Step 1: Oxygen (\(O\)), Selenium (\(Se\)), and Tellurium (\(Te\)) commonly show a \(-2\) oxidation state due to their high electronegativity.
Step 2: Polonium (\(Po\)), being a metal, prefers to show positive oxidation states (+2, +4) and does not exhibit \(-2\). Quick Tip: For oxidation states, remember non-metals in Group 16 show \(-2\), while metallic members like Polonium prefer positive oxidation states.
'Spin-only' magnetic moment is the same for which of the following ions?
A. Ti\(^{3+}\)
B. Cr\(^{2+}\)
C. Mn\(^{2+}\)
D. Fe\(^{2+}\)
E. Sc\(^{3+}\)
Choose the correct answer:
Step 1: Magnetic moment is calculated as: \[ \mu = \sqrt{n(n+2)} \, BM, \]
where \(n\) is the number of unpaired electrons.
Step 2: For Cr\(^{2+}\) (\(d^4\)) and Fe\(^{2+}\) (\(d^6\)), \(n = 4\). Both ions have the same spin-only magnetic moment: \(\mu = \sqrt{4(4+2)} = 4.90 \, BM\). Quick Tip: Use the magnetic moment formula for ions: \(\mu = \sqrt{n(n+2)}\). Identify \(n\) from the unpaired electrons in the electronic configuration.
A compound with a molecular formula of C\(_6\)H\(_{14}\) has two tertiary carbons. Its IUPAC name is:
Step 1: Two tertiary carbons imply two carbons bonded to three other carbons each.
Step 2: Among the options, 2,3-dimethylbutane has two tertiary carbons at C2 and C3.
Step 3: Other options do not satisfy this condition. Quick Tip: For identifying tertiary carbons, look for carbons bonded to three other carbons. Verify with the molecular structure.
The Henry's law constant (\(K_H\)) values of three gases (A, B, C) in water are 145, \(2 \times 10^{-5}\), and 35 kbar, respectively. The solubility of these gases in water follows the order:
Step 1: Solubility is inversely proportional to \(K_H\). Lower \(K_H\) implies higher solubility.
Step 2: \(K_H\) values: A = 145, B = \(2 \times 10^{-5}\), C = 35.
Step 3: Order of solubility: B (lowest \(K_H\)) \(> C >\) A. Quick Tip: Remember: \(Solubility \propto \frac{1}{K_H}\). Smaller \(K_H\) implies higher solubility in water.
The compound that will undergo \(S_N1\) reaction with the fastest rate is:
Step 1: \(S_N1\) rate depends on carbocation stability. A more stable carbocation leads to a faster reaction.
Step 2: 2-Methylbenzyl bromide forms a resonance-stabilized benzyl carbocation, enhanced by the methyl group.
Step 3: Other compounds form less stable carbocations. Quick Tip: In \(S_N1\) reactions, prioritize the stability of the intermediate carbocation. Resonance and hyperconjugation increase stability.
The most stable carbocation among the following is:
Step 1: Carbocation stability increases with resonance and hyperconjugation.
Step 2: Option (3) forms a cyclopropylmethyl carbocation stabilized by resonance (non-classical carbocation).
Step 3: Other options lack equivalent stabilization. Quick Tip: Carbocation stability: Benzyl \( > Allyl > Tertiary > Secondary > Primary > \)Methyl.
Given below are two statements:
Statement I: Both \([Co(NH_3)_6]^{3+}\) and \([CoF_6]^{3-}\) complexes are octahedral but differ in their magnetic behavior.
Statement II: \([Co(NH_3)_6]^{3+}\) is diamagnetic, whereas \([CoF_6]^{3-}\) is paramagnetic.
Choose the correct answer:
Step 1: \([Co(NH_3)_6]^{3+}\) has a low-spin configuration as NH\(_3\) is a strong field ligand. All electrons pair up, making it diamagnetic.
Step 2: \([CoF_6]^{3-}\) has a high-spin configuration as F\(^-\) is a weak field ligand, resulting in unpaired electrons and paramagnetic behavior.
Step 3: Both complexes are octahedral but differ in magnetic properties due to the nature of ligands. Quick Tip: To determine magnetic behavior, check the ligand strength using the spectrochemical series. Strong field ligands induce pairing (low spin), while weak field ligands do not (high spin).
1 gram of sodium hydroxide was treated with 25 mL of 0.75 M HCl solution. The mass of sodium hydroxide left unreacted is equal to:
Step 1: The reaction is: \(NaOH + HCl \rightarrow NaCl + H_2O\).
Step 2: Moles of HCl = \(0.75 \, M \times 0.025 \, L = 0.01875 \, mol\).
Step 3: Moles of NaOH = \(\frac{1}{40} = 0.025 \, mol\).
Step 4: HCl reacts with 0.01875 mol of NaOH, leaving \(0.025 - 0.01875 = 0.00625 \, mol\) of NaOH.
Step 5: Mass of unreacted NaOH = \(0.00625 \times 40 = 250 \, mg\). Quick Tip: Always calculate the limiting reagent in stoichiometry problems to determine the amount left unreacted.
Given below are two statements:
Statement I: The boiling point of hydrides of Group 16 elements follows the order \(H_2O > H_2Te > H_2Se > H_2S\).
Statement II: \(H_2O\) has the highest boiling point due to extensive hydrogen bonding.
Choose the correct answer:
(1) Both Statement I and Statement II are false
(2) Statement I is true but Statement II is false
(3) Statement I is false but Statement II is true
(4) Both Statement I and Statement II are true
Step 1: The boiling point order is determined by molecular mass and hydrogen bonding.
Step 2: \(H_2O\) has extensive hydrogen bonding, giving it the highest boiling point.
Step 3: Heavier hydrides (\(H_2Te\), \(H_2Se\), \(H_2S\)) follow boiling point trends based on molecular mass. Quick Tip: Hydrogen bonding significantly increases boiling points in hydrides like \(H_2O\). For heavier hydrides, molecular mass dictates boiling points.
Arrange the following elements in increasing order of first ionization enthalpy: \(Li, Be, B, C, N\).
Step 1: Ionization enthalpy increases across a period due to increased nuclear charge.
Step 2: The anomaly: \(B < Be\) because Be has a fully filled \(2s^2\) configuration, making it more stable.
Step 3: Final order: \(Li < B < Be < C < N\). Quick Tip: For ionization enthalpy trends, consider stability of electronic configurations: fully filled and half-filled orbitals are more stable.
Activation energy of any chemical reaction can be calculated if one knows the value of:
Step 1: Activation energy is calculated using the Arrhenius equation: \[ k = A e^{-E_a/RT}, \]
where \(k\) is the rate constant, \(E_a\) is the activation energy, \(R\) is the gas constant, and \(T\) is the temperature.
Step 2: By taking the natural logarithm at two different temperatures: \[ \ln \frac{k_2}{k_1} = \frac{E_a}{R} \left(\frac{1}{T_1} - \frac{1}{T_2}\right), \]
one can calculate \(E_a\) if \(k_1\) and \(k_2\) are known. Quick Tip: To calculate activation energy, always use rate constants at two different temperatures with the Arrhenius equation.
Arrange the following elements in increasing order of electronegativity: \(N, O, F, C, Si\).
Step 1: Electronegativity increases across a period and decreases down a group in the periodic table.
Step 2: Silicon (\(Si\)) has the lowest electronegativity, while fluorine (\(F\)) has the highest.
Step 3: Order: \(Si < C < N < O < F\). Quick Tip: Remember: Electronegativity increases left to right in a period and decreases down a group.
Match List I with List II:
Step 1: Principal quantum number (\(n\)) gives the size of the orbital.
Step 2: Azimuthal quantum number (\(l\)) gives the shape of the orbital.
Step 3: Magnetic quantum number (\(m\)) gives the orientation of the orbital.
Step 4: Spin quantum number (\(m_s\)) gives the orientation of the spin of the electron. Quick Tip: Learn the significance of quantum numbers: \(n\) (size), \(l\) (shape), \(m\) (orientation), \(m_s\) (spin).
Match List I with List II:
Step 1: \(NH_3\) is trigonal pyramidal due to lone pair repulsion.
Step 2: \(BrF_5\) is square pyramidal with one lone pair.
Step 3: \(XeF_4\) is square planar due to two lone pairs.
Step 4: \(SF_6\) is octahedral with no lone pairs. Quick Tip: Use VSEPR theory to determine molecular geometries based on lone pairs and bond pairs.
Which plot of \(\ln k\) vs \(\frac{1}{T}\) is consistent with the Arrhenius equation?
Step 1: The Arrhenius equation is: \[ \ln k = -\frac{E_a}{R} \cdot \frac{1}{T} + \ln A. \]
Step 2: A plot of \(\ln k\) vs \(\frac{1}{T}\) yields a straight line with a negative slope (\(-E_a/R\)).
Step 3: The graph is linear and decreases as \(\frac{1}{T}\) increases. Quick Tip: Arrhenius plot is always a straight line with a negative slope for typical reactions.
The work done during reversible isothermal expansion of one mole of hydrogen gas at \(25^\circ C\) from a pressure of 20 atm to 10 atm is:
(Given \(R = 2.0 \, cal K^{-1} \, mol^{-1}\))
Step 1: For isothermal expansion, work done is calculated as: \[ W = -nRT \ln \frac{P_2}{P_1}. \]
Step 2: Substituting the given values: \[ W = -(1) \cdot (2.0) \cdot (298) \cdot \ln \left(\frac{10}{20}\right). \]
Step 3: Simplify: \[ W = -596 \cdot \ln(0.5) = -596 \cdot (-0.693) \approx -413.14 \, calories. \] Quick Tip: For isothermal processes, always use \(-nRT \ln \frac{V_2}{V_1}\) or \(-nRT \ln \frac{P_2}{P_1}\). Be careful with the logarithm base (natural log in this case).
Identify the \textbf{correct} answer:
Step 1: \(BF_3\) is planar and symmetric, so it has zero dipole moment.
Step 2: Dipole moment of \(NH_3\) is greater than that of \(NF_3\) due to opposite polarity.
Step 3: \(CO_3^{2-}\) ion has three equivalent resonance structures: \[ O=C-O^- \leftrightarrow O-C=O^- \leftrightarrow -C(O)-O^-. \]
Step 4: Ozone (\(O_3\)) has only two resonance structures. Quick Tip: Canonical forms represent different valid structures for resonance-stabilized molecules. Count only valid equivalent structures.
Major products \(A\) and \(B\) formed in the following reaction sequence are:
Step 1: In the first step, \(PBr_3\) replaces \(-OH\) with \(-Br\): \[ CH_3CH(OH)CH_2CH_3 \rightarrow CH_3CH(Br)CH_2CH_3 \, (A). \]
Step 2: In the second step, alcoholic KOH causes elimination of HBr: \[ CH_3CH(Br)CH_2CH_3 \rightarrow CH_3CH=CH_2 \, (B). \] Quick Tip: In elimination reactions, alcoholic KOH promotes dehydrohalogenation to form alkenes.
The pair of lanthanoid ions which are diamagnetic is:
Step 1: Diamagnetic ions have no unpaired electrons.
Step 2: \(Ce^{4+}\) (\([Xe]\)) has no unpaired electrons.
Step 3: \(Yb^{2+}\) (\([Xe]4f^{14}\)) has fully paired \(4f\)-orbitals.
Step 4: Other options involve ions with unpaired electrons, making them paramagnetic. Quick Tip: Identify the electron configurations of lanthanoid ions to determine whether electrons are paired or unpaired.
A compound \(X\) contains 32% of \(A\), 20% of \(B\), and the remaining percentage of \(C\). The empirical formula of \(X\) is:
(Given atomic masses of \(A = 64\), \(B = 40\), \(C = 32\))
Step 1: Calculate moles of each element: \[ Moles of A = \frac{Mass of A}{Atomic Mass of A} = \frac{32}{64} = 0.5. \] \[ Moles of B = \frac{Mass of B}{Atomic Mass of B} = \frac{20}{40} = 0.5. \] \[ Moles of C = \frac{Mass of C}{Atomic Mass of C} = \frac{48}{32} = 1.5. \]
Step 2: Divide by the smallest mole value: \[ Ratio: \frac{0.5}{0.5} : \frac{0.5}{0.5} : \frac{1.5}{0.5} = 1 : 1 : 3. \]
Step 3: Empirical formula: \[ Empirical Formula: ABC_3. \] Quick Tip: To calculate the empirical formula, always divide by the smallest number of moles to get a whole number ratio.
Given below are certain cations. Arrange them in increasing group number from 0 to VI.
A. \(Al^3+\)
B. \(Cu^2+\)
C. \(Ba^2+\)
D. \(Co^2+\)
E. \(Mg^2+\)
Choose the correct answer from the following//
Step 1: Assign group numbers based on periodic table positions:
\(B (Cu^{2+})\): Group I, \(A (Al^{3+})\): Group III,
\(D (Co^{2+})\): Group V, \(C (Ba^{2+})\): Group II,
\(E (Mg^{2+})\): Group VI.
Step 2: Arrange in increasing group number:
Order: \(B < A < D < C < E\). Quick Tip: Refer to periodic table trends and positions to quickly assign group numbers.
Consider the following reaction in a sealed vessel at equilibrium with concentrations of \[ N_2 = 3.0 \times 10^{-3} \, M, \, O_2 = 4.2 \times 10^{-3} \, M, \, and \, NO = 2.8 \times 10^{-3} \, M. \] \[ 2NO(g) \rightleftharpoons N_2(g) + O_2(g) \]
If 0.1 mol L\(^{-1}\) of NO is taken in a closed vessel, what will be the degree of dissociation (\( \alpha \)) of NO(g) at equilibrium?
Let the degree of dissociation of NO be \( \alpha \).
Initially, the concentration of NO is 0.1 mol L\(^{-1}\), and the concentrations of \( N_2 \) and \( O_2 \) are 0.
At equilibrium, the dissociation of \( 2NO \) will produce \( N_2 \) and \( O_2 \) as: \[ NO \rightleftharpoons \frac{1}{2} N_2 + \frac{1}{2} O_2 \]
Using the ICE (Initial, Change, Equilibrium) table: \[ \begin{array}{|c|c|c|c|} \hline Species & Initial (mol/L) & Change (mol/L) & Equilibrium (mol/L)
\hline NO & 0.1 & -2\alpha & 0.1 - 2\alpha
N_2 & 0 & +\alpha & \alpha
O_2 & 0 & +\alpha & \alpha
\hline \end{array} \]
At equilibrium, the concentrations are:
- \( [NO] = 0.1 - 2\alpha \)
- \( [N_2] = \alpha \)
- \( [O_2] = \alpha \)
Using the equilibrium expression: \[ K_c = \frac{[N_2][O_2]}{[NO]^2} \]
Substituting the known values: \[ K_c = \frac{(\alpha)(\alpha)}{(0.1 - 2\alpha)^2} \]
Using the known equilibrium concentrations, solve for \( \alpha \): \[ K_c = \frac{(3.0 \times 10^{-3})(4.2 \times 10^{-3})}{(2.8 \times 10^{-3})^2} \]
Thus, solving the equation gives the value of \( \alpha = 0.717 \). Quick Tip: The degree of dissociation \( \alpha \) is calculated by comparing the equilibrium concentrations using the ICE table and equilibrium constant expression.
The rate of a reaction quadruples when temperature changes from \(27^\circ C\) to \(57^\circ C\). Calculate the energy of
activation.
Step 1: Use the Arrhenius equation: \[ \ln \left( \frac{k_2}{k_1} \right) = \frac{E_a}{R} \left( \frac{T_2 - T_1}{T_1 T_2} \right). \]
Step 2: Plug values: \[ \ln 4 = \frac{E_a}{8.314} \times \frac{30}{300 \times 330}. \]
Step 3: Solve for \(E_a\): \[ E_a = 38.04 \, kJ/mol. \] Quick Tip: Convert temperatures to Kelvin and use logarithmic tables or calculators for accurate results.
During the preparation of Mohr’s salt solution (Ferrous ammonium sulphate), which of the following acid is
added to prevent hydrolysis of \(Fe^{2+}\):
Step 1: Hydrolysis of \(Fe^{2+}\):
Dilute \(H_2SO_4\) is used as it prevents hydrolysis and oxidation. Quick Tip: Always use dilute \(H_2SO_4\) for stabilizing \(Fe^{2+}\) ions in aqueous solutions.
Identify the major product \(C\) formed in the following reaction sequence: \[ CH_3-CH_2-CH_2-I \xrightarrow{NaCN} A \xrightarrow{Partial Hydrolysis} B \xrightarrow{NaOH, Br_2} C \]
Step 1: Reaction with NaCN: \[ CH_3-CH_2-CH_2-I + NaCN \rightarrow CH_3-CH_2-CH_2-CN \, (A). \]
Step 2: Partial hydrolysis of nitrile: \[ CH_3-CH_2-CH_2-CN + H_2O \rightarrow CH_3-CH_2-CH_2-CONH_2 \, (B). \]
Step 3: Hofmann degradation: \[ CH_3-CH_2-CH_2-CONH_2 + NaOH + Br_2 \rightarrow CH_3-CH_2-CH_2-NH_2 \, (C). \]
Thus, the major product is propylamine. Quick Tip: In Hofmann degradation, amides are converted into primary amines with one carbon atom less than the parent compound.
Mass of copper deposited by passing 9.6487 A of current through copper sulfate solution for 100 seconds is: \[ Given: Molar mass of Cu = 63 g/mol, 1 F = 96487 C \]
Step 1: Faraday's second law of electrolysis: \[ Mass of Cu deposited = \frac{I \times t \times M}{n \times F}, \]
where \(M = Molar mass of Cu\), \(n = Number of electrons\), \(F = Faraday's constant\).
Step 2: Substituting values: \[ Mass = \frac{9.6487 \times 100 \times 63}{2 \times 96487} = 0.315 \, g. \] Quick Tip: To solve Faraday's law problems, remember: \(Mass \propto Charge\), where \(Charge = I \times t\).
For the given reaction:
Step 1: The oxidation of alkenes with \(KMnO_4\) under acidic conditions results in cleavage of the double bond, forming carboxylic acids or ketones depending on the substituents.
Step 2: In this reaction, the double bond in cyclohexene is cleaved, producing cyclohexane carboxylic acid as the product. Quick Tip: For alkene reactions with \(KMnO_4/H^+\), remember: - Terminal alkenes form carboxylic acids. - Internal alkenes form ketones or acids based on substitution.
Given statements:
Statement I: \([Co(NH_3)_6]^{3+}\) is homoleptic, while \([Co(NH_3)_4Cl_2]^+\) is heteroleptic.
Statement II: \([Co(NH_3)_6]^{3+}\) has one type of ligand, whereas \([Co(NH_3)_4Cl_2]^+\) has more than one type.
Step 1: A homoleptic complex contains identical ligands, e.g., \([Co(NH_3)_6]^{3+}\), with only \(NH_3\).
Step 2: A heteroleptic complex contains different ligands, e.g., \([Co(NH_3)_4Cl_2]^+\), with \(NH_3\) and \(Cl^-\).
Step 3: Both statements are true. Quick Tip: Homoleptic complexes have identical ligands; heteroleptic ones have a combination. Check the ligands to classify.
The plot of osmotic pressure (Π) vs concentration (mol L–1) for a solution gives a straight line with slope
25.73 L bar mol–1. The temperature at which the osmotic pressure measurement is done is
(Use R = 0.083 L bar mol–1 K–1)
Step 1: Using \(R = 0.083\), calculate: \[ T = \frac{25.73}{0.083} = 310 \, K. \]
Step 2: Convert temperature to Celsius: \[ T = 310 - 273 = 37^\circ C. \] Quick Tip: To solve osmotic pressure problems: \[ \Pi = CRT \quad and \quad T(K) = slope/R. \]
Reaction sequence: \[ 3ROH + PCl_3 \rightarrow 3RCl + A \quad and \quad ROH + PCl_5 \rightarrow RCl + HCl + B. \]
Step 1: The first reaction produces \(H_3PO_3\) (phosphorous acid) as a by-product with \(RCl\).
Step 2: The second reaction produces \(POCl_3\) (phosphoryl chloride) with \(RCl\) and \(HCl\). Quick Tip: For \(PCl_3\), think of \(H_3PO_3\); for \(PCl_5\), think of \(POCl_3\).
Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin:
Auxins are plant hormones that play a crucial role in regulating growth and development in plants. When applied in high concentrations, auxins cause abnormal growth in plants, especially dicots, leading to the death of these plants. However, monocotyledonous plants, such as grasses, are less affected by auxins. This is because monocots have a different structure and metabolic response compared to dicots, making them less susceptible to the growth-disrupting effects of auxins. Therefore, when gardeners use auxins to eliminate weeds, the herbicide harms the dicot weeds but does not damage the monocot grass, allowing the lawn to remain unaffected. Quick Tip: Auxins are selective in their action. They affect dicot plants more severely, leading to their death, while monocots (like grasses) are relatively unaffected, making auxin-based herbicides ideal for lawn care.
Lecithin, a small molecular weight organic compound found in living tissues, is an example of:
Lecithin is a type of phospholipid, which is a class of lipids that are a major component of all biological membranes. Phospholipids like lecithin have both hydrophilic and hydrophobic properties, making them essential in membrane structure. Lecithin is commonly found in cell membranes and in biological tissues. Quick Tip: Lecithin is specifically a phospholipid because it contains both a phosphate group and a lipid molecule. This combination is critical for its role in cellular membrane structure.
Match List I with List II:
Step 1: A refers to "two or more alternative forms of a gene," which are called alleles (III).
Step 2: B refers to "cross of F1 progeny with homozygous recessive parent," which is known as a test cross (IV).
Step 3: C refers to "cross of F1 progeny with any of the parents," typically called a back cross (I).
Step 4: D refers to "number of chromosome sets in plant," which is ploidy (II). Quick Tip: A test cross helps to determine the genotype of an individual showing a dominant phenotype by crossing it with a homozygous recessive individual.
Identify the set of correct statements:
A. The flowers of Vallisneria are colourful and produce nectar.
B. The flowers of water lily are not pollinated by water.
C. In most water-pollinated species, the pollen grains are protected from wetting.
D. Pollen grains of some hydrophytes are long and ribbon-like.
E. In some hydrophytes, the pollen grains are carried passively inside water.
Step 1: A is incorrect because the flowers of Vallisneria are not colorful and do not produce nectar; they are typically small and unnoticeable.
Step 2: B is correct because water lilies are pollinated by insects, not by water.
Step 3: C is correct; in water-pollinated species, pollen grains often have special adaptations to prevent wetting, such as being hydrophobic.
Step 4: D is correct; some hydrophytes have long, ribbon-like pollen grains that help them to float.
Step 5: E is correct; in some hydrophytes, pollen grains are passively carried by the water to fertilize the flowers. Quick Tip: Water-pollinated species often have specialized pollen grains that can either float on water or are protected from moisture to ensure successful fertilization.
The list of endangered species was released by:
The International Union for Conservation of Nature (IUCN) is responsible for compiling and releasing the list of endangered species. This list, known as the IUCN Red List, categorizes species based on their risk of extinction and provides critical data for conservation efforts worldwide. Quick Tip: The IUCN Red List is an essential tool in conservation biology, helping to raise awareness about endangered species and drive conservation actions.
What is the fate of a piece of DNA carrying only the gene of interest which is transferred into an alien organism?
When a piece of DNA carrying a gene of interest is transferred into an alien organism, it may integrate into the recipient's genome. This process ensures that the new genetic material is passed on to progeny cells. Alternatively, the DNA may replicate independently, but the key factor for long-term inheritance is its integration into the host's genetic material. Quick Tip: Gene transfer into alien organisms typically requires integration into the genome for stable inheritance, which is the basis of genetic engineering.
Which of the following are required for the dark reaction of photosynthesis?
A. Light
B. Chlorophyll
C. \ch{CO_2
D. ATP
E. NADPH
The dark reaction (also known as the Calvin cycle) of photosynthesis requires \(CO_2\), ATP, and NADPH as key inputs. These molecules are used to convert carbon dioxide into glucose. Light and chlorophyll are required for the light-dependent reactions, not the dark reactions. Quick Tip: The dark reaction does not require light directly, but relies on the products of the light reactions (ATP and NADPH).
The type of conservation in which the threatened species are taken out from their natural habitat and placed in a special setting where they can be protected and given special care is called:
The correct term for the conservation method described in the question is Biodiversity conservation, where endangered species are removed from their natural habitat and given special care, usually in controlled environments such as zoos or botanical gardens. This approach aims to protect the species while also allowing for research and breeding programs. Quick Tip: Biodiversity conservation encompasses both in-situ and ex-situ methods, including the protection of species in controlled environments.
Given below are two statements:
Statement I: Bt toxins are insect group-specific and coded by the gene cry IAc.
Statement II: Bt toxin exists as inactive protoxin in \textit{B. thuringiensis. However, after ingestion by the insect, the inactive protoxin gets converted into its active form due to the acidic pH of the insect gut.
Step 1: Statement I is true because Bt toxins are specific to different insect groups, and the cry IAc gene in \textit{Bacillus thuringiensis codes for one such toxin.
Step 2: Statement II is false because although the Bt toxin exists as an inactive protoxin, it is the alkaline pH of the insect gut (not acidic) that activates it. Quick Tip: The activation of Bt toxins occurs in the alkaline pH of the insect's gut, not acidic, which allows it to disrupt the insect’s digestive system.
A transcription unit in DNA is defined primarily by three regions in DNA and these are with respect to upstream and downstream ends:
A transcription unit in DNA consists of three regions:
- The promoter, which initiates transcription.
- The structural gene, which codes for a protein.
- The terminator, which signals the end of transcription.
These three components are key to the transcription process in both prokaryotes and eukaryotes. Quick Tip: The transcription unit is defined by its promoter, structural gene, and terminator, which regulate the process of gene expression.
In the given figure, which component has thin outer walls and highly thickened inner walls?
Guard cells are specialized cells found in the epidermis of plant leaves and stems. These cells control the opening and closing of stomata, which are pores on the surface of the plant that allow gas exchange (oxygen and carbon dioxide) and water vapor to pass in and out.
The unique structure of the guard cells plays a crucial role in this function. Guard cells have thin outer walls and thickened inner walls. This differential wall thickness is essential for the opening and closing mechanism of the stomata.
- The thin outer walls of the guard cells are more flexible, allowing the cells to stretch and bend outward as they accumulate water and become turgid.
- The thickened inner walls are more rigid and less flexible, which helps create a "bowing" effect when the cells swell. As water enters the guard cells, the thick inner walls prevent them from expanding evenly. Instead, the outer walls expand more, and the inner thickened walls restrict this movement, causing the stomata to open. When the guard cells lose water, the inner walls' rigidity causes the cells to collapse, closing the stomatal pore.
This mechanism helps regulate water loss through transpiration while allowing necessary gas exchange for photosynthesis and respiration. Quick Tip: The differential thickness of the guard cells' walls (thin outer, thickened inner) is key to their ability to control stomatal opening and closing effectively, balancing gas exchange and water conservation.
Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:
Hind II is a restriction enzyme that cuts DNA at a specific recognition sequence, which is 6 base pairs (bp) long. The recognition site for Hind II is the palindromic sequence \texttt{AAGCTT, which is a 6 bp sequence. This enzyme cuts the DNA at the specific sequence, allowing scientists to manipulate DNA for cloning, sequencing, and other molecular biology techniques. Quick Tip: Restriction enzymes like Hind II are specific to their recognition sequences, which are usually palindromic and range from 4-8 base pairs.
Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the given figures (a) and (b).
In the perigynous condition, the gynoecium (female reproductive organ) is located in the center of the flower, while the other parts of the flower, such as the stamens, petals, and sepals, are positioned around it on the rim of the thalamus (receptacle). All the floral parts (including stamens, petals, and sepals) are situated at the same level and appear to be attached to a common structure called the hypanthium.
This arrangement contrasts with other flower types, such as hypogynous and epigynous flowers, where the position of the gynoecium is either above or below the other floral parts, respectively. In perigynous flowers, the ovary is typically superior (above the point of attachment of other parts). Quick Tip: In perigynous flowers, the floral parts arise from the same level on the rim of the thalamus, surrounding the central gynoecium. The ovary is superior, making the structure distinct.
Which of the following is an example of an actinomorphic flower?
Actinomorphic flowers, also known as radial symmetry flowers, can be divided into two equal halves in multiple planes. Datura is an example of an actinomorphic flower, as its flower structure exhibits radial symmetry.
The other options (Cassia, Pisum, and Sesbania) have zygomorphic (bilateral symmetry) flowers, which can only be divided into two equal halves along one plane. Quick Tip: Actinomorphic flowers have a symmetrical structure, allowing them to be divided equally in multiple planes, while zygomorphic flowers are symmetric in just one plane.
Which one of the following is not a criterion for classification of fungi?
Fungi classification is primarily based on the mode of spore formation, fruiting body structure, and the morphology of the mycelium.
The mode of nutrition is not typically used as a primary criterion for classification because fungi are generally classified based on their reproductive structures. Most fungi are heterotrophic (absorptive nutrition), but the classification depends more on the structural aspects of reproduction and growth. Quick Tip: Fungi classification focuses on their reproductive structures, such as spore formation and fruiting bodies, rather than the mode of nutrition.
The equation of Verhulst-Pearl logistic growth is \[ \frac{dN}{dt} = rN \left( \frac{K - N}{K} \right) \]
From this equation, \(K\) indicates:
The Verhulst-Pearl logistic growth model is used to describe population growth in a limited environment.
In this equation, \(K\) represents the carrying capacity, which is the maximum population size that the environment can support based on available resources.
When the population reaches this limit, the growth rate slows down and stabilizes. Quick Tip: In the logistic growth equation, \(K\) is the carrying capacity, which determines the upper limit of population size in a given environment.
Which one of the following can be explained on the basis of Mendel's Law of Dominance?
A. Out of one pair of factors, one is dominant and the other is recessive.
B. Alleles do not show any expression and both the characters appear as such in \(F_2\) generation.
C. Factors occur in pairs in normal diploid plants.
D. The discrete unit controlling a particular character is called factor.
E. The expression of only one of the parental characters is found in a monohybrid cross.
Choose the correct answer from the options given below:
Mendel's Law of Dominance states that when two different alleles are present for a trait, the dominant allele will mask the expression of the recessive allele in the heterozygous condition.
- A is true because one factor (allele) is dominant and the other recessive.
- C is true because Mendel’s experiments confirmed that alleles occur in pairs in diploid organisms.
- D is true because Mendel referred to the units controlling traits as "factors," which are now known as genes.
- E is true because in a monohybrid cross, only the dominant trait is expressed in the \(F_1\) generation. Quick Tip: Mendel's Law of Dominance explains that in a heterozygous organism, the dominant allele masks the effect of the recessive allele.
Match List I with List II:
- A. Rhizopus is commonly known as bread mould (III).
- B. Ustilago is a smut fungus (II).
- C. Puccinia is a rust fungus (IV).
- D. Agaricus is a type of mushroom (I).
So, the correct matching is A-III, B-II, C-IV, D-I. Quick Tip: Fungal classifications often rely on the type of reproduction and the structure of the fruiting bodies. Smut and rust fungi are parasitic, while mushrooms are examples of edible fungi.
Inhibition of succinic dehydrogenase enzyme by malonate is a classical example of:
Malonate is a competitive inhibitor of the enzyme succinic dehydrogenase. It competes with the substrate, succinate, for the active site of the enzyme.
In competitive inhibition, the inhibitor resembles the substrate and binds to the enzyme's active site, preventing the normal substrate from binding. Quick Tip: Competitive inhibition occurs when an inhibitor competes with the substrate for the enzyme’s active site, blocking the normal reaction.
Formation of interfascicular cambium from fully developed parenchyma cells is an example of:
Dedifferentiation is the process where mature, differentiated cells lose their specialized functions and revert to a more meristematic state, capable of dividing and forming new tissues.
In this case, parenchyma cells in the vascular bundle region dedifferentiate to form interfascicular cambium, which is responsible for secondary growth in plants. Quick Tip: Dedifferentiation allows mature cells to revert to a less specialized state, enabling them to participate in new tissue formation, such as cambium in plants.
A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?
In Snapdragon plants, flower color follows incomplete dominance, where the red allele (R) and the pink allele (R') both contribute to flower color.
- If a pink flowered plant (R'R') is crossed with a red flowered plant (RR), the F1 progeny will inherit one red allele (R) from the red parent and one pink allele (R') from the pink parent. This results in red and pink flowered plants in the progeny.
- Red flowered plants will occur when two red alleles (RR) are inherited, while pink flowered plants will be the result of inheriting one red allele and one pink allele (R'R). Quick Tip: In incomplete dominance, the heterozygote exhibits a blend of both parental traits. In Snapdragon, red and pink flower colors mix to form pink flowers in the F1 generation.
In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it?
To determine the genotype of a black-seeded plant (BB/Bb), a test cross should be performed with a homozygous recessive (bb) plant. This is because the recessive genotype (bb) will allow the expression of the recessive trait if the black-seeded plant is heterozygous (Bb).
- If the black-seeded plant is homozygous dominant (BB), all progeny will show black seeds.
- If the plant is heterozygous (Bb), 50% of the progeny will have black seeds and 50% will have white seeds. Quick Tip: A test cross with a recessive plant (bb) helps determine whether the black-seeded plant is homozygous (BB) or heterozygous (Bb).
Match List I with List II:
- A. Clostridium butylicum is responsible for the production of butyric acid (III).
- B. Saccharomyces cerevisiae is used in the fermentation process to produce ethanol (I).
- C. Trichoderma polysporum produces cyclosporin-A (IV), an immunosuppressant.
- D. Streptococcus sp. is known for producing streptokinase (II), which is used as a clot-busting enzyme in medicine. Quick Tip: Know the microbial products—Saccharomyces cerevisiae is involved in ethanol production, and Clostridium butylicum for butyric acid.
How many molecules of ATP and NADPH are required for every molecule of \(CO_2\) fixed in the Calvin cycle?
In the Calvin cycle, for every molecule of \(CO_2\) fixed, 3 molecules of ATP and 2 molecules of NADPH are required to convert 3-phosphoglycerate (3-PGA) into G3P (Glyceraldehyde-3-phosphate).
- ATP provides the energy necessary for the phosphorylation steps, while NADPH provides the reducing power for the reduction steps. Quick Tip: In the Calvin cycle, 3 ATP and 2 NADPH are used for the fixation of each \(CO_2\) molecule to form sugars.
The capacity to generate a whole plant from any cell of the plant is called:
Totipotency refers to the ability of a single plant cell to give rise to a whole new plant. This ability is a key feature in plant tissue culture and micropropagation, where cells are induced to regenerate into an entire plant.
- Micropropagation is the technique of growing plants from small tissues or cells, and somatic hybridization involves the fusion of somatic cells to create hybrid plants. Quick Tip: Totipotency is the ability of plant cells to regenerate into a complete organism, which is used in plant tissue culture for cloning.
Tropical regions show greatest level of species richness because:
A. Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was available for species diversification.
B. Tropical environments are more seasonal.
C. More solar energy is available in tropics.
D. Constant environments promote niche specialization.
E. Tropical environments are constant and predictable.
Choose the correct answer from the options given below:
Tropical regions have remained relatively undisturbed over millions of years, which has provided more time for species to evolve and diversify.
The constant availability of solar energy in these regions supports a high rate of photosynthesis, which in turn supports diverse ecosystems.
Furthermore, the predictable and constant environmental conditions in the tropics allow species to specialize in particular niches, enhancing species richness. Seasonal variability is less pronounced in the tropics compared to temperate zones, making environments more stable for long-term survival. Hence, the combination of all these factors (A, C, D, and E) leads to greater species richness. Quick Tip: Tropical regions have been stable for millions of years, which has allowed for a high rate of species diversification.
Match List I with List II:
- A. Nucleolus is the site for active ribosomal RNA synthesis (III).
- B. Centriole has an organization like the cartwheel (II).
- C. Leucoplasts are for storing nutrients (IV).
- D. Golgi apparatus is the site of formation of glycolipids (I). Quick Tip: The nucleolus is where ribosomal RNA is synthesized, while the Golgi apparatus is involved in lipid and protein processing.
Identify the part of the seed from the given figure which is destined to form root when the seed germinates.
The radicle is the part of the seedling that is destined to form the root. It is the first part of the embryo that grows and anchors the plant in the soil. In the given diagram, 'C' represents the radicle. Quick Tip: The radicle develops into the primary root of the plant, which later gives rise to lateral roots, ensuring a stable root system for nutrient absorption.
Spindle fibers attach to kinetochores of chromosomes during:
During metaphase of mitosis, the chromosomes align at the metaphase plate in the center of the cell. The spindle fibers, which are microtubules, attach to the kinetochores on the centromere of each chromosome. This attachment is crucial for the proper separation of chromatids during anaphase. Quick Tip: The kinetochores are specialized protein complexes where the spindle fibers attach to the chromosomes.
Given below are two statements:
Statement I: Chromosomes become gradually visible under light microscope during leptotene stage.
Statement II: The beginning of diplotene stage is recognized by dissolution of synaptonemal complex.
In the light of the above statements, choose the correct answer from the options given below:
During leptotene (early prophase I), chromosomes begin to condense and become visible under the light microscope.
In the diplotene stage, which is a later phase of prophase I, the synaptonemal complex (a protein structure that helps align homologous chromosomes) dissolves, signaling the beginning of this phase. Quick Tip: In leptotene, chromosomes become visible, and in diplotene, the synaptonemal complex dissolves.
Given below are two statements:
Statement I : Parenchyma is living but collenchyma is dead tissue.
Statement II : Gymnosperms lack xylem vessels but presence of xylem vessels is the characteristic of angiosperms.
In the light of the above statements, choose the correct answer from the options given below:
Statement I is incorrect because both parenchyma and collenchyma are living tissues. Parenchyma cells are responsible for metabolic functions, while collenchyma provides structural support, especially in growing plant parts.
Statement II is true because gymnosperms (like conifers) lack xylem vessels, a characteristic of angiosperms (flowering plants). Gymnosperms have tracheids instead of xylem vessels. Quick Tip: Parenchyma and collenchyma are living tissues, but gymnosperms lack xylem vessels.
These are regarded as major causes of biodiversity loss:
A. Over exploitation
B. Co-extinction
C. Mutation
D. Habitat loss and fragmentation
E. Migration
Choose the correct option:
Overexploitation, co-extinction, and habitat loss/fragmentation are major anthropogenic (human-caused) factors leading to biodiversity loss.
Overexploitation occurs when species are harvested at unsustainable rates, while habitat loss and fragmentation reduce the amount of available natural habitat.
Co-extinction happens when one species' extinction leads to the extinction of another species dependent on it.
Mutation and migration, however, are natural processes that do not directly cause biodiversity loss. Quick Tip: Overexploitation and habitat fragmentation are the main contributors to biodiversity loss.
The lactose present in the growth medium of bacteria is transported to the cell by the action of:
Permease is a membrane-bound protein that facilitates the transport of lactose into bacterial cells.
It is part of the lactose operon system in bacteria, which also includes beta-galactosidase (which breaks down lactose inside the cell) and transacetylase.
Acetylase and polymerase are involved in different metabolic processes. Quick Tip: Permease is responsible for lactose transport across the bacterial membrane.
Bulliform cells are responsible for:
Bulliform cells are specialized epidermal cells in monocot plants. They play a key role in water conservation by causing the leaf to curl inward during periods of water stress, reducing water loss through transpiration. Quick Tip: Bulliform cells help plants conserve water by causing leaf curling under stress.
The cofactor of the enzyme carboxypeptidase is:
Zinc acts as a cofactor for the enzyme carboxypeptidase, which catalyzes the hydrolysis of peptide bonds at the carboxyl terminal of proteins.
Zinc ions facilitate the enzyme's function by coordinating with the substrate during catalysis. Quick Tip: Zinc is essential for many enzymes, including carboxypeptidase, which breaks down proteins.
Read the following statements and choose the set of correct statements:
In the members of Phaeophyceae:
A. Asexual reproduction occurs usually by biflagellate zoospores.
B. Sexual reproduction is by oogamous method only.
C. Stored food is in the form of carbohydrates which is either mannitol or laminarin.
D. The major pigments found are chlorophyll a, c and carotenoids and xanthophyll.
E. Vegetative cells have a cellulosic wall, usually covered on the outside by gelatinous coating of algin.
Choose the correct answer from the options given below:
Phaeophyceae, or brown algae, typically reproduce asexually through biflagellate zoospores.
Their sexual reproduction is oogamous, where the male gamete is smaller and motile.
The stored carbohydrates are mannitol and laminarin, and their major pigments include chlorophyll a, c, carotenoids, and xanthophylls.
Their cell walls are made of cellulose and are often covered by a gelatinous coating of algin. Quick Tip: Brown algae store food as mannitol and laminarin and have cell walls with algin.
Match List I with List II:
Choose the correct answer from the options given below:
- Robert May is associated with the global species diversity estimate of around 7 million species.
- Alexander von Humboldt is known for the species-area relationship.
- Paul Ehrlich is linked to the Rivet popper hypothesis of biodiversity.
- David Tilman is known for his long-term ecosystem experiments, which assess biodiversity and ecosystem function. Quick Tip: The Rivet popper hypothesis suggests that each species contributes a unique function to an ecosystem.
Given below are two statements:
Statement I: In C3 plants, some O2 binds to RuBisCO, hence CO2 fixation is decreased.
Statement II: In C4 plants, mesophyll cells show very little photorespiration while bundle sheath cells do not show photorespiration.
In the light of the above statements, choose the correct answer from the options given below:
- In C3 plants, RuBisCO can bind oxygen instead of carbon dioxide, leading to photorespiration and reduced CO2 fixation.
- In C4 plants, mesophyll cells indeed have low photorespiration, but the bundle sheath cells also show some degree of photorespiration, contrary to the second statement. Quick Tip: C4 plants have a mechanism to reduce photorespiration by spatial separation of carbon fixation and Calvin cycle.
The DNA present in chloroplast is:
Chloroplasts contain their own DNA, which is circular and double-stranded, similar to the DNA found in prokaryotes.
This DNA is responsible for encoding some of the proteins necessary for photosynthesis. Quick Tip: Chloroplast DNA is circular and double-stranded, inherited maternally in most plants.
In an ecosystem if the Net Primary Productivity (NPP) of the first trophic level is 100x (kcal m–2 yr–1), what would be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem?
The Gross Primary Productivity (GPP) at higher trophic levels (like the third trophic level) is typically much lower than that at the first trophic level due to the loss of energy between trophic levels.
Assuming a 10% energy transfer efficiency, the GPP at the third trophic level would be 10x kcal m–2 yr–1. Quick Tip: Energy decreases at each trophic level due to inefficiencies in energy transfer.
Which of the following are fused in somatic hybridization involving two varieties of plants?
Somatic hybridization involves the fusion of protoplasts (cells without a cell wall) from two different plant varieties.
This technique is used to create hybrid plants with desired traits.
Quick Tip: Protoplast fusion is a key technique in plant genetic engineering for creating somatic hybrids.
Match List I with List II:
Choose the correct answer from the options given below:
The Citric acid cycle (Krebs cycle) occurs in the mitochondrial matrix where acetyl-CoA is oxidized to produce ATP, NADH, and FADH\(_2\).
Glycolysis takes place in the cytoplasm of the cell, where glucose is broken down into pyruvate, generating ATP and NADH in the process.
The Electron transport system is located on the inner mitochondrial membrane, where NADH and FADH\(_2\) donate electrons to generate a proton gradient.
The Proton gradient is found in the intermembrane space of mitochondria, driving ATP synthesis through ATP synthase.
Quick Tip: The citric acid cycle and electron transport chain both take place in the mitochondria, but in different regions.
Match List I with List II:
Choose the correct answer from the options given below:
Frederick Griffith discovered transformation, which is the process where bacteria take up foreign DNA.
Jacob and Monod worked on the Lac operon model, explaining gene regulation.
Har Gobind Khorana contributed to understanding the genetic code and protein synthesis.
Meselson and Stahl proved the semi-conservative mode of DNA replication using isotopic labeling.
Quick Tip: Griffith's experiment with Streptococcus pneumoniae demonstrated the process of transformation.
Match List I with List II:
Choose the correct answer from the options given below:
Monoadelphous stamens are found in species like China rose, where all the filaments are fused into a single bundle.
Diadelphous stamens are characteristic of plants like pea, where the stamens are fused in two groups.
Polyadelphous stamens are found in citrus, where the filaments are fused into several groups.
Epiphyllous stamens, which are borne on the surface of the leaves, are found in species like the lily.
Quick Tip: Diadelphous stamens are a distinguishing feature of the pea plant.
Identify the correct description about the given figure:
The diagram depicts a wind-pollinated plant with a compact inflorescence and well-exposed stamens.
1. Compact Inflorescence: A dense cluster of flowers helps increase the chance of pollen being carried by the wind. This arrangement maximizes pollen exposure to the environment.
2. Well-exposed Stamens: The male reproductive organs are exposed to facilitate the release of pollen into the air.
3. Autogamy and Exposure: Although autogamy refers to self-pollination, the exposed stamens ensure pollen release for cross-pollination, reducing self-pollination and promoting genetic diversity.
Quick Tip: Wind-pollinated plants typically have exposed stamens, lightweight pollen, and compact inflorescences to maximize cross-pollination efficiency.
Match List I with List II:
Choose the correct answer from the options given below:
- GLUT-4 is a glucose transporter protein responsible for facilitating glucose uptake into muscle and adipose tissue cells.
- Insulin is a hormone secreted by the pancreas to regulate blood glucose levels.
- Trypsin is an enzyme that digests proteins in the small intestine.
- Collagen is a structural protein found in intercellular ground substances, providing tissue support.
Quick Tip: GLUT-4 is crucial for insulin-mediated glucose uptake, a key process in glucose metabolism.
Identify the step in the tricarboxylic acid cycle that does not involve oxidation of the substrate:
In the tricarboxylic acid (TCA) cycle, the conversion of Succinyl-CoA to succinic acid does not involve oxidation but occurs via substrate-level phosphorylation.
This step generates ATP or GTP depending on the organism, contrasting other steps that involve oxidation reactions.
Quick Tip: Substrate-level phosphorylation generates ATP directly, without requiring an electron transport chain.
Spraying sugarcane crops with which plant growth regulator increases the length of stems, thereby enhancing yield?
Gibberellins are plant hormones that promote stem elongation and overall growth.
When sprayed on sugarcane, gibberellins increase stem length, enhancing yield.
Other growth regulators like cytokinin promote cell division, auxins influence root growth, and abscisic acid is associated with stress responses.
Quick Tip: Gibberellins are widely used in agriculture to boost stem growth and increase crop productivity.
Match List I with List II:
Choose the correct answer from the options given below:
- Rose has twisted aestivation, where petals overlap in a twisted manner.
- Pea exhibits a perigynous flower arrangement, where the ovary is at the center, surrounded by floral parts.
- Cotton has marginal placentation, with ovules attached along the ovary's edges.
- Mango is classified as a drupe fruit with a hard endocarp surrounding the seed.
Quick Tip: Twisted aestivation is typical in roses, while marginal placentation is common in cotton.
Which of the following statements is correct regarding the process of replication in E.coli?
In E. coli, DNA replication is catalyzed by DNA-dependent DNA polymerase, which synthesizes new DNA in the 5’ → 3’ direction.
The template strand is read in the opposite 3’ → 5’ direction. RNA polymerase catalyzes transcription but is not involved in DNA synthesis.
Quick Tip: DNA polymerase extends the DNA strand in the 5’ → 3’ direction, reading the template strand in the 3’ → 5’ direction.
Match List I with List II:
Choose the correct answer from the options given below:
- The Pons (A) connects different regions of the brain (III).
- The Hypothalamus (B) contains neurosecretory cells (IV) responsible for hormone regulation.
- The Medulla (C) controls respiration and gastric secretions (II).
- The Cerebellum (D) provides additional space for neurons and regulates posture and balance (I).
Quick Tip: The brainstem, which includes the Pons and Medulla, controls vital functions like breathing and heart rate.
Which of the following is not a component of Fallopian tube?
- The Fallopian tube consists of the Isthmus, Infundibulum, and Ampulla.
- The Uterine fundus is part of the uterus, not the Fallopian tube.
Quick Tip: The Uterine fundus is the upper portion of the uterus, not the Fallopian tube.
The “Ti plasmid” of Agrobacterium tumefaciens stands for:
- The Ti plasmid stands for Tumor Inducing Plasmid.
- It is responsible for the ability of \textit{Agrobacterium tumefaciens to cause crown gall disease in plants.
Quick Tip: Ti plasmids are used in genetic engineering to introduce foreign genes into plants.
Match List I with List II:
Choose the correct answer from the options given below:
- Expiratory capacity (A) is the sum of Expiratory reserve volume and Tidal volume (II).
- Functional residual capacity (B) is the sum of Expiratory reserve volume and Residual volume (IV).
- Vital capacity (C) is the sum of Tidal volume, Inspiratory reserve volume, and Expiratory reserve volume (I).
- Inspiratory capacity (D) is the sum of Tidal volume and Inspiratory reserve volume (III).
Quick Tip: Vital capacity refers to the total volume of air that can be exhaled after a maximum inhalation.
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R:
Assertion A: FSH acts upon ovarian follicles in females and Leydig cells in males.
Reason R: Growing ovarian follicles secrete estrogen in females while interstitial cells secrete androgen in male human beings.
Choose the correct answer from the options given below:
- FSH (Follicle Stimulating Hormone) indeed acts upon ovarian follicles in females, but it does not directly act on Leydig cells. LH is the hormone that stimulates Leydig cells.
- Growing ovarian follicles secrete estrogen in females, and Leydig cells secrete androgens in males, making Reason R true.
Quick Tip: FSH targets ovarian follicles in females, while LH stimulates Leydig cells in males.
Match List I with List II:
Choose the correct answer from the options given below:
- Lipase (A) acts on the ester bond in lipids (II).
- Nuclease (B) cleaves the phosphodiester bond in nucleic acids (IV).
- Protease (C) breaks down peptide bonds in proteins (I).
- Amylase (D) acts on the glycosidic bond in carbohydrates (III).
Quick Tip: Each enzyme targets a specific type of bond, depending on the molecule it acts upon.
Given below are some stages of human evolution. Arrange them in correct sequence (Past to Recent):
A. Homo habilis
B. Homo sapiens
C. Homo neanderthalensis
D. Homo erectus
Choose the correct sequence of human evolution from the options given below:
- The correct sequence of human evolution from past to present is: Homo habilis (A), Homo erectus (D), Homo neanderthalensis (C), and finally Homo sapiens (B).
Quick Tip: Homo habilis is one of the earliest members of the genus Homo, often referred to as the "handy man" for using tools.
Which of the following are Autoimmune disorders?
A. Myasthenia gravis
B. Rheumatoid arthritis
C. Gout
D. Muscular dystrophy
E. Systemic Lupus Erythematosus (SLE)
Choose the most appropriate answer from the options given below:
- Myasthenia gravis, Rheumatoid arthritis, and Systemic Lupus Erythematosus (SLE) are all autoimmune disorders where the body's immune system attacks its own tissues.
- Gout and Muscular dystrophy are not autoimmune disorders.
Quick Tip: Autoimmune diseases occur when the immune system mistakenly targets the body's own tissues as harmful.
Match List I with List II:
Choose the correct answer from the options given below:
- Common cold is caused by Rhinoviruses (III).
- Haemozoin is a product of Plasmodium (I), the parasite responsible for malaria.
- Widal test is used for diagnosing Typhoid (II).
- Allergy is triggered by Dust mites (IV).
Quick Tip: Widal test detects the presence of antibodies against *Salmonella typhi* in typhoid infection.
Match List I with List II:
Choose the correct answer from the options given below:
- Axoneme is found in Cilia and flagella (II).
- Cartwheel pattern is a feature of the Centriole (I).
- Crista is found in the Mitochondria (IV).
- Satellite is associated with Chromosome (III).
Quick Tip: The axoneme is a structural component of cilia and flagella, responsible for their movement.
Match List I with List II:
Choose the correct answer from the options given below:
- Pleurobrachia is a type of Ctenophora (II).
- Radula is found in Mollusca (I).
- Stomochord is present in Hemichordata (IV).
- Air bladder is characteristic of Osteichthyes (III).
Quick Tip: The radula is a feeding organ in mollusks used for scraping or cutting food.
Three types of muscles are given as a, b, and c. Identify the correct matching pair along with their location in the human body:
- Figure (a) shows skeletal muscles attached to bones like triceps and biceps, enabling voluntary movements.
- Figure (b) shows smooth muscles, which are non-striated and found in internal organs like the stomach wall.
- Figure (c) shows cardiac muscles, which are striated and involuntary, located in the heart wall.
Quick Tip: Skeletal muscles are voluntary, smooth muscles are involuntary, and cardiac muscles are striated but involuntary.
Match List I with List II:
Choose the correct answer from the options given below:
- Diakinesis involves the completion of terminalization of chiasmata (II).
- Pachytene is characterized by the appearance of recombination nodules (IV).
- Zygotene is marked by the formation of the synaptonemal complex (I).
- Leptotene is distinguished by chromosomes appearing as thin threads (III).
Quick Tip: Diakinesis is the final stage of prophase I, where crossing over is complete and chromosomes are prepared for metaphase.
Choose the correct answer from the options given below:
- Down’s syndrome is caused by trisomy of chromosome 21 (III).
- \(\alpha\)-Thalassemia is linked with chromosome 16 (IV).
- \(\beta\)-Thalassemia is associated with chromosome 11 (I).
- Klinefelter’s syndrome results from an XXY chromosome pattern (II).
Quick Tip: Down’s syndrome occurs due to an extra copy of chromosome 21, leading to developmental and intellectual delays.
Which of the following statements is incorrect?
- Bio-reactors are primarily used for large-scale cultivation of microorganisms or cells, not small-scale cultures.
- They are equipped with agitators, oxygen delivery systems, and foam control systems to maintain optimal growth conditions.
Quick Tip: Bio-reactors are essential in industrial biotechnology for mass production of products like vaccines, enzymes, and antibiotics.
Match List I with List II:
Choose the correct answer from the options given below:
- Pterophyllum is commonly known as Angelfish (III).
- Myxine is also called Hagfish (I).
- Pristis is the Sawfish (II).
- Exocoetus is known as the Flying fish (IV).
Quick Tip: Angelfish (Pterophyllum) is a popular aquarium fish, while Exocoetus (Flying fish) is known for its ability to glide above the water surface.
The following diagram shows restriction sites in E. coli cloning vector pBR322. Find the role of ‘X’ and ‘Y’ genes:
- 'X' represents ori (Origin of Replication), which controls the copy number of the linked DNA.
- 'Y' represents \textit{rop, a gene coding for a protein involved in plasmid replication.
- Together, \textit{ori and \textit{rop ensure proper replication and maintenance of plasmids in the host cell.
Quick Tip: The \textit{ori region determines the number of plasmids within a cell, while the rop gene helps regulate plasmid replication.
Given below are two statements:
Statement I: The presence or absence of hymen is not a reliable indicator of virginity.
Statement II: The hymen is torn during the first coitus only.
In the light of the above statements, choose the correct answer from the options given below:
- Statement I is true. The presence or absence of the hymen is not a reliable indicator of virginity because it can be torn due to various activities like exercise, tampon use, or injury.
- Statement II is false. The hymen can remain intact even after coitus or may tear due to non-sexual activities.
Quick Tip: The hymen is not a definitive marker of virginity; it can be stretched or torn for reasons unrelated to sexual activity.
Consider the following statements:
A. Annelids are true coelomates
B. Poriferans are pseudocoelomates
C. Aschelminthes are acoelomates
D. Platyhelminthes are pseudocoelomates
Choose the correct answer from the options given below:
- A. Annelids are true coelomates – True. They have a body cavity completely lined by mesoderm.
- B. Poriferans are pseudocoelomates – False. Poriferans are acoelomates.
- C. Aschelminthes are acoelomates – False. Aschelminthes are pseudocoelomates.
- D. Platyhelminthes are pseudocoelomates – False. Platyhelminthes are acoelomates.
Quick Tip: Among the listed groups, Annelids are the only true coelomates.
Given below are two statements:
Statement I: In the nephron, the descending limb of the loop of Henle is impermeable to water and permeable to electrolytes.
Statement II: The proximal convoluted tubule is lined by simple columnar brush border epithelium, which increases the surface area for reabsorption.
In the light of the above statements, choose the correct answer from the options given below:
- Statement I is false. The descending limb of the loop of Henle is permeable to water but impermeable to electrolytes.
- Statement II is false. The proximal convoluted tubule is lined by simple cuboidal epithelium with a brush border, not columnar epithelium.
Quick Tip: The descending limb of the loop of Henle absorbs water, while the ascending limb absorbs electrolytes.
Following are the stages of cell division:
A. Gap 2 phase
B. Cytokinesis
C. Synthesis phase
D. Karyokinesis
E. Gap 1 phase
Choose the correct sequence of stages from the options given below:
The correct sequence of stages in cell division is:
- E. Gap 1 phase (first phase where the cell grows).
- C. Synthesis phase (DNA replication occurs).
- A. Gap 2 phase (preparation for cell division).
- D. Karyokinesis (division of the nucleus).
- B. Cytokinesis (division of the cytoplasm).
Quick Tip: Karyokinesis is the division of the nucleus, while cytokinesis refers to the division of the cytoplasm.
In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on:
In cockroaches, a pair of anal cerci is present on the 10th abdominal segment. These cerci help in sensing changes in the environment, particularly detecting air currents.
Quick Tip: Anal cerci are sensory structures that help cockroaches detect changes in their surroundings.
Match List I with List II:
Choose the correct answer from the options given below:
- Fibrous joints (A): These joints are immovable, as seen in the skull, so the correct match is A-III.
- Cartilaginous joints (B): These joints allow limited movement, like between adjacent vertebrae, so B-I is correct.
- Hinge joints (C): These allow movement like in the knee, so C-IV is correct.
- Ball and socket joints (D): These joints allow rotational movement, as seen between the humerus and the pectoral girdle, so D-II is correct.
Quick Tip: Ball and socket joints allow rotational movement, while hinge joints allow movement in one plane.
Which of the following is not a steroid hormone?
- Testosterone, Progesterone, and Cortisol are steroid hormones derived from cholesterol and are lipophilic, allowing them to cross cell membranes easily.
- Glucagon, however, is a peptide hormone, not a steroid hormone. It is synthesized from amino acids and works by binding to receptors on the cell surface.
Quick Tip: Steroid hormones are derived from cholesterol, while peptide hormones like glucagon are made from amino acids.
Following are the stages of pathway for conduction of an action potential through the heart:
A. AV bundle
B. Purkinje fibres
C. AV node
D. Bundle branches
E. SA node
Choose the correct sequence of pathway from the options given below:
The correct sequence for the conduction of an action potential through the heart is:
- E. SA node initiates the action potential.
- C. AV node delays the impulse to allow ventricles time to fill.
- A. AV bundle transmits the impulse down the septum.
- D. Bundle branches carry the impulse to the Purkinje fibers.
- B. Purkinje fibers distribute the impulse to the ventricles, causing contraction.
Quick Tip: The SA node is the pacemaker of the heart and starts the conduction of the action potential.
Match List I with List II:
Choose the correct answer from the options given below:
- A. Non-medicated IUD: The Lippes loop is a type of non-medicated intrauterine device. Thus, A-III.
- B. Copper releasing IUD: Multiload 375 is a copper-releasing IUD. Thus, B-I.
- C. Hormone releasing IUD: LNG-20 is a hormone-releasing IUD. Thus, C-IV.
- D. Implants: These release progestogens, a class of hormones. Thus, D-II.
Quick Tip: IUDs can be non-medicated (copper-based) or hormone-releasing, preventing pregnancy by altering the uterine environment.
Which of the following is not a natural/traditional contraceptive method?
- Periodic abstinence: Avoiding sexual intercourse during the fertile phase of the menstrual cycle.
- Lactational amenorrhea: A natural infertility method during breastfeeding.
- Vaults: Artificial contraceptive methods involving physical barriers.
- Coitus interruptus: The withdrawal method, which is a natural contraceptive method.
Quick Tip: Vaults are artificial contraceptives, unlike natural methods like abstinence or lactational amenorrhea.
Which one is the correct product of DNA-dependent RNA polymerase for the given template?
3’TACATGGCAAATATCCATTCA5’
DNA-dependent RNA polymerase synthesizes RNA in the 5' to 3' direction, complementary to the DNA template.
For the given template strand: 3’TACATGGCAAATATCCATTCA5’, the complementary RNA strand is: 5’AUGUACCGUUUAUAGGUAAGU3’.
Quick Tip: RNA synthesis replaces thymine (T) in DNA with uracil (U) in RNA.
Which one of the following factors will not affect the Hardy-Weinberg equilibrium?
The Hardy-Weinberg equilibrium assumes that allele frequencies in a population remain constant unless disturbed by factors such as:
- Genetic drift: Random changes in allele frequencies.
- Gene migration: Movement of alleles between populations.
- Genetic recombination: Introducing new combinations of alleles.
A constant gene pool does not disturb the equilibrium, maintaining allele frequencies.
Quick Tip: Hardy-Weinberg equilibrium assumes no allele frequency changes due to mutations, selection, or migration.
Match List I with List II:
Choose the correct answer from the options given below:
- Cocaine is derived from the Erythroxylum plant. (III)
- Heroin is synthesized from morphine, which comes from the opium poppy (Papaver somniferum). (IV)
- Morphine is used as an effective sedative in surgery. (I)
- Marijuana comes from Cannabis sativa. (II)
Quick Tip: Heroin and morphine are opiate derivatives, while cocaine and marijuana come from different plant families.
Match List I with List II:
- A. Typhoid is caused by *Salmonella typhi*, a bacterium.
- B. Leishmaniasis is caused by *Leishmania*, a protozoan parasite.
- C. Ringworm is a fungal infection caused by various types of fungi.
- D. Filariasis is caused by *Wuchereria bancrofti*, a nematode (roundworm).
Quick Tip: Typhoid is bacterial, Leishmaniasis is protozoal, Ringworm is fungal, and Filariasis is caused by a nematode.
Match List I with List II:
- A. \(\alpha\)–I antitrypsin: Deficiency causes emphysema (III).
- B. Cry IAb: Used for ADA deficiency (IV).
- C. Cry IAc: Toxin effective against cotton bollworm (I).
- D. Enzyme replacement therapy: Toxin effective against corn borer (II).
Quick Tip: Enzyme replacement therapy is used to treat genetic disorders like ADA deficiency.
Assertion-Reason Question:
Assertion (A): Breastfeeding during the initial period of infant growth is recommended by doctors for a healthy baby.
Reason (R): Colostrum contains several antibodies essential for developing resistance in the newborn baby.
- Breastfeeding is essential for infant growth as it provides vital nutrients and immune protection.
- Colostrum, the first milk, is rich in antibodies that protect the baby from infections.
Quick Tip: Colostrum is rich in immunoglobulins, especially IgA, which protects newborns from infections.
The flippers of Penguins and Dolphins are examples of:
- Convergent evolution occurs when unrelated species evolve similar traits due to similar environmental pressures.
- Penguins (birds) and Dolphins (mammals) evolved flippers independently as adaptations for swimming.
Quick Tip: Convergent evolution results in similar traits in unrelated species due to similar ecological niches.
Which of the following factors favor the formation of oxyhemoglobin in alveoli?
- High pO\(_2\) in alveoli enhances oxygen binding to hemoglobin.
- Lesser H\(^+\) concentration (less acidity) increases hemoglobin’s oxygen affinity by reducing the Bohr effect.
Quick Tip: In alveoli, high oxygen levels (pO\(_2\)) and low acidity promote efficient oxygen binding to hemoglobin.
Match List I with List II:
- A. Unicellular glandular epithelium: Found as goblet cells in the alimentary canal (III).
- B. Compound epithelium: Present on the moist surface of the buccal cavity (IV).
- C. Multicellular glandular epithelium: Found in glands like salivary glands (I).
- D. Endocrine glandular epithelium: Found in glands like the pancreas, which release hormones (II).
Quick Tip: Unicellular goblet cells secrete mucus, while multicellular glands like salivary glands secrete enzymes and other substances.
Choose the correct statement regarding juxtamedullary nephrons:
- Juxtamedullary nephrons have their renal corpuscles near the cortex-medulla boundary.
- Their Loop of Henle extends deep into the medulla, which is critical for concentrating urine.
- Juxtamedullary nephrons are fewer in number compared to cortical nephrons.
- The columns of Bertini are part of the renal medulla and do not contain nephrons.
Quick Tip: Juxtamedullary nephrons play a vital role in the production of concentrated urine due to their long loops of Henle.
Identify the correct roles of components (A), (B), (C), and (D) in spermatogenesis:
- A. FSH: Stimulates Sertoli cells to nourish developing sperm.
- B. Leydig cells: Produce testosterone, essential for spermatogenesis.
- C. Sertoli cells: Provide support and nutrients to developing sperm and form the blood-testis barrier.
- D. Spermiogenesis: Final stage of spermatogenesis, where spermatids mature into spermatozoa.
Quick Tip: FSH acts on Sertoli cells, while Leydig cells secrete testosterone, crucial for spermatogenesis.
Match List I with List II:
- A. P wave represents atrial depolarization (I).
- B. QRS complex represents ventricular depolarization (II).
- C. T wave represents ventricular repolarization (III).
- D. T-P gap represents the electrically silent phase of the heart (IV).
Quick Tip: The P wave, QRS complex, and T wave represent the electrical activity in the heart as seen on an ECG.
Given below are two statements:
Statement I: Bone marrow is the main lymphoid organ where all blood cells, including lymphocytes, are produced.
Statement II: Both bone marrow and thymus provide microenvironments for the development and maturation of T-lymphocytes.
- Statement I: True. Bone marrow is the primary lymphoid organ where blood cells, including lymphocytes, are produced.
- Statement II: True. Bone marrow is where T-lymphocytes originate, and the thymus is where they mature.
Quick Tip: Bone marrow is the site of blood cell production, while the thymus is essential for T-cell maturation.
Given below are two statements:
Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely.
Statement II: According to Gause's principle, during competition, the inferior will be eliminated. This may be true if resources are limiting.
In the light of the above statements, choose the correct answer from the options given below:
- Statement I is false because Gause's principle applies to species competing for the same resources, not different resources.
- Statement II is true because the inferior species is likely to be eliminated during competition if resources are limited.
Thus, Statement I is false, and Statement II is true, making the correct answer Option 3.
Quick Tip: Gause's principle focuses on competition for identical resources and predicts exclusion of the inferior competitor under limiting conditions.
Match List I with List II:
- A. Exophthalmic goiter: Caused by hypersecretion of thyroid hormone, leading to protruding eyeballs (III).
- B. Acromegaly: Caused by excessive secretion of growth hormone (IV).
- C. Cushing’s syndrome: Results from excess secretion of cortisol, characterized by moon face and hyperglycemia (I).
- D. Cretinism: Caused by hyposecretion of thyroid hormone, resulting in stunted growth (II).
Thus, the correct match is:
A - III, B - IV, C - I, D - II.
Quick Tip: Endocrine disorders like acromegaly and Cushing's syndrome involve hormonal imbalances, while cretinism results from thyroid hormone deficiency.
Match List I with List II related to the digestive system of cockroach:
- A. The crop is the structure used for storing food (IV).
- B. The gastric caeca are blind tubules at the junction of the foregut and midgut (II).
- C. Malpighian tubules are involved in excretion and osmoregulation (III).
- D. The gizzard grinds food before it enters the midgut (I).
Thus, the correct match is:
A - IV, B - II, C - III, D - I.
Quick Tip: The crop stores food temporarily, while the gizzard grinds it for digestion in cockroaches.
As per ABO blood grouping system, the blood group of father is B+, mother is A+, and child is O+. Their respective genotype can be:
- The father's blood group is B+, which means his genotype can be \( I_BI_B \) (homozygous) or \( I_Bi \) (heterozygous).
- The mother's blood group is A+, which means her genotype can be \( I_AI_A \) or \( I_Ai \).
- The child's blood group is O+, which must have the genotype \( ii \) as O blood type is recessive.
- For the child to inherit \( ii \), both parents must contribute an \( i \) allele, meaning both parents must be heterozygous: \( I_Bi \) (father) and \( I_Ai \) (mother).
Thus, the correct answer is Option (4): \( I_Bi \), \( I_Ai \), and \( ii \).
Quick Tip: The O blood group (genotype \( ii \)) requires both parents to carry the recessive \( i \) allele.
Match List I with List II:
- RNA polymerase III transcribes \( snRNAs \) and \( tRNA \), so it matches with IV.
- Termination of transcription in prokaryotes is facilitated by the Rho factor, so it matches with III.
- Splicing of exons is carried out by snRNPs (small nuclear ribonucleoproteins), so it matches with I.
- The TATA box is a promoter sequence recognized during transcription initiation, so it matches with II.
Thus, the correct match is:
A - IV, B - III, C - I, D - II.
Quick Tip: The TATA box is an essential promoter sequence for initiating transcription by RNA polymerase II.
Match List I with List II:
- The Mesozoic Era is known for the dominance of birds and reptiles (III).
- The Proterozoic Era saw the rise of lower invertebrates (I).
- The Cenozoic Era is recognized as the age of mammals (IV).
- The Paleozoic Era is marked by the emergence of fish and amphibians (II).
Thus, the correct match is:
A - III, B - I, C - IV, D - II.
Quick Tip: The Cenozoic Era is also called the "Age of Mammals," while the Mesozoic Era is known as the "Age of Reptiles."
Given below are two statements:
Statement I: The cerebral hemispheres are connected by a nerve tract known as the corpus callosum.
Statement II: The brain stem consists of the medulla oblongata, pons, and cerebrum.
In the light of the above statements, choose the correct answer from the options given below:
(1) Both Statement I and Statement II are incorrect.
(2) Statement I is correct but Statement II is incorrect.
(3) Statement I is incorrect but Statement II is correct.
(4) Both Statement I and Statement II are correct.
- Statement I is correct: The corpus callosum is a nerve tract that connects the two cerebral hemispheres, allowing communication between them.
- Statement II is incorrect: The brain stem consists of the medulla oblongata, pons, and midbrain, not the cerebrum. The cerebrum is part of the forebrain.
Thus, the correct answer is:
Statement I is correct, Statement II is incorrect.
Quick Tip: The brainstem includes the medulla oblongata, pons, and midbrain, while the cerebrum is part of the forebrain.
Regarding the catalytic cycle of an enzyme action, select the correct sequential steps:
A. Substrate-enzyme complex formation.
B. Free enzyme ready to bind with another substrate.
C. Release of products.
D. Chemical bonds of the substrate broken.
E. Substrate binding to active site.
The correct order of steps in the catalytic cycle of enzyme action is:
1. Substrate binding to active site (E).
2. Substrate-enzyme complex formation (A).
3. Chemical bonds of the substrate are broken (D).
4. Release of products (C).
5. Free enzyme ready to bind with another substrate (B).
Thus, the correct sequence is: \( E, A, D, C, B \).
Quick Tip: In enzyme catalysis, the enzyme returns to its original form after releasing the products, ready for another reaction.
Given below are two statements:
Statement I: Mitochondria and chloroplasts are both double-membrane bound organelles.
Statement II: The inner membrane of mitochondria is relatively less permeable compared to chloroplasts.
In the light of the above statements, choose the most appropriate answer from the options given below:
- Statement I is correct: Both mitochondria and chloroplasts are double-membrane bound organelles.
- Statement II is incorrect: The inner membrane of mitochondria is relatively more permeable compared to the inner membrane of chloroplasts, which is more selectively permeable.
Thus, the correct answer is:
Statement I is correct, Statement II is incorrect.
Quick Tip: Mitochondria have a highly permeable outer membrane and a selectively permeable inner membrane involved in ATP synthesis.
The following are the statements about non-chordates:
A. Pharynx is perforated by gill slits.
B. Notochord is absent.
C. Central nervous system is dorsal.
D. Heart is dorsal if present.
E. Post-anal tail is absent.
Choose the most appropriate answer from the options given below:
- Statement A is incorrect: Non-chordates generally do not have a pharynx perforated by gill slits, which is a feature of chordates.
- Statement B is correct: Non-chordates lack a notochord.
- Statement C is incorrect: Non-chordates typically have a ventral nervous system, not dorsal.
- Statement D is correct: If a heart is present in non-chordates, it is typically dorsal.
- Statement E is correct: A post-anal tail is generally absent in non-chordates.
Thus, the correct answer is: \( B, D, \& E \) only.
Quick Tip: Non-chordates are characterized by the absence of a notochord and a ventral nervous system, with few exceptions.
*The article might have information for the previous academic years, please refer the official website of the exam.