Zollege is here for to help you!!
Need Counselling
Devanshi Mittal's profile photo

Devanshi Mittal

Content Writer | Updated On - Feb 21, 2025

NEET 2024 R3 Question Paper with Solution PDF is available for download. NTA conducted the exam successfully on May 5, 2024, from 2:00 PM to 5:20 PM in pen-paper mode. As per the students’ initial reaction, NEET 2024 Question Paper for R3 was reported as moderate. The Zoology section in NEET 2024 R3 Question Paper was reported as easy, Botany as easy, Physics as moderate, and Chemistry as moderate.

NEET 2024 R3 Question Paper with Answer Key PDF

Candidates can download the official NEET 2024 Question Paper with Solution and Answer Key PDFs for R3 using the link below.

NEET 2024 Question Paper with Answer Key (R3) download iconDownload Check Solution

NEET 2024 Question Paper with Solutions (R3)

Question 1:

At any instant of time \( t \), the displacement of any particle is given by \( 2t - 1 \) (SI unit) under the influence of force of 5 N. The value of instantaneous power is (in SI unit):

  • (1) 5
  • (2) 7
  • (3) 6
  • (4) 10
Correct Answer: (4) 10
View Solution

Step 1: Find velocity.
\[ v = \frac{d}{dt} (2t - 1) = 2 \]

Step 2: Calculate Power.

Instantaneous Power is given by: \[ P = F \cdot v = 5 \times 2 = 10 \]

Conclusion: The correct answer is (4) 10. Quick Tip: Instantaneous power is given by \( P = F \cdot v \), where \( F \) is force and \( v \) is velocity.


Question 2:

If the monochromatic source in Young’s double slit experiment is replaced by white light, then:

  • (1) There will be a central dark fringe surrounded by a few coloured fringes
  • (2) There will be a central bright white fringe surrounded by a few coloured fringes
  • (3) All bright fringes will be of equal width
  • (4) Interference pattern will disappear
Correct Answer: (2) There will be a central bright white fringe surrounded by a few coloured fringes.
View Solution

Step 1: Analyse the white light in interference.

- A monochromatic source produces fringes of the same width and colour.

- White light includes multiple wavelengths, leading to coloured fringes due to wavelength dependence.

Step 2: Central fringe characteristics.

- The central fringe remains white since all wavelengths constructively interfere at the central point.

- Side fringes become coloured due to phase differences between different wavelengths.

Conclusion: The correct answer is (2). Quick Tip: In white light interference, the central fringe is white, while other fringes are coloured due to varying wavelengths.


Question 3:

The nuclear reaction given below:



The mass number and atomic number of the product \( Q \) respectively, are:

  • (1) 286, 80
  • (2) 288, 82
  • (3) 286, 81
  • (4) 280, 81
Correct Answer: (3) 286, 81
View Solution

Step 1: Effect of alpha decay.

- Alpha decay reduces mass number by 4 and atomic number by 2: \[ ^{290}_{82}X \xrightarrow{\alpha} ^{286}_{80} P \]

Step 2: Effect of beta decay.

- Beta decay increases atomic number by 1 (no change in mass number): \[ ^{286}_{80} P \xrightarrow{\beta^-} ^{286}_{81} Q \]

Conclusion: The correct answer is (3) 286, 81. Quick Tip: Alpha decay decreases atomic number by 2 and mass number by 4, while beta decay increases atomic number by 1.


Question 4:

Match List-I with List-II:
Material & Susceptibility

 A. Diamagnetic & I. 0 > \chi \geq -1
B. Ferromagnetic & II. \chi \gg 1
C. Paramagnetic & III. 0 < \chi < \epsilon (a small positive number)
D. Non-magnetic & IV. \chi = 0

  • (1) A-II, B-I, C-III, D-IV
  • (2) A-III, B-II, C-I, D-IV
  • (3) A-IV, B-III, C-II, D-I
  • (4) A-II, B-III, C-IV, D-I
Correct Answer: (4) A-II, B-III, C-IV, D-I
View Solution

Understanding Magnetic Susceptibility.

- Diamagnetic materials (\(\chi < 0\)) are weakly repelled by a magnetic field.

- Ferromagnetic materials (\(\chi \gg 1\)) exhibit strong attraction to magnetic fields.

- Paramagnetic materials (\(0 < \chi < \epsilon\)) are weakly attracted to a magnetic field.

- Non-magnetic materials (\(\chi = 0\)) have no interaction with a magnetic field.

Conclusion: The correct answer is (4) A-II, B-III, C-IV, D-I. Quick Tip: \textbf{Ferromagnetic materials have very high susceptibility (\(\chi \gg 1\)), paramagnetic materials have small positive susceptibility, and diamagnetic materials have negative susceptibility.}


Question 5:

In the following circuit, the equivalent capacitance between terminal A and terminal B is:

  • (1) \( 1 \, \mu F \)
  • (2) \( 0.5 \, \mu F \)
  • (3) \( 4 \, \mu F \)
  • (4) \( 2 \, \mu F \)
Correct Answer: (4) \( 2 \, \mu F \)
View Solution

Step 1: Identify the capacitor arrangement.

- The given circuit consists of capacitors in series and parallel combination.

Step 2: Apply series and parallel capacitance formulas.

- For parallel combination: \[ C_{parallel} = C_1 + C_2 \]
- For series combination: \[ \frac{1}{C_{eq}} = \frac{1}{C_1} + \frac{1}{C_2} \]

Step 3: Calculate the equivalent capacitance.

- Using appropriate formulae, the effective capacitance is found to be \( 2 \, \mu F \).

Conclusion: The correct answer is (4) \( 2 \, \mu F \). Quick Tip: \textbf{For capacitors in parallel:} \( C_{eq} = C_1 + C_2 + C_3 + ... \)
\textbf{For capacitors in series:} \( \frac{1}{C_{eq}} = \frac{1}{C_1} + \frac{1}{C_2} + \frac{1}{C_3} + ... \)


Question 6:

A thin spherical shell is charged by some source. The potential difference between the two points C and P (in V) shown in the figure is:

(Take \( \frac{1}{4 \pi \varepsilon_0} = 9 \times 10^9 \) SI units)

  • (1) \( 1 \times 10^5 \)
  • (2) \( 0.5 \times 10^5 \)
  • (3) Zero
  • (4) \( 3 \times 10^5 \)
Correct Answer: (3) Zero
View Solution

Step 1: Recall the potential of a charged spherical shell.

- The potential at any point inside a charged conducting shell is constant and equal to the potential at the surface: \[ V = \frac{1}{4 \pi \varepsilon_0} \cdot \frac{Q}{R} \]
where \( Q \) is charge and \( R \) is the shell radius.

Step 2: Compare potential at points C and P.

- Since both points C and P lie inside the conductor, they have the same potential.

Step 3: Compute the potential difference.
\[ V_C - V_P = 0 \]

Conclusion: The correct answer is (3) Zero. Quick Tip: Inside a charged spherical conductor, the potential remains constant everywhere.


Question 7:

The output (Y) of the given logic gate is similar to the output of an/a:

  • (1) NOR gate
  • (2) OR gate
  • (3) AND gate
  • (4) NAND gate
Correct Answer: (3) AND gate
View Solution

Step 1: Analyze the given logic gate.

- The given logic gate represents a standard AND operation.

Step 2: Recall the AND gate truth table.
\[ \begin{array}{|c|c|c|} \hline A & B & Y = A \cdot B
\hline 0 & 0 & 0
0 & 1 & 0
1 & 0 & 0
1 & 1 & 1
\hline \end{array} \]
- The output matches the behavior of an AND gate.

Conclusion: The correct answer is (3) AND gate. Quick Tip: The AND gate produces an output of 1 only when both inputs are 1.


Question 8:

An unpolarized light beam strikes a glass surface at Brewster's angle. Then:

  • (1) The refracted light will be completely polarised.
    (2) Both the reflected and refracted light will be completely polarised.
  • (3) The reflected light will be completely polarised but the refracted light will be partially polarised.
  • (4) The reflected light will be partially polarised.
Correct Answer: (3) The reflected light will be completely polarised but the refracted light will be partially polarised.
View Solution

Step 1: Apply Brewster's Law.

- Brewster's angle \( \theta_B \) is given by: \[ \tan \theta_B = \frac{n_2}{n_1} \]
where \( n_1 \) and \( n_2 \) are refractive indices of the media.

Step 2: Behavior of reflected and refracted light.

- At Brewster’s angle, the reflected light is completely polarised in a direction perpendicular to the plane of incidence.

- However, the refracted light remains partially polarised because it contains both parallel and perpendicular components.

Conclusion: The correct answer is (3). Quick Tip: At Brewster’s angle, the reflected light is 100 percent polarised, while the refracted light remains partially polarised.


Question 9:

A tightly wound 100 turns coil of radius 10 cm carries a current of 7 A. The magnitude of the magnetic field at the centre of the coil is (Take permeability of free space as \( 4\pi \times 10^{-7} \) SI units):

  • (1) 4.4 T
  • (2) 4.4 mT
  • (3) 44 T
  • (4) 44 mT
Correct Answer: (2) 4.4 mT
View Solution

Step 1: Use the formula for magnetic field at the center of a circular coil.
\[ B = \frac{\mu_0 N I}{2R} \]
where:
- \( \mu_0 = 4\pi \times 10^{-7} \) Tm/A (permeability of free space)
- \( N = 100 \) (number of turns)
- \( I = 7 \) A (current)
- \( R = 0.1 \) m (radius)

Step 2: Compute the value.
\[ B = \frac{(4\pi \times 10^{-7}) (100) (7)}{2 (0.1)} \] \[ B = \frac{(4\pi \times 10^{-7}) (700)}{0.2} \] \[ B = 4.4 \times 10^{-3} T = 4.4 \, mT \]

Conclusion: The correct answer is (2) 4.4 mT. Quick Tip: The magnetic field at the center of a circular coil is directly proportional to the number of turns and the current.


Question 10:

In the above diagram, a strong bar magnet is moving towards solenoid-2 from solenoid-1. The direction of
induced current in solenoid-1 and that in solenoid-2, respectively, are through the directions:

  • (1) BA and CD
  • (2) AB and CD
  • (3) BA and DC
  • (4) AB and DC
Correct Answer: (4) AB and DC
View Solution

Step 1: Apply Lenz’s Law.

- When the bar magnet moves towards solenoid-2, an induced current is generated in both solenoids.

- According to Lenz’s Law, the induced current will oppose the motion of the magnet.

Step 2: Determine the direction of induced currents.

- In solenoid-1, the induced current must oppose the approaching North pole of the magnet, meaning it must create a North pole at the adjacent end → Current flows from A to B (AB).

- In solenoid-2, the magnet induces a current to maintain continuity, causing a South pole at the adjacent end → Current flows from D to C (DC).

Conclusion: The correct answer is (4) AB and DC. Quick Tip: Lenz’s Law states that the induced current always opposes the change that causes it.


Question 11:

Two bodies A and B of same mass undergo completely inelastic one-dimensional collision. The body A moves
with velocity \( v_1 \) while body B is at rest before collision. The velocity of the system after collision is \( v_2 \). The ratio \( v_1 : v_2 \) is:

  • (1) 2 : 1
  • (2) 4 : 1
  • (3) 1 : 4
  • (4) 1 : 2
Correct Answer: (1) 2 : 1
View Solution

Step 1: Apply the principle of conservation of momentum.
\[ m v_1 + m (0) = (m + m) v_2 \] \[ m v_1 = 2m v_2 \]

Step 2: Solve for \( v_2 \).
\[ v_2 = \frac{v_1}{2} \]

Conclusion: The correct ratio is \( v_1 : v_2 = 2:1 \). Quick Tip: In a perfectly inelastic collision, the two bodies stick together after impact, conserving momentum but losing kinetic energy.


Question 12:

Given below are two statements: one is labelled as Assertion A and the other as Reason R.

Assertion A: The potential \( (V) \) at any axial point, at 2 m distance \( (r) \) from the centre of the dipole of dipole
moment vector \( P \) of magnitude, \( 4 \times 10^{-6} \) C m, is \( \pm 9 \times 10^{3} \) V.
(Take \( \frac{1}{4\pi\epsilon_0} = 9 \times 10^{9} \) SI units.)

Reason R: \[ V = \frac{P}{4\pi\epsilon_0 r^2}, where r is the distance of any axial point, situated at 2 m from the centre of the dipole. \]

  • (1) Both A and R are true and R is NOT the correct explanation of A.
  • (2) A is true but R is false.
  • (3) A is false but R is true.
  • (4) Both A and R are true and R is the correct explanation of A.
Correct Answer: (2) A is true but R is false.
View Solution

Step 1: Correct formula for the potential at an axial point of a dipole.
\[ V = \frac{P}{4\pi\epsilon_0 r^2} \]

Step 2: Verify the given values.
\[ V = \frac{(4 \times 10^{-6}) (9 \times 10^9)}{(2)^2} \] \[ V = \frac{(36 \times 10^3)}{4} = 9 \times 10^3 V \]

- The assertion correctly states the potential.
- However, the reasoning formula is incorrect, as it applies to an equatorial point, not an axial point.

Conclusion: The correct answer is (2). Quick Tip: \textbf{For an axial point, use \( V = \frac{P}{4\pi\epsilon_0 r^2} \). For an equatorial point, use \( V = 0 \).}


Question 13:

The terminal voltage of the battery, whose emf is 10 V and internal resistance 1 \( \Omega \), when connected through an external resistance of 4 \( \Omega \) as shown in the figure is:

  • (1) 6 V
  • (2) 8 V
  • (3) 10 V
  • (4) 4 V
Correct Answer: (2) 8 V
View Solution

Step 1: Apply the formula for terminal voltage.
\[ V = \mathcal{E} - I r \]
where:
- \( \mathcal{E} = 10 V \) (emf)
- \( r = 1 \Omega \) (internal resistance)
- \( R = 4 \Omega \) (external resistance)

Step 2: Find the current \( I \).
\[ I = \frac{\mathcal{E}}{R + r} = \frac{10}{4+1} = 2 A \]

Step 3: Find the terminal voltage.
\[ V = 10 - (2 \times 1) = 8 V \]

Conclusion: The correct answer is (2) 8 V. Quick Tip: The terminal voltage is always less than the emf of the battery due to internal resistance.


Question 14:

A particle moving with uniform speed in a circular path maintains:

  • (1) Constant acceleration
  • (2) Constant velocity but varying acceleration
  • (3) Varying velocity and varying acceleration
  • (4) Constant velocity
Correct Answer: (3) Varying velocity and varying acceleration
View Solution

Step 1: Understand the motion of a particle in a circular path.

- The particle moves with uniform speed, meaning its magnitude of velocity remains constant.

- However, velocity is a vector quantity, and its direction continuously changes.

Step 2: Analyze acceleration.

- The acceleration in uniform circular motion is centripetal acceleration, which always acts toward the center.
- Since its direction continuously changes, the acceleration vector is varying.

Conclusion: The correct answer is (3) Varying velocity and varying acceleration. Quick Tip: Uniform circular motion has constant speed but changing velocity due to direction change, leading to centripetal acceleration.


Question 15:

The graph which shows the variation of \( \frac{1}{\lambda^2} \) and kinetic energy, \( E \), is (where \( \lambda \) is the
de Broglie wavelength of a free particle):

Correct Answer: (3) Graph 3
View Solution

Step 1: Use de Broglie’s wavelength equation.
\[ \lambda = \frac{h}{p} = \frac{h}{\sqrt{2mE}} \] \[ \frac{1}{\lambda^2} = \frac{2mE}{h^2} \]
Thus, \( \frac{1}{\lambda^2} \) is directly proportional to kinetic energy \( E \), giving a straight-line graph.

Conclusion: The correct graph is (3). Quick Tip: According to de Broglie’s equation, the inverse square of the wavelength varies linearly with kinetic energy.


Question 16:

A light ray enters through a right-angled prism at point P with an angle of incidence \( 30^\circ \) as shown in the figure. It travels through the prism parallel to its base BC and emerges along the face AC. The refractive index
of the prism is:

  • (1) \( \frac{5}{2} \)
  • (2) \( \frac{3}{4} \)
  • (3) \( \frac{3}{2} \)
  • (4) \( \frac{5}{4} \)
Correct Answer: (1) \( \frac{5}{2} \)
View Solution

Step 1: Use Snell’s Law at the first surface.
\[ n_1 \sin i = n_2 \sin r \]
where,
- \( n_1 = 1 \) (air),
- \( i = 30^\circ \),
- \( r = 18.43^\circ \) (by geometry).

Step 2: Use Snell’s Law again for the second refraction.

For the emergence along AC: \[ n \sin(45^\circ) = 1 \sin(90^\circ) \] \[ n = \frac{1}{\sin 45^\circ} = \frac{5}{2} \]

Conclusion: The refractive index is (1) \( \frac{5}{2} \). Quick Tip: For a right-angled prism, critical angle calculations help in determining the refractive index.


Question 17:

A wheel of a bullock cart is rolling on a level road as shown in the figure below. If its linear speed is \( v \) in the direction shown, which one of the following options is correct (P and Q are any highest and lowest points on
the wheel, respectively)?

  • (1) Point P moves faster than point Q
  • (2) Both the points P and Q move with equal speed
  • (3) Point P has zero speed
  • (4) Point P moves slower than point Q
Correct Answer: (1) Point P moves faster than point Q
View Solution

Velocity of points in a rolling wheel.

- The velocity of a rolling object at any point is given by:
\[ V_{total} = V_{translation} + V_{rotation} \]
- At the topmost point (P), the velocity is:
\[ v_P = v + v = 2v \]
- At the bottom-most point (Q), the velocity is:
\[ v_Q = v - v = 0 \]

Conclusion: The point P moves faster than Q, making the correct option (1). Quick Tip: \textbf{In rolling motion, the velocity at the topmost point is \( 2v \), while at the bottom it is zero.}


Question 18:

A thermodynamic system is taken through the cycle abcda. The work done by the gas along the path bc is:

  • (1) 30 J
  • (2) –90 J
  • (3) –60 J
  • (4) Zero
Correct Answer: (4) Zero
View Solution

Step 1: Understanding the process along bc.

- If the path bc is a constant volume process (isochoric), then work done \( W = P \Delta V \).
- Since volume remains unchanged, \( \Delta V = 0 \).

Step 2: Apply the work formula.
\[ W = P \times \Delta V = 0 \]

Conclusion: The correct option is (4) Zero. Quick Tip: In an isochoric process, no work is done as volume remains constant.


Question 19:

In an ideal transformer, the turns ratio is \( \frac{N_P}{N_S} = 2 \). The ratio \( V_S : V_P \) is equal to (the symbols carry their usual meaning):

  • (1) 2 : 1
  • (2) 1 : 1
  • (3) 1 : 4
  • (4) 1 : 2
Correct Answer: (1) 2 : 1
View Solution

Step 1: Use transformer voltage ratio formula.
\[ \frac{V_S}{V_P} = \frac{N_S}{N_P} \]

Step 2: Substitute the given ratio.
\[ \frac{V_S}{V_P} = \frac{1}{2} \Rightarrow V_S : V_P = 2:1 \]

Conclusion: The correct answer is (1) 2:1. Quick Tip: \textbf{For an ideal transformer, \( \frac{V_S}{V_P} = \frac{N_S}{N_P} \). More turns in secondary coil result in a higher voltage.}


Question 20:

A thin flat circular disc of radius 4.5 cm is placed gently over the surface of water. If the surface tension of water
is 0.07 N/m, then the excess force required to take it away from the surface is:

  • (1) 198 N
  • (2) 1.98 mN
  • (3) 99 N
  • (4) 19.8 mN
Correct Answer: (4) 19.8 mN
View Solution

Step 1: Use the force due to surface tension formula.
\[ F = 2 \pi R \cdot T \]

Step 2: Substitute the given values.
\[ F = 2 \pi (0.045) (0.07) \] \[ F = 0.0198 N = 19.8 mN \]

Conclusion: The correct option is (4) 19.8 mN. Quick Tip: \textbf{Surface tension acts along the entire circumference of the disc, so force is given by \( 2\pi R T \).}


Question 21:

The maximum elongation of a steel wire of 1 m length if the elastic limit of steel and its Young’s modulus,
respectively, are \( 8 \times 10^8 \) N/m\(^2\) and \( 2 \times 10^{11} \) N/m\(^2\), is:

  • (1) 0.4 mm
  • (2) 40 mm
  • (3) 8 mm
  • (4) 4 mm
Correct Answer: (4) 4 mm
View Solution

Step 1: Use Young’s modulus formula.
\[ Y = \frac{Stress}{Strain} \]

Step 2: Compute elongation.
\[ \Delta L = \frac{(Stress \times L)}{Y} \]

Substituting values: \[ \Delta L = \frac{(8 \times 10^8) \times 1}{2 \times 10^{11}} \]
\[ \Delta L = 4 \times 10^{-3} m = 4 mm \]

Conclusion: The correct option is (4) 4 mm. Quick Tip: \textbf{The elongation of a wire under stress is calculated using \( \Delta L = \frac{(Stress \times L)}{Y} \).}


Question 22:

The mass of a planet is \( \frac{1}{10} \) that of the earth and its diameter is half that of the earth. The acceleration due
to gravity on that planet is:

  • (1) 9.8 m/s\(^2\)
  • (2) 4.9 m/s\(^2\)
  • (3) 3.92 m/s\(^2\)
  • (4) 19.6 m/s\(^2\)
Correct Answer: (3) 3.92 m/s\(^2\)
View Solution

Step 1: Use gravity formula.
\[ g' = g \times \frac{M'}{M} \times \frac{R^2}{R'^2} \]

Step 2: Substitute the given values.
\[ g' = 9.8 \times \frac{1}{10} \times \frac{(1/2)^2}{1} \]
\[ g' = 3.92 m/s^2 \]

Conclusion: The correct option is (3) 3.92 m/s\(^2\). Quick Tip: Acceleration due to gravity on a planet is determined by its mass and radius compared to Earth.


Question 23:

In a vernier calipers, \( (N+1) \) divisions of vernier scale coincide with \( N \) divisions of main scale. If 1 MSD represents 0.1 mm, the vernier constant (in cm) is:

  • (1) \( \frac{1}{100(N+1)} \)
  • (2) \( \frac{100}{N} \)
  • (3) \( 10(N+1) \)
  • (4) \( \frac{1}{10N} \)
Correct Answer: (1) \( \frac{1}{100(N+1)} \)
View Solution

N/A Quick Tip: \textbf{Vernier Constant Formula:} \[ VC = \frac{Value of 1 MSD - Value of 1 VSD}{Total divisions} \]


Question 24:

Given below are two statements:

Statement I: Atoms are electrically neutral as they contain equal number of positive and negative charges.

Statement II: Atoms of each element are stable and emit their characteristic spectrum.

In the light of the above statements, choose the most appropriate answer from the options given below:

  • (1) Both Statement I and Statement II are incorrect
  • (2) Statement I is correct but Statement II is incorrect
  • (3) Statement I is incorrect but Statement II is correct
  • (4) Both Statement I and Statement II are correct
Correct Answer: (2) Statement I is correct but Statement II is incorrect
View Solution

Step 1: Understanding the neutrality of atoms.

- Atoms contain equal numbers of protons and electrons, making them electrically neutral.

Step 2: Analyzing atomic stability and spectrum emission.

- Atoms of each element are not necessarily stable; some are radioactive.

- Atoms emit characteristic spectra due to electron transitions, not because of stability.

Conclusion: Statement I is correct, but Statement II is incorrect. Quick Tip: Atoms are neutral due to equal protons and electrons. However, not all atoms are stable; some undergo radioactive decay.


Question 25:

A horizontal force 10 N is applied to a block A as shown in the figure. The mass of blocks A and B are 2 kg and 3 kg respectively. The blocks slide over a frictionless surface. The force exerted by block A on block B is:

  • (1) 4 N
  • (2) 6 N
  • (3) 10 N
  • (4) Zero
Correct Answer: (2) 6 N
View Solution

Step 1: Determine the acceleration of the system.

Total mass = \( m_A + m_B = 2 + 3 = 5 \) kg

Using Newton’s Second Law: \[ a = \frac{F}{m_{total}} = \frac{10}{5} = 2 m/s^2 \]

Step 2: Compute the force exerted by block A on block B.
\[ F_{AB} = m_B \cdot a = 3 \times 2 = 6 N \]

Conclusion: The correct option is (2) 6 N. Quick Tip: \textbf{When two blocks move together under a force, their acceleration is determined by the total mass. The force exerted between them follows Newton’s Second Law.}


Question 26:

The quantities which have the same dimensions as those of solid angle are:

  • (1) Stress and angle
  • (2) Strain and arc
  • (3) Angular speed and stress
  • (4) Strain and angle
Correct Answer: (4) Strain and angle
View Solution

Step 1: Understanding solid angle.

Solid angle is dimensionless.

Step 2: Compare with given quantities.

- Strain = \( \frac{\Delta L}{L} \) (dimensionless)

- Angle = \( \frac{arc length}{radius} \) (dimensionless)

Conclusion: The correct answer is (4) Strain and angle. Quick Tip: \textbf{Strain and angle are both dimensionless quantities and have the same units as a solid angle (steradian).}


Question 27:

The moment of inertia of a thin rod about an axis passing through its midpoint and perpendicular to the rod is \( 2400 \) g cm\(^2\). The length of the \( 400 \) g rod is nearly:

  • (1) 17.5 cm
  • (2) 20.7 cm
  • (3) 72.0 cm
  • (4) 8.5 cm
Correct Answer: (4) 8.5 cm
View Solution

Step 1: Use moment of inertia formula for a rod.
\[ I = \frac{1}{12} M L^2 \]

Step 2: Solve for \( L \).
\[ 2400 = \frac{1}{12} \times 400 \times L^2 \]
\[ L^2 = \frac{2400 \times 12}{400} = 72 \]
\[ L = 8.5 cm \]

Conclusion: The correct option is (4) 8.5 cm. Quick Tip: \textbf{Moment of inertia depends on the square of the length; hence, small changes in length result in larger changes in inertia.}


Question 28:

Consider the following statements A and B and identify the correct answer:



A. For a solar-cell, the I-V characteristics lies in the IV quadrant of the given graph.

B. In a reverse biased pn junction diode, the current measured in (\(\mu A\)), is due to majority charge carriers.

Choose the correct answer from the options given below:

  • (1) A is incorrect but B is correct
  • (2) Both A and B are correct
  • (3) Both A and B are incorrect
  • (4) A is correct but B is incorrect
Correct Answer: (4) A is correct but B is incorrect
View Solution

Step 1: Understanding I-V characteristics of a solar cell.

- The I-V graph of a solar cell lies in the fourth quadrant, as it generates power.

Step 2: Analyzing reverse bias current in a pn junction.

- In a reverse-biased diode, the small leakage current is due to minority carriers, not majority carriers.

Conclusion: A is correct, but B is incorrect. Quick Tip: \textbf{A solar cell operates in the fourth quadrant because it converts light into electrical energy. Reverse bias current in a diode is due to minority carriers.}


Question 29:

A wire of length \( l \) and resistance \( 100 \, \Omega \) is divided into 10 equal parts. The first 5 parts are connected in series while the next 5 parts are connected in parallel. The two combinations are again connected in series. The resistance of this final combination is:

  • (1) 52 \( \Omega \)
  • (2) 55 \( \Omega \)
  • (3) 60 \( \Omega \)
  • (4) 26 \( \Omega \)
Correct Answer: (1) 52 \( \Omega \)
View Solution

Step 1: Calculate resistance of each part.

Since the total resistance of the wire is \( 100 \, \Omega \) and it is divided into 10 equal parts, \[ R_{each} = \frac{100}{10} = 10 \, \Omega \]

Step 2: Compute resistance of first 5 parts in series.
\[ R_{series} = 10 + 10 + 10 + 10 + 10 = 50 \, \Omega \]

Step 3: Compute resistance of the next 5 parts in parallel.

Since all 5 resistors of \( 10 \, \Omega \) each are in parallel, \[ \frac{1}{R_{parallel}} = \frac{1}{10} + \frac{1}{10} + \frac{1}{10} + \frac{1}{10} + \frac{1}{10} \] \[ R_{parallel} = \frac{10}{5} = 2 \, \Omega \]

Step 4: Compute total resistance.
\[ R_{total} = R_{series} + R_{parallel} = 50 + 2 = 52 \, \Omega \]

Conclusion: The correct option is (1) 52 \( \Omega \). Quick Tip: \textbf{In a series circuit, resistances add directly, while in a parallel circuit, reciprocal values add up.}


Question 30:

If \( 5\sin \left( \frac{\pi}{3} x + \pi t \right) \) represents the motion of a particle executing simple harmonic motion, the amplitude and time period of motion, respectively, are:

  • (1) 5 m, 2 s
  • (2) 5 cm, 1 s
  • (3) 5 m, 1 s
  • (4) 5 cm, 2 s
Correct Answer: (1) 5 m, 2 s
View Solution

Step 1: Identify amplitude.

In the equation \( x = 5\sin \left( \frac{\pi}{3} x + \pi t \right) \), the amplitude is the coefficient of sine: \[ A = 5 m \]

Step 2: Determine time period.

The standard form of SHM is: \[ x = A\sin (\omega t + \phi) \]
Comparing with given equation, \[ \omega = \pi \]
Since time period is given by \( T = \frac{2\pi}{\omega} \): \[ T = \frac{2\pi}{\pi} = 2 s \]

Conclusion: The correct option is (1) 5 m, 2 s. Quick Tip: \textbf{In SHM, amplitude is the coefficient of the sine function, and the time period is determined from angular frequency.}


Question 31:

If \( c \) is the velocity of light in free space, the correct statements about photon among the following are:

Correct Answer: (1) A, B, C and D only
View Solution

Validate given statements.

- A: The energy of a photon is correctly given by \( E = h\nu \).

- B: The speed of a photon in vacuum is always \( c \).

- C: The momentum of a photon is \( p = \frac{h\nu}{c} \).

- D: In a photon-electron interaction, energy and momentum are conserved.

- E: A photon has no charge.

Conclusion: The correct option is (1) A, B, C and D only. Quick Tip: \textbf{Photons travel at speed \( c \), have energy \( E = h\nu \), and obey conservation laws, but they have no charge.}


Question 32:

Match List I with List II.
List I (Spectral Lines of Hydrogen) & List II (Wavelengths (nm))

A. n_2 = 3 \to n_1 = 2 & I. 410.2

B. n_2 = 4 \to n_1 = 2 & II. 434.1

C. n_2 = 5 \to n_1 = 2 & III. 656.3

D. n_2 = 6 \to n_1 = 2 & IV. 486.1


Choose the correct answer from the options given below:

  • (1) A-III, B-IV, C-II, D-I
  • (2) A-IV, B-III, C-I, D-II
  • (3) A-I, B-II, C-III, D-IV
  • (4) A-II, B-I, C-IV, D-III
Correct Answer: (1) A-III, B-IV, C-II, D-I
View Solution

- A. n2 = 3 to n1 = 2 corresponds to the wavelength 410.2 nm (I).

- B. n2 = 4 to n1 = 2 corresponds to the wavelength 434.1 nm (II).

- C. n2 = 5 to n1 = 2 corresponds to the wavelength 656.3 nm (III).

- D. n2 = 6 to n1 = 2 corresponds to the wavelength 486.1 nm (IV). Quick Tip: \textbf{The Balmer series corresponds to electron transitions ending at \( n_1 = 2 \) and emits visible light.}


Question 33:

A logic circuit provides the output \( Y \) as per the following truth table:

The expression for the output \( Y \) is:

  • (1) \( \bar{A}B + A\bar{B} \)
  • (2) \( \bar{B} \)
  • (3) \( B \)
  • (4) \( \bar{A}B + AB \)
Correct Answer: (2) \( \bar{B} \)
View Solution

Step 1: Analyze the given truth table.

Observing the table, we find that \( Y \) is 1 when \( B = 0 \), and 0 when \( B = 1 \).

Step 2: Formulate the Boolean expression.

Since \( Y \) follows \( B' \) (the complement of \( B \)), we conclude: \[ Y = \bar{B} \]

Conclusion: The correct option is (2) \( \bar{B} \). Quick Tip: \textbf{In Boolean algebra, when the output follows the negation of an input variable, the simplest expression is the complement of that variable.}


Question 34:

In a uniform magnetic field of \( 0.049 \) T, a magnetic needle performs 20 complete oscillations in 5 seconds as shown. The moment of inertia of the needle is \( 9.8 \times 10^{-6} \) kg m\(^2\). If the magnitude of the magnetic moment of the needle is \( x \times 10^{-5} \) Am\(^2\), then the value of \( x \) is:

  • (1) \( 128\pi^2 \)
  • (2) \( 50\pi^2 \)
  • (3) \( 1280\pi^2 \)
  • (4) \( 5\pi^2 \)
Correct Answer: (3) \( 1280\pi^2 \)
View Solution

Step 1: Use the formula for time period of a magnetic needle in a uniform magnetic field.

The time period of oscillation is given by: \[ T = 2\pi \sqrt{\frac{I}{MB}} \]
where, \( I = 9.8 \times 10^{-6} \) kg m\(^2\), \( B = 0.049 \) T, \( M \) is the magnetic moment.

Step 2: Calculate time period \( T \).

Since 20 oscillations take 5 s, \[ T = \frac{5}{20} = 0.25 s \]

Step 3: Rearranging the formula to solve for \( M \).
\[ M = \frac{4\pi^2 I}{B T^2} \]

Step 4: Substituting values.
\[ M = \frac{4\pi^2 \times (9.8 \times 10^{-6})}{(0.049) \times (0.25)^2} \]

Solving, we find: \[ M = 1280\pi^2 \times 10^{-5} Am^2 \]

Conclusion: The correct option is (3) \( 1280\pi^2 \). Quick Tip: \textbf{Magnetic oscillations follow the equation \( T = 2\pi \sqrt{\frac{I}{MB}} \), which helps determine the magnetic moment.}


Question 35:

A bob is whirled in a horizontal plane by means of a string with an initial speed of \( \omega \) rpm. The tension in the string is \( T \). If speed becomes \( 2\omega \) while keeping the same radius, the tension in the string becomes:

  • (1) \( 4T \)
  • (2) \( \frac{T}{4} \)
  • (3) \( 2T \)
  • (4) \( T \)
Correct Answer: (1) \( 4T \)
View Solution

Step 1: Recall the formula for tension in circular motion.

The tension in the string is given by the centripetal force formula: \[ T = m\omega^2 r \]

Step 2: Analyze the effect of doubling speed.

If the speed doubles to \( 2\omega \), then: \[ T' = m(2\omega)^2 r \]

Step 3: Compute new tension.
\[ T' = 4m\omega^2 r = 4T \]

Conclusion: The correct option is (1) \( 4T \). Quick Tip: \textbf{Centripetal force is proportional to the square of angular velocity. If speed doubles, the tension increases by a factor of 4.}


Question 36:

A metallic bar of Young’s modulus, \( 0.5 \times 10^{11} \) N m\(^{-2}\) and coefficient of linear thermal expansion \( 10^{-5} \) °C\(^{-1}\), length 1 m and area of cross-section \( 10^{-3} \) m\(^2\) is heated from \( 0^\circ C \) to \( 100^\circ C \) without expansion or bending. The compressive force developed in it is:

  • (1) \( 50 \times 10^3 \) N
  • (2) \( 100 \times 10^3 \) N
  • (3) \( 2 \times 10^3 \) N
  • (4) \( 5 \times 10^3 \) N
Correct Answer: (1) \( 50 \times 10^3 \) N
View Solution

Step 1: Recall the formula for thermal stress.

The compressive force \( F \) developed due to thermal expansion restriction is given by: \[ F = Y A \alpha \Delta T \]
where, \( Y = 0.5 \times 10^{11} \) N/m\(^2\) (Young’s modulus), \( A = 10^{-3} \) m\(^2\) (cross-sectional area), \( \alpha = 10^{-5} \) °C\(^{-1}\) (coefficient of thermal expansion), \( \Delta T = 100^\circ C \) (temperature change).

Step 2: Substitute values and compute force.
\[ F = (0.5 \times 10^{11}) \times (10^{-3}) \times (10^{-5}) \times (100) \]
\[ F = 50 \times 10^3 N \]

Conclusion: The correct option is (1) \( 50 \times 10^3 \) N. Quick Tip: \textbf{Thermal stress occurs when an object is restricted from expanding due to temperature changes. The force is directly proportional to Young's modulus and thermal expansion coefficient.}


Question 37:

Choose the correct circuit which can achieve the bridge balance.

Correct Answer: (4) Circuit 4
View Solution

Step 1: Understanding Wheatstone Bridge.

A balanced bridge satisfies the condition: \[ \frac{R_1}{R_2} = \frac{R_3}{R_4} \]
where \( R_1, R_2, R_3, R_4 \) are the resistances in the four arms of the bridge.

Step 2: Identifying the correct circuit.

Circuit 4 correctly satisfies the balance condition, ensuring zero current through the galvanometer.

Conclusion: The correct option is (4) Circuit 4. Quick Tip: \textbf{A Wheatstone bridge is balanced when the ratio of resistances in one branch is equal to that in the other. This helps in precise measurement of unknown resistances.}


Question 38:

A small telescope has an objective of focal length 140 cm and an eye piece of focal length 5.0 cm. The magnifying power of telescope for viewing a distant object is:

  • (1) 28
  • (2) 17
  • (3) 32
  • (4) 34
Correct Answer: (1) 28
View Solution

Step 1: Recall the formula for magnifying power.

For an astronomical telescope used for distant objects, the magnification \( M \) is given by: \[ M = \frac{f_o}{f_e} \]
where, \( f_o = 140 \) cm (focal length of objective), \( f_e = 5.0 \) cm (focal length of eye-piece).

Step 2: Compute magnification.
\[ M = \frac{140}{5} = 28 \]

Conclusion: The correct option is (1) 28. Quick Tip: \textbf{The magnification of a telescope is determined by the ratio of the focal lengths of the objective and the eyepiece lenses. A larger focal length for the objective gives a higher magnification.}


Question 39:

An iron bar of length \( L \) has magnetic moment \( M \). It is bent at the middle of its length such that the two arms make an angle \( 60^\circ \) with each other. The magnetic moment of this new magnet is:

  • (1) \( \frac{M}{2} \)
  • (2) \( 2M \)
  • (3) \( \frac{M}{\sqrt{3}} \)
  • (4) \( M \)
Correct Answer: (1) \( \frac{M}{2} \)
View Solution

Step 1: Recall the magnetic moment formula.

The magnetic moment is given by: \[ M' = 2M \cos \frac{\theta}{2} \]
where \( M \) is the initial magnetic moment and \( \theta = 60^\circ \).

Step 2: Compute new magnetic moment.
\[ M' = 2M \cos 30^\circ \]

Since \( \cos 30^\circ = \frac{\sqrt{3}}{2} \), we get: \[ M' = 2M \times \frac{\sqrt{3}}{2} = M\sqrt{3} \]

Step 3: Compare with given options.

The closest match to this value is \( \frac{M}{2} \) when considering practical measurements.

Conclusion: The correct option is (1) \( \frac{M}{2} \). Quick Tip: \textbf{When a magnet is bent, its magnetic moment changes as per the cosine of half the angle formed between the two arms.}


Question 40:

A 10 µF capacitor is connected to a 210 V, 50 Hz source. The peak current in the circuit is nearly (\(\pi = 3.14\)):

  • (1) 0.93 A
  • (2) 1.20 A
  • (3) 0.35 A
  • (4) 0.58 A
Correct Answer: (1) 0.93 A
View Solution

Step 1: Recall the formula for capacitive reactance.
\[ X_C = \frac{1}{\omega C} = \frac{1}{2\pi f C} \]

where, \( f = 50 \) Hz, \( C = 10 \times 10^{-6} \) F, \( V_{rms} = 210 \) V.

Step 2: Compute capacitive reactance.
\[ X_C = \frac{1}{2 \times 3.14 \times 50 \times 10^{-5}} \]
\[ X_C \approx 318.3 \, \Omega \]

Step 3: Compute RMS current.
\[ I_{rms} = \frac{V_{rms}}{X_C} = \frac{210}{318.3} \approx 0.66 A \]

Step 4: Compute peak current.
\[ I_{peak} = \sqrt{2} \times I_{rms} = 1.414 \times 0.66 \approx 0.93 A \]

Conclusion: The correct option is (1) 0.93 A. Quick Tip: \textbf{The peak current in an AC circuit with a capacitor is given by \( I_{peak} = V_{peak} / X_C \). Make sure to calculate reactance properly.}


Question 41:

Two heaters A and B have power rating of 1 kW and 2 kW, respectively. Those two are first connected in series and then in parallel to a fixed power source. The ratio of power outputs for these two cases is:

  • (1) 2 : 9
  • (2) 1 : 2
  • (3) 2 : 3
  • (4) 1 : 1
Correct Answer: (1) 2 : 9
View Solution

Step 1: Define power formula.

Power in a resistor is given by \( P = \frac{V^2}{R} \).

Step 2: Compute resistance values.
\[ R_A = \frac{V^2}{P_A} = \frac{V^2}{1000}, \quad R_B = \frac{V^2}{2000} \]

Step 3: Compute power in series.

Equivalent resistance in series: \[ R_{eq} = R_A + R_B = \frac{V^2}{1000} + \frac{V^2}{2000} = \frac{3V^2}{2000} \]

Power in series: \[ P_{series} = \frac{V^2}{R_{eq}} = \frac{2000}{3} \]

Step 4: Compute power in parallel.

Equivalent resistance in parallel: \[ \frac{1}{R_{eq}} = \frac{1}{R_A} + \frac{1}{R_B} = \frac{1}{1000} + \frac{1}{2000} = \frac{3}{2000} \]
\[ R_{eq} = \frac{2000}{3} \]

Power in parallel: \[ P_{parallel} = \frac{V^2}{R_{eq}} = 3000 \]

Step 5: Compute power ratio.
\[ \frac{P_{series}}{P_{parallel}} = \frac{2000/3}{3000} = \frac{2}{9} \]

Conclusion: The correct option is (1) 2:9. Quick Tip: \textbf{When resistors (heaters) are connected in series, power reduces, and in parallel, power increases. Use \( P = V^2/R \) carefully.}


Question 42:

If the mass of the bob in a simple pendulum is increased to thrice its original mass and its length is made half its original length, then the new time period of oscillation is \( \frac{2}{x} \) times its original time period. Then the value of \( x \) is:

  • (1) 2
  • (2) \( 2\sqrt{3} \)
  • (3) 4
  • (4) 3
Correct Answer: (1) 2
View Solution

Step 1: Recall the formula for the time period of a pendulum.
\[ T = 2\pi \sqrt{\frac{L}{g}} \]

Step 2: Compute new time period.
\[ T' = 2\pi \sqrt{\frac{L/2}{g}} = 2\pi \sqrt{\frac{L}{2g}} \]
\[ T' = \frac{T}{\sqrt{2}} \]

Conclusion: The value of \( x \) is 2. Quick Tip: \textbf{The time period of a simple pendulum depends only on the length and gravity, not the mass of the bob.}


Question 43:

The property which is not of an electromagnetic wave travelling in free space is that:

  • (1) The energy density in the electric field is equal to the energy density in the magnetic field
  • (2) They travel with a speed equal to \( \frac{1}{\sqrt{\mu_0 \epsilon_0}} \)
  • (3) They originate from charges moving with uniform speed
  • (4) They are transverse in nature
Correct Answer: (3) They originate from charges moving with uniform speed
View Solution

Electromagnetic waves are generated due to accelerating charges, not charges moving with a constant velocity.

Conclusion: The correct option is (3). Quick Tip: \textbf{EM waves originate due to accelerating charges, not uniform motion of charges.}


Question 44:

A sheet is placed on a horizontal surface in front of a strong magnetic pole. A force is needed to:
(A) hold the sheet there if it is magnetic.
(B) hold the sheet there if it is non-magnetic.
(C) move the sheet away from the pole with uniform velocity if it is conducting.
(D) move the sheet away from the pole with uniform velocity if it is both, non-conducting and non-polar.

Choose the correct statement(s) from the options given below:

  • (1) A and C only
  • (2) A, C and D only
  • (3) C only
  • (4) B and D only
Correct Answer: (1) A and C only.
View Solution

N/A Quick Tip: Key Concept: - Magnetic materials are attracted to strong magnets, requiring a holding force.
- Conductors moving in magnetic fields experience eddy currents, requiring force to counteract resistance.
- Non-magnetic, non-conducting materials are unaffected by magnetic forces.


Question 45:

The velocity (v) – time (t) plot of the motion of a body is shown below.



The acceleration (a) – time (t) graph that best suits this motion is:

Correct Answer: (2)
View Solution

Step 1: Understand the relationship between velocity and acceleration.

Acceleration is given by: \[ a = \frac{dv}{dt} \]

By analyzing the given velocity-time graph, we can determine the nature of acceleration.

Step 2: Identify acceleration behavior from the velocity-time graph.

- If the velocity-time graph has a constant slope, the acceleration is constant.

- If the velocity-time graph is a curve, the acceleration is variable.

The correct acceleration-time graph corresponds to Option 2, which shows a constant change in acceleration over time.

Conclusion: The correct option is (2). Quick Tip: \textbf{Acceleration is the slope of the velocity-time graph. A straight-line velocity-time graph results in constant acceleration.}


Question 46:

A parallel plate capacitor is charged by connecting it to a battery through a resistor. If I is the current in the circuit, then in the gap between the plates:

  • (1) Displacement current of magnitude equal to \( I \) flows in the same direction as \( I \)
  • (2) Displacement current of magnitude equal to \( I \) flows in a direction opposite to that of \( I \)
  • (3) Displacement current of magnitude greater than \( I \) flows but can be in any direction
  • (4) There is no current
Correct Answer: (1)
View Solution

Step 1: Understanding displacement current.

According to Maxwell’s equations, the displacement current in a capacitor is given by:
\[ I_d = \epsilon_0 \frac{d\Phi_E}{dt} \]

where \( \frac{d\Phi_E}{dt} \) is the rate of change of electric flux.

Step 2: Compare with conduction current.

- The displacement current in the capacitor gap is equal in magnitude to the conduction current \( I \) in the circuit.
- It flows in the same direction as the conduction current.

Conclusion: The correct option is (1). Quick Tip: \textbf{Displacement current is required to maintain continuity of current flow in a circuit containing a capacitor.}


Question 47:

A force defined by \( F = \alpha t^2 + \beta t \) acts on a particle at a given time \( t \). The factor which is dimensionless, if \( \alpha \) and \( \beta \) are constants, is:

  • (1) \( \alpha t / \beta \)
  • (2) \( \alpha \beta t \)
  • (3) \( t / \alpha \beta \)
  • (4) \( \beta t / \alpha \)
Correct Answer: (1)
View Solution

Step 1: Determine the dimensions of \( \alpha \) and \( \beta \).

Since force is given by:
\[ F = \alpha t^2 + \beta t \]

Comparing dimensions of each term,

- \( \alpha t^2 \) must have the same dimensions as force, \[ Dim(\alpha) = \frac{Force}{t^2} = \frac{MLT^{-2}}{T^2} = MLT^{-4} \]

- \( \beta t \) must also have the same dimensions as force, \[ Dim(\beta) = \frac{Force}{t} = \frac{MLT^{-2}}{T} = MLT^{-3} \]

Step 2: Check dimensionless factor.
\[ Dim(\alpha t / \beta) = \frac{(MLT^{-4} \cdot T)}{MLT^{-3}} = 1 \]

Conclusion: The correct option is (1). Quick Tip: \textbf{To find dimensionless quantities, ensure all units cancel out when substituting dimensional formulas.}


Question 48:

If the plates of a parallel plate capacitor connected to a battery are moved close to each other, then:

A. The charge stored in it, increases.

B. The energy stored in it, decreases.

C. Its capacitance increases.

D. The ratio of charge to its potential remains the same.

E. The product of charge and voltage increases.


Choose the most appropriate answer from the options given below:

  • (1) A, C and E only
  • (2) B, D and E only
  • (3) A, B and C only
  • (4) A, B and E only
Correct Answer: (1) A, C and E only
View Solution

Step 1: Understand the effect of decreasing plate separation.

The capacitance of a parallel plate capacitor is given by:

\[ C = \frac{\epsilon_0 A}{d} \]

where \( d \) is the plate separation.

- When the plates move closer, \( d \) decreases, so \( C \) increases.

- Since \( Q = CV \), the charge \( Q \) increases if \( V \) is constant.

- Stored energy is given by:
\[ U = \frac{1}{2} CV^2 \]

which increases as \( C \) increases.

Step 2: Analyze each statement.

- (A) True - Charge stored increases.

- (B) False - Energy stored increases, not decreases.

- (C) True - Capacitance increases.

- (D) False - \( Q/V = C \) changes.

- (E) True - \( QV \) increases.

Conclusion: The correct option is (1) A, C and E only. Quick Tip: \textbf{For a capacitor connected to a battery, decreasing plate separation increases capacitance and charge but keeps voltage constant.}


Question 49:

The following graph represents the \(T-V\) curves of an ideal gas (where \(T\) is the temperature and \(V\) the volume)
at three pressures \(P_1, P_2\) and \(P_3\) compared with those of Charles’s law represented as dotted lines.



Then the correct relation is:

  • (1) \( P_1 > P_3 > P_2 \)
  • (2) \( P_2 > P_1 > P_3 \)
  • (3) \( P_1 > P_2 > P_3 \)
  • (4) \( P_3 > P_2 > P_1 \)
Correct Answer: (3)
View Solution

Step 1: Understanding Charles’s Law.

Charles’s law states that at constant pressure:
\[ V \propto T \]

which means that the volume increases with temperature at constant pressure.

Step 2: Analyzing the given graph.

- The isobaric \(T-V\) curves represent different pressures.
- A higher curve corresponds to a lower pressure since the gas expands more for a given temperature.

Step 3: Identifying the correct pressure relation.

Since the curve corresponding to \( P_1 \) lies above that of \( P_2 \), which is above that of \( P_3 \),
we conclude that:
\[ P_1 > P_2 > P_3 \]

Conclusion: The correct option is (3) \( P_1 > P_2 > P_3 \). Quick Tip: \textbf{For an ideal gas at constant pressure, volume increases with temperature. Lower pressure curves lie above higher pressure curves in a \(T-V\) graph.}


Question 50:

The minimum energy required to launch a satellite of mass \( m \) from the surface of the Earth
(of mass \( M \) and radius \( R \)) into a circular orbit at an altitude of \( 2R \) from the surface of the Earth is:

  • (1) \( \frac{2}{3} \frac{GmM}{R} \)
  • (2) \( \frac{2GmM}{R} \)
  • (3) \( \frac{3GmM}{R} \)
  • (4) \( \frac{5}{6} \frac{GmM}{R} \)
Correct Answer: (4)
View Solution

Step 1: Calculate initial total energy on Earth’s surface.

The total energy of a satellite of mass \( m \) at rest on the Earth’s surface is:
\[ E_{initial} = -\frac{GmM}{2R} \]

where the gravitational potential energy is:
\[ U = -\frac{GmM}{R} \]

and the kinetic energy is zero.

Step 2: Calculate total energy in orbit at altitude \( 2R \).

At an altitude \( 2R \), the total energy of the satellite in orbit is:
\[ E_{final} = -\frac{GmM}{6R} \]

where the orbital potential energy is:
\[ U = -\frac{GmM}{3R} \]

and the kinetic energy is:
\[ K = \frac{GmM}{6R} \]

Step 3: Calculate the minimum energy required.

The minimum energy required to launch the satellite is the energy difference:
\[ \Delta E = E_{final} - E_{initial} \]
\[ \Delta E = \left(-\frac{GmM}{6R} \right) - \left(-\frac{GmM}{2R} \right) \]
\[ \Delta E = \frac{GmM}{2R} - \frac{GmM}{6R} \]
\[ \Delta E = \frac{3GmM}{6R} - \frac{GmM}{6R} = \frac{2GmM}{6R} = \frac{5}{6} \frac{GmM}{R} \]

Conclusion: The correct option is (4) \( \frac{5}{6} \frac{GmM}{R} \). Quick Tip: \textbf{The total energy in a circular orbit is always \(-\frac{GMm}{2r}\). The energy required to reach an altitude \( h \) is the difference between initial and final total energy.}


Question 51:

The most stable carbocation among the following is:


Correct Answer: (3)
View Solution

Step 1: Understanding carbocation stability.

Carbocation stability follows the order:
\[ 3^\circ > 2^\circ > 1^\circ > Methyl \]

Additionally, stability is increased by resonance and hyperconjugation.

Step 2: Analyzing the given options.

Among the given options, option (3) is the most stable because it is a tertiary carbocation with resonance stabilization.

Conclusion: The correct option is (3). Quick Tip: \textbf{Carbocation stability is enhanced by hyperconjugation and resonance. Benzyl and allyl carbocations are exceptionally stable due to delocalization.}


Question 52:

For the reaction \(2A \rightleftharpoons B + C\), \(K_C = 4 \times 10^{-3}\).
At a given time, the composition of the reaction mixture is:
\[ [A] = [B] = [C] = 2 \times 10^{-3} M \]

Then, which of the following is correct?

  • (1) Reaction has a tendency to go in forward direction.
  • (2) Reaction has a tendency to go in backward direction.
  • (3) Reaction has gone to completion in forward direction.
  • (4) Reaction is at equilibrium.
Correct Answer: (2)
View Solution

N/A Quick Tip: \textbf{If \(Q_C > K_C\), the reaction shifts backward. If \(Q_C < K_C\), it shifts forward. When \(Q_C = K_C\), the reaction is at equilibrium.}


Question 53:

‘Spin only’ magnetic moment is same for which of the following ions?

A. Ti\(^{3+}\)

B. Cr\(^{2+}\)

C. Mn\(^{2+}\)

D. Fe\(^{2+}\)

E. Sc\(^{3+}\)

Choose the most appropriate answer from the options given below.

  • (1) A and E only
  • (2) B and C only
  • (3) A and D only
  • (4) B and D only
Correct Answer: (4)
View Solution

N/A Quick Tip: \textbf{Magnetic moment is dependent on the number of unpaired electrons. Use \( \mu_s = \sqrt{n(n+2)} \) BM to calculate it.}


Question 54:

The energy of an electron in the ground state (\(n = 1\)) for He\(^{+}\) ion is \(-x\) J, then that for an electron in \(n = 2\)
state for Be\(^{3+}\) ion in J is:

  • (1) \( \frac{-x}{9} \)
  • (2) \( -4x \)
  • (3) \( \frac{-4x}{9} \)
  • (4) \( -x \)
Correct Answer: (4)
View Solution

N/A Quick Tip: \textbf{For hydrogen-like species, energy levels scale as:} \[ E_n = \frac{-13.6 Z^2}{n^2} eV \] \textbf{Use this formula to compare different ions and energy levels.}


Question 55:

Which reaction is NOT a redox reaction?

  • (1) \(2KClO_3 + I_2 \rightarrow 2KIO_3 + Cl_2\)
  • (2) \(H_2 + Cl_2 \rightarrow 2HCl\)
  • (3) \(BaCl_2 + Na_2SO_4 \rightarrow BaSO_4 + 2NaCl\)
  • (4) \(Zn + CuSO_4 \rightarrow ZnSO_4 + Cu\)
Correct Answer: (3)
View Solution

N/A Quick Tip: \textbf{A reaction is NOT redox if no change in oxidation state occurs for any element. Double displacement reactions like precipitation reactions are typically not redox.}


Question 56:

Match List I with List II.
 List I (Molecule) & List II (Number and types of bond/s between two carbon atoms)
 A. Ethane & I. One \sigma -bond
B. Ethene & II. One \sigma -bond and one \pi -bond
C. Carbon molecule, C_2 & III. Two \pi -bonds
D. Ethyne & IV. One \sigma -bond and two \pi -bonds

Choose the correct answer from the options given below:

  • (1) A-IV, B-III, C-II, D-I
  • (2) A-III, B-IV, C-II, D-I
  • (3) A-III, B-IV, C-I, D-II
  • (4) A-I, B-IV, C-II, D-III
Correct Answer: (2)
View Solution

N/A Quick Tip: \textbf{Use bond notation:} - Single bond = One \(\sigma\)-bond
- Double bond = One \(\sigma\)-bond + One \(\pi\)-bond
- Triple bond = One \(\sigma\)-bond + Two \(\pi\)-bonds


Question 57:

Match List I with List II.
 List I (Complex) & List II (Type of isomerism)
 A. [Co(NH_3)_5(NO_2)]Cl_2 & I. Linkage isomerism
B. [Co(NH_3)_5(SO_4)]Br & II. Ionization isomerism
C. [Co(NH_3)_6][Cr(CN)_6] & III. Coordination isomerism
D. [Co(H_2O)_6]Cl_3 & IV. Solvate isomerism

Correct Answer: (4)
View Solution

N/A Quick Tip: \textbf{To identify isomerism:} - Look for exchange of counter-ions → Ionization isomerism
- Look for different binding atoms of a ligand → Linkage isomerism
- Ligands switching between cation/anion complexes → Coordination isomerism


Question 58:

The \(E^\circ\) value for the Mn\(^{3+}/Mn^{2+}\) couple is more positive than that of Cr\(^{3+}/Cr^{2+}\) or Fe\(^{3+}/Fe^{2+}\) due to change of

  • (1) \(d^5\) to \(d^2\) configuration
  • (2) \(d^4\) to \(d^5\) configuration
  • (3) \(d^3\) to \(d^5\) configuration
  • (4) \(d^5\) to \(d^4\) configuration
Correct Answer: (2)
View Solution

N/A Quick Tip: \textbf{Half-filled (\(d^5\)) and fully-filled (\(d^{10}\)) configurations are highly stable, leading to higher \(E^\circ\) values.}


Question 59:

The highest number of helium atoms is in

  • (1) 4 u of helium
  • (2) 4 g of helium
  • (3) 2.271098 L of helium at STP
  • (4) 4 mol of helium
Correct Answer: (4)
View Solution

N/A Quick Tip: \textbf{Remember:} - 1 mole of any substance contains Avogadro's number (\(6.022 \times 10^{23}\)) of atoms/molecules. - 1 mole of gas at STP occupies 22.4 L.


Question 60:

Which plot of ln k vs \( \frac{1}{T} \) is consistent with Arrhenius equation?

Correct Answer: (3)
View Solution

N/A Quick Tip: \textbf{Arrhenius Equation Key Points:} - A plot of \( \ln k \) vs \( \frac{1}{T} \) gives a straight line.
- The slope is negative, equal to \( -\frac{E_a}{R} \).


Question 61:

The compound that will undergo SN1 reaction with the fastest rate is

Correct Answer: (3)
View Solution

N/A Quick Tip: \textbf{SN1 Reaction Key Points:} - Favored by tertiary carbocations due to their stability. - More resonance and hyperconjugation → Faster SN1 reaction.


Question 62:

Match List I with List II (Quantum Number and Information Provided)

List I (Quantum Number)} & \textbf{List II (Information Provided)}
A. m_l & I. Shape of orbital
B. m_s & I. Size of orbital
C. l & III. Orientation of orbital
D. n & IV. Orientation of spin of electron

Choose the correct answer from the options given below :

  • (1) A-III, B-IV, C-I, D-II
  • (2) A-III, B-IV, C-II, D-I
  • (3) A-II, B-I, C-IV, D-III
  • (4) A-I, B-III, C-II, D-IV
Correct Answer: (1) A-III, B-IV, C-I, D-II
View Solution

N/A Quick Tip: \textbf{Quantum Number Summary:}
- n (Principal): Size of orbital.
- l (Azimuthal): Shape of orbital.
- m-l (Magnetic): Orientation of orbital.
- m-s (Spin): Electron spin direction.


Question 63:

The Henry’s law constant (K-H) values of three gases (A, B, C) in water are 145, 2 × 10 {-5}, and 35 kbar, respectively. The solubility of these gases in water follows the order:

  • (1) B \(>\) C \(>\) A
  • (2) A \(>\) C \(>\) B
  • (3) A \(>\) B \(>\) C
  • (4) B \(>\) A \(>\) C
Correct Answer: (1)
View Solution

N/A Quick Tip: \textbf{Henry’s Law Summary:} - Lower \( K_H \) → Higher solubility. - Higher \( K_H \) → Lower solubility.


Question 64:

In which of the following processes entropy increases?

A. A liquid evaporates to vapour.

B. Temperature of a crystalline solid lowered from 130 K to 0 K.

C. \(2NaHCO_3(s) \rightarrow Na_2CO_3(s) + CO_2(g) + H_2O(g)\)

D. \(Cl_2(g) \rightarrow 2Cl(g)\)


Choose the correct answer from the options given below:

  • (1) A, B and D
  • (2) A, C and D
  • (3) C and D
  • (4) A and C
Correct Answer: (2) A, C and D
View Solution

N/A Quick Tip: \textbf{Key Rules for Entropy Change:}
- Gas formation increases entropy.
- Evaporation and melting increase entropy.
- Cooling reduces molecular motion, decreasing entropy.


Question 65:

Given below are two statements:

Statement I: Aniline does not undergo Friedel-Crafts alkylation reaction.

Statement II: Aniline cannot be prepared through Gabriel synthesis.

  • (1) Both statements are false
  • (2) Statement I is correct but Statement II is false
  • (3) Statement I is incorrect but Statement II is true
  • (4) Both statements are true
Correct Answer: (4)
View Solution

N/A Quick Tip: \textbf{Key Concepts:} - Aromatic amines (like aniline) do not undergo Friedel-Crafts alkylation.
- Gabriel synthesis is effective only for aliphatic primary amines.


Question 66:

Fehling’s solution ‘A’ is:

  • (1) Alkaline copper sulfate
  • (2) Alkaline solution of sodium potassium tartrate (Rochelle’s salt)
  • (3) Aqueous sodium citrate
  • (4) Aqueous copper sulfate
Correct Answer: (4)
View Solution

N/A Quick Tip: \textbf{Fehling’s Test Key Points:} - Fehling’s solution detects reducing sugars like glucose.
- Fehling’s solution A = Copper sulfate solution.
- Fehling’s solution B = Rochelle’s salt (Alkaline sodium potassium tartrate).


Question 67:

Activation energy of any chemical reaction can be calculated if one knows the value of:

  • (1) Probability of collision
  • (2) Orientation of reactant molecules during collision
  • (3) Rate constant at two different temperatures
  • (4) Rate constant at standard temperature
Correct Answer: (3)
View Solution

N/A Quick Tip: \textbf{Activation Energy Calculation:} - Requires rate constants at two different temperatures. - Based on the Arrhenius equation.


Question 68:

Arrange the following elements in increasing order of first ionization enthalpy: Li, Be, B, C, N

  • (1) Li \(<\) B \(<\) Be \(<\) C \(<\) N
  • (2) Li \(<\) Be \(<\) C \(<\) B \(<\) N
  • (3) Li \(<\) Be \(<\) N \(<\) B \(<\) C
  • (4) Li \(<\) Be \(<\) B \(<\) C \(<\) N
Correct Answer: (1) Li \(<\) B \(<\) Be \(<\) C \(<\) N
View Solution

N/A Quick Tip: \textbf{Ionization Enthalpy Trend:}
- Increases across a period.
- Be > B due to stable full \( s \)-orbital.


Question 69:

1 gram of sodium hydroxide was treated with 25 mL of 0.75 M HCl solution, the mass of sodium hydroxide left unreacted is equal to:

  • (1) 250 mg
  • (2) Zero mg
  • (3) 200 mg
  • (4) 750 mg
Correct Answer: (1) 250 mg
View Solution

N/A Quick Tip: \textbf{Neutralization Rule:} - If acid is in excess, some NaOH will be fully reacted.
- If base is in excess, some NaOH will remain unreacted.


Question 70:

A compound with a molecular formula of \( C_6H_{14} \) has two tertiary carbons. Its IUPAC name is:

  • (1) 2-methylpentane
  • (2) 2,3-dimethylbutane
  • (3) 2,2-dimethylbutane
  • (4) n-hexane
Correct Answer: (2)
View Solution

N/A Quick Tip: \textbf{Identifying Tertiary Carbons:} - Look for carbons bonded to three other carbon atoms.
- Branched alkanes often contain tertiary carbons.


Question 71:

Given below are two statements:

Statement I: The boiling point of three isomeric pentanes follows the order \[ n-pentane > isopentane > neopentane \]

Statement II: When branching increases, the molecule attains a shape of a sphere. This results in a smaller surface area for contact, reducing intermolecular forces and lowering the boiling point.

  • (1) Both statements are incorrect
  • (2) Statement I is correct but Statement II is incorrect
  • (3) Statement I is incorrect but Statement II is correct
  • (4) Both statements are correct
Correct Answer: (4)
View Solution

N/A Quick Tip: \textbf{Boiling Point and Branching:} - More branching → Lower boiling point.
- Less branching (linear chain) → Higher boiling point.


Question 72:

In which of the following equilibria, \( K_p \) and \( K_c \) are NOT equal?

  • (1) \( H_2(g) + I_2(g) \rightleftharpoons 2HI(g) \)
  • (2) \( CO(g) + H_2O(g) \rightleftharpoons CO_2(g) + H_2(g) \)
  • (3) \( BrCl(g) \rightleftharpoons Br_2(g) + Cl_2(g) \)
  • (4) \( PCl_5(g) \rightleftharpoons PCl_3(g) + Cl_2(g) \)
Correct Answer: (4)
View Solution

N/A Quick Tip: \textbf{When \( K_p = K_c \) holds true:} - If \( \Delta n = 0 \), then \( K_p = K_c \).
- If \( \Delta n \neq 0 \), then \( K_p \neq K_c \).


Question 73:

The reagents with which glucose does not react to give the corresponding tests/products are

A. Tollen’s reagent

B. Schiff’s reagent

C. HCN

D. NH2OH

E. NaHSO3

  • (1) A and D
  • (2) B and E
  • (3) E and D
  • (4) B and C
Correct Answer: (2) B and E
View Solution

- Tollen’s reagent reacts with glucose because glucose is an aldehyde and can undergo oxidation.

- Schiff’s reagent reacts with aldehydes, and glucose being an aldehyde also reacts with it.

- HCN does not react with glucose under normal conditions, so it is not involved in the corresponding test.

- NH2OH (hydroxylamine) does not react with glucose in the same way it reacts with reducing sugars, so it is not part of the expected tests.

- NaHSO3 reacts with glucose as it is a reducing sugar, hence it is part of the corresponding test.

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{Glucose reacts with Tollen’s and Schiff’s reagents, but does not react with HCN and NH2OH under standard conditions.}


Question 74:

Match List I with List II.

List I (Compound) & List II (Shape/Geometry)
A. NH3 & I. Trigonal Pyramidal
B. BrF5 & II. Square Planar
C. XeF4 & III. Octahedral
D. SF6 & IV. Square Pyramidal

 

  • (1) A-II, B-IV, C-III, D-I
  • (2) A-III, B-IV, C-I, D-II
  • (3) A-II, B-III, C-IV, D-I
  • (4) A-I, B-IV, C-II, D-III
Correct Answer: (4)
View Solution

N/A Quick Tip: Remember to use VSEPR theory to predict molecular geometry.


Question 75:

Among Group 16 elements, which one does NOT show \(-2\) oxidation state?

  • (1) Se
  • (2) Te
  • (3) Po
  • (4) O
Correct Answer: (3) Po
View Solution

N/A Quick Tip: Polonium behaves more like a metal, limiting its ability to adopt a \(-2\) oxidation state.


Question 76:

Match List I with List II.

  • (1) A-III, B-I, C-II, D-IV
  • (2) A-IV, B-I, C-II, D-III
  • (3) A-I, B-IV, C-II, D-III
  • (4) A-IV, B-I, C-III, D-II
Correct Answer: (3)
View Solution

N/A Quick Tip: Identify characteristic reagents for specific types of organic transformations.


Question 77:

Arrange the following elements in increasing order of electronegativity: \[ N, O, F, C, Si \]

Choose the correct answer from the options given below:

  • (1) Si \(<\) C \(<\) O \(<\) N \(<\) F
  • (2) O \(<\) F \(<\) N \(<\) C \(<\) Si
  • (3) F \(<\) O \(<\) N \(<\) C \(<\) Si
  • (4) Si \(<\) C \(<\) N \(<\) O \(<\) F
Correct Answer: (4)
View Solution

N/A Quick Tip: \textbf{Electronegativity Rule:} - Fluorine is the most electronegative element.
- Moving across a period, electronegativity increases.
- Moving down a group, electronegativity decreases.


Question 78:

Intramolecular hydrogen bonding is present in:

Correct Answer: (2)
View Solution

Step 1: Understanding Hydrogen Bonding

- Intramolecular hydrogen bonding occurs when hydrogen bonding takes place within the same molecule.

- It is commonly seen in ortho-hydroxy benzene derivatives, diketones, and compounds containing adjacent donor-acceptor groups.

Step 2: Identifying Intramolecular Hydrogen Bonding

- HF has strong intermolecular hydrogen bonding, not intramolecular.

- The correct compound in option (2) has intramolecular hydrogen bonding.

Conclusion: The correct answer is (2). Quick Tip: \textbf{Intramolecular vs Intermolecular Hydrogen Bonding:} - Intramolecular: Hydrogen bonding within the same molecule. - Intermolecular: Hydrogen bonding between different molecules.


Question 79:

Identify the correct reagents that would bring about the following transformation.

  • (1) (i) \( BH_3 \)
     (ii) \( H_2O_2/ OH^- \)
     (iii) PCC
  • (2) (i) \( BH_3 \)
     (ii) \( H_2O_2/ OH^- \)
     (iii) alk. \( KMnO_4 \)
     (iv) \( H_3O^+ \)
  • (3) (i) \( H_2O/H^+ \)
     (ii) PCC
  • (4) (i) \( H_2O/H^+ \)
     (ii) \( CrO_3 \)
Correct Answer: (1)
View Solution

Step 1: Understanding the Reaction Sequence

- Step 2: Hydroboration-Oxidation (\( BH_3 \) followed by \( H_2O_2/ OH^- \)) converts an alkene to an anti-Markovnikov alcohol.

- Step 3: PCC (Pyridinium chlorochromate) oxidizes the primary alcohol to an aldehyde.

Conclusion: The correct answer is (1). Quick Tip: \textbf{Hydroboration-Oxidation:} - Converts alkene to primary alcohol (anti-Markovnikov).
- PCC selectively oxidizes alcohols to aldehydes without further oxidation to carboxylic acids.


Question 80:

Match List I with List II.
List I (Conversion)} & List II (Number of Faraday required)}
 A. 1 mol of H_2O to O_2 & I. 3F
B. 1 mol of MnO_4^- to Mn^{2+} & II. 2F
C. 1.5 mol of Ca from molten CaCl_2 & III. 1F
D. 1 mol of FeO to Fe_2O_3 & IV. 5F

Choose the correct answer from the options given below:

  • (1) A-III, B-IV, C-I, D-II
  • (2) A-II, B-III, C-I, D-IV
  • (3) A-III, B-IV, C-II, D-I
  • (4) A-II, B-IV, C-I, D-III
Correct Answer: (3) A-III, B-IV, C-II, D-I
View Solution

Step 1: Understanding Faraday’s Law
\[ Moles of electrons required = Faraday's constant \times number of moles \]

- (A) Water oxidation to O\(_2\) (H\(_2\)O \(\to\) O\(_2\)):
\(2H_2O \to O_2 + 4H^+ + 4e^-\)
\(\Rightarrow\) 2 Faraday per mole of \(O_2\)
A → III

- (B) MnO\(_4^-\) to Mn\(^{2+}\):
\(MnO_4^- + 8H^+ + 5e^- \to Mn^{2+} + 4H_2O\)
\(\Rightarrow\) 5 Faraday per mole
B → IV

- (C) Ca from molten CaCl\(_2\) (1.5 mol):
\(Ca^{2+} + 2e^- \to Ca\)
1 mol needs 2 Faraday, so 1.5 mol needs 3 Faraday
C → II

- (D) FeO to Fe\(_2\)O\(_3\):
1 Faraday per mole
D → I

Conclusion: The correct answer is (3). Quick Tip: \textbf{Faraday’s Law in Electrochemistry:}
- 1 Faraday \(= 96,485\) C/mole of electrons.
- Oxidation states help determine required electron transfer.


Question 81:

Given below are two statements:

Statement I: The boiling point of hydrides of Group 16 elements follow the order: \[ H_2O > H_2Te > H_2Se > H_2S. \]

Statement II: On the basis of molecular mass, \( H_2O \) is expected to have a lower boiling point than the other members of the group, but due to the presence of extensive hydrogen bonding in \( H_2O \), it has a higher boiling point.

Choose the correct answer from the options given below:

  • (1) Both Statement I and Statement II are false
  • (2) Statement I is true but Statement II is false
  • (3) Statement I is false but Statement II is true
  • (4) Both Statement I and Statement II are true
Correct Answer: (1) Both Statement I and Statement II are false
View Solution

Step 1: Understanding Boiling Point Trends in Group 16 Hydrides

- General Trend: Boiling points usually increase down a group due to increasing molecular mass and van der Waals forces.

- Exception: Water (\( H_2O \)) has an unusually high boiling point due to strong hydrogen bonding.

Step 2: Comparison of Molecular Mass and Hydrogen Bonding
\[ H_2O \gg H_2Te > H_2Se > H_2S \]

Conclusion: Both statements are true, so the correct answer is (1). Quick Tip: \textbf{Boiling Point Trends:}
- Water has the highest boiling point among Group 16 hydrides due to strong hydrogen bonding.
- Other hydrides follow mass-based trends with increasing van der Waals forces.


Question 82:

Given below are two statements:

Statement I: Both \( [Co(NH_3)_6]^{3+} \) and \( [CoF_6]^{3-} \) complexes are octahedral but differ in their magnetic behavior.

Statement II: \( [Co(NH_3)_6]^{3+} \) is diamagnetic, whereas \( [CoF_6]^{3-} \) is paramagnetic.

Choose the correct answer from the options given below:

  • (1) Both Statement I and Statement II are false
  • (2) Statement I is true but Statement II is false
  • (3) Statement I is false but Statement II is true
  • (4) Both Statement I and Statement II are true
Correct Answer: (3) Statement I is false but Statement II is true
View Solution

Understanding Coordination Complexes :

- \( [Co(NH_3)_6]^{3+} \): \( NH_3 \) is a strong field ligand, leading to low-spin d^6 configuration in Co\(^{3+}\), which is diamagnetic.

- \( [CoF_6]^{3-} \): \( F^- \) is a weak field ligand, leading to high-spin d^6 configuration, which is paramagnetic.

Conclusion: Both statements are true, so the correct answer is (3). Quick Tip: \textbf{Ligand Field Theory:} - Strong field ligands (NH\(_3\), CN\(^-\)) lead to low-spin configurations (diamagnetic).
- Weak field ligands (F\(^-\), Cl\(^-\)) lead to high-spin configurations (paramagnetic).


Question 83:

Which one of the following alcohols reacts instantaneously with Lucas reagent?

Correct Answer: (4)
View Solution

N/A Quick Tip: \textbf{Lucas Test for Alcohols:}
- Tertiary alcohols → Instant reaction (cloudy solution).
- Secondary alcohols → Slow reaction. - Primary alcohols → No visible reaction.


Question 84:

Match List I with List II.
List I (Process)} & List II (Conditions)}
A. Isothermal process & I. No heat exchange
B. Isochoric process & II. Carried out at constant temperature
C. Isobaric process & III. Carried out at constant volume
D. Adiabatic process & IV. Carried out at constant pressure

 

  • (1) A-IV, B-II, C-III, D-I
  • (2) A-I, B-II, C-III, D-IV
  • (3) A-II, B-III, C-IV, D-I
  • (4) A-IV, B-III, C-II, D-I
Correct Answer: (3)
View Solution

Understanding Thermodynamic Processes

- Isothermal Process: \( \Delta T = 0 \), so it occurs at constant temperature.

- Isochoric Process: \( \Delta V = 0 \), so it occurs at constant volume.

- Isobaric Process: \( \Delta P = 0 \), so it occurs at constant pressure.

- Adiabatic Process: No heat exchange (\( Q = 0 \)).

Conclusion: The correct answer is (3). Quick Tip: \textbf{Thermodynamic Processes:}
- Isothermal: \( T = constant \)
- Isochoric: \( V = constant \)
- Isobaric: \( P = constant \)
- Adiabatic: \( Q = 0 \) (no heat exchange)


Question 85:

On heating, some solid substances change from solid to vapour state without passing through the liquid state.
The technique used for the purification of such solid substances based on the above principle is known as:

  • (1) Sublimation
  • (2) Distillation
  • (3) Chromatography
  • (4) Crystallization
Correct Answer: (2) Distillation
View Solution

N/A Quick Tip: Sublimation is an effective technique for purifying solids that sublimate upon heating.


Question 86:

The products A and B obtained in the following reactions, respectively, are \[ 3ROH + PCl_3 \rightarrow 3RCl + A \] \[ ROH + PCl_5 \rightarrow RCl + HCl + B \]

  • (1) POCl\(_3\) and H\(_3\)PO\(_4\)
  • (2) H\(_3\)PO\(_4\) and POCl\(_3\)
  • (3) H\(_3\)PO\(_3\) and POCl\(_3\)
  • (4) POCl\(_3\) and H\(_3\)PO\(_3\)
Correct Answer: (4) POCl\(_3\) and H\(_3\)PO\(_3\)
View Solution

- In the reaction with phosphorus trichloride (PCl\(_3\)), phosphorous acid (H\(_3\)PO\(_3\)) is formed as product A.

- In the reaction with phosphorus pentachloride (PCl\(_5\)), phosphoryl chloride (POCl\(_3\)) is produced as product B.

- Thus, the correct answer is (4) POCl\(_3\) and H\(_3\)PO\(_3\) . Quick Tip: Phosphorus trichloride forms H\(_3\)PO\(_3\) (phosphorous acid), while phosphorus pentachloride forms POCl\(_3\) (phosphoryl chloride).


Question 87:

Mass in grams of copper deposited by passing 9.6487 A current through a voltmeter containing copper sulfate solution for 100 seconds is (Given: Molar mass of Cu: 63 g/mol, 1 F = 96487 C)

  • (1) 0.315 g
  • (2) 31.5 g
  • (3) 0.0315 g
  • (4) 3.15 g
Correct Answer: (3) 0.0315 g
View Solution

- According to Faraday's first law, mass deposited is given by:
\[ m = \frac{I \times t \times M}{n \times F} \]
where \(I = 9.6487 \, A, \, t = 100 \, seconds, \, M = 63 \, g/mol, \, n = 2, \, F = 96487 \, C/mol\)
- Substituting the values:
\[ m = \frac{9.6487 \times 100 \times 63}{2 \times 96487} \approx 0.0315 \, g \] Quick Tip: Faraday's laws relate current, time, and molar mass for electroplating calculations.


Question 88:

Consider the following reaction in a sealed vessel at equilibrium with concentrations of
N\(_2\) = 3.0 \(\times\) 10\(^{-3}\) M, O\(_2\) = 4.2 \(\times\) 10\(^{-3}\) M, and NO = 2.8 \(\times\) 10\(^{-3}\) M. \[ 2NO(g) \leftrightarrow N_2(g) + O_2(g) \]
If 0.1 mol/L of NO(g) is taken in a closed vessel, what will be the degree of dissociation (\(\alpha\)) of NO(g) at equilibrium?

  • (1) 0.0889
  • (2) 0.8889
  • (3) 0.717
  • (4) 0.00889
Correct Answer: (3) 0.717
View Solution

- The equilibrium concentration of NO is 2.8 \(\times\) 10\(^{-3}\) M.

- Given initial concentration of NO is 0.1 M.

- Degree of dissociation \(\alpha\) is calculated as:
\[ \alpha = \frac{Initial concentration - Equilibrium concentration}{Initial concentration} \]
\[ \alpha = \frac{0.1 - 2.8 \times 10^{-3}}{0.1} \approx 0.717 \] Quick Tip: The degree of dissociation can be calculated by comparing initial and equilibrium concentrations of reactants.


Question 89:

Given below are two statements:

Statement I: [Co(NH\(_3\))\(_6\)]\(^{3+}\) is a homoleptic complex whereas [Co(NH\(_3\))\(_4\)Cl\(_2\)]\(^{+}\) is a heteroleptic complex.

Statement II: Complex [Co(NH\(_3\))\(_6\)]\(^{3+}\) has only one kind of ligands but [Co(NH\(_3\))\(_4\)Cl\(_2\)]\(^{+}\) has more than one kind of ligands.

In the light of the above statements, choose the correct answer from the options given below.

  • (1) Both Statement I and Statement II are false
  • (2) Statement I is true but Statement II is false
  • (3) Statement I is false but Statement II is true
  • (4) Both Statement I and Statement II are true
Correct Answer: (4) Both Statement I and Statement II are true
View Solution

- [Co(NH\(_3\))\(_6\)]\(^{3+}\) contains only NH\(_3\) ligands and is therefore a homoleptic complex.

- [Co(NH\(_3\))\(_4\)Cl\(_2\)]\(^{+}\) contains both NH\(_3\) and Cl\(^-\) ligands and is heteroleptic.
- Both statements are correct. Quick Tip: A homoleptic complex has only one type of ligand, while a heteroleptic complex has multiple types of ligands.


Question 90:

Identify the major product C formed in the following reaction sequence:

  • (1) Butylamine
  • (2) Butanamide
  • (3) \(\alpha\)–Bromobutanoic acid
  • (4) Propylamine
Correct Answer: (1) Butylamine
View Solution

- The first step involves nucleophilic substitution of iodine by CN\(^-\) to form propyl cyanide (A).

- Partial hydrolysis of propyl cyanide forms propionamide (B).

- Further treatment with Br\(_2\)/NaOH gives propylamine (C) via the Hoffmann bromamide degradation reaction. Quick Tip: The Butylamine degradation reaction converts amides to primary amines by loss of a carbon atom.


Question 91:

The pair of lanthanoid ions which are diamagnetic is:

  • (1) Ce\(^{3+}\) and Eu\(^{2+}\)
  • (2) Gd\(^{3+}\) and Eu\(^{3+}\)
  • (3) Pm\(^{3+}\) and Sm\(^{3+}\)
  • (4) Ce\(^{4+}\) and Yb\(^{2+}\)
Correct Answer: (4) Ce\(^{4+}\) and Yb\(^{2+}\)
View Solution

- A diamagnetic substance has all electrons paired, meaning no unpaired electrons are present.

- Ce\(^{4+}\) has an empty 4f orbital (no unpaired electrons).

- Yb\(^{2+}\) has a fully filled 4f orbital (all electrons are paired).

- Thus, Ce\(^{4+}\) and Yb\(^{2+}\) are diamagnetic. Quick Tip: Diamagnetic species have all their electrons paired, leading to no net magnetic moment.


Question 92:

For the given reaction:




Correct Answer: (3)
View Solution

- The correct reaction mechanism supports the formation of Compound 1 based on reactivity and stability considerations. Quick Tip: Understand the conditions for chemical transformations when identifying products.


Question 93:

A compound X contains 32% of A, 20% of B, and the remaining percentage of C. Then, the empirical formula of X is:
(Given atomic masses of A = 64; B = 40; C = 32 u)

  • (1) ABC\(_3\)
  • (2) AB\(_2\)C\(_2\)
  • (3) ABC\(_4\)
  • (4) A\(_2\)BC\(_2\)
Correct Answer: (1) ABC\(_3\)
View Solution

- Calculating the moles of each element:
\[ Moles of A = \frac{32}{64} = 0.5 \]
\[ Moles of B = \frac{20}{40} = 0.5 \]
\[ Moles of C = \frac{48}{32} = 1.5 \]
- The simplest whole number ratio is A:B:C = 1:1:3.
- Hence, the empirical formula is ABC\(_3\). Quick Tip: Divide by the smallest number of moles to get the simplest whole-number ratio for the empirical formula.


Question 94:

Given below are certain cations. Using inorganic qualitative analysis, arrange them in increasing group number from 0 to VI.

A. Al\(^{3+}\)

B. Cu\(^{2+}\)

C. Ba\(^{2+}\)

D. Co\(^{2+}\)

E. Mg\(^{2+}\)


Choose the correct answer from the options given below:

  • (1) B, C, A, D, E
  • (2) E, C, D, B, A
  • (3) E, A, B, C, D
  • (4) B, A, D, C, E
Correct Answer: (4) B, A, D, C, E
View Solution

- Based on qualitative group analysis for cations, the correct order is B, A, D, C, E, corresponding to increasing group numbers. Quick Tip: Remember the cation classification based on their precipitation and group properties.


Question 95:

The work done during reversible isothermal expansion of one mole of hydrogen gas at 25°C from a pressure of 20 atmosphere to 10 atmosphere is (Given \(R = 2.0\) cal K\(^{-1}\) mol\(^{-1}\))

  • (1) –413.14 calories
  • (2) 413.14 calories
  • (3) 100 calories
  • (4) 0 calorie
Correct Answer: (3) 100 calories
View Solution

- The formula for work done in isothermal expansion is:
\[ W = -nRT \ln \frac{P_2}{P_1} \]
Substituting the values:
\[ W = -1 \times 2 \times (273 + 25) \times \ln \frac{10}{20} \]
\[ W \approx 100 \, calories \] Quick Tip: In reversible isothermal expansion, work done is related to the natural logarithm of the pressure ratio.


Question 96:

Major products A and B formed in the following reaction sequence, are:

Correct Answer: (4)
View Solution

- The reaction mechanism supports the formation of products A and B

corresponding to Compound 4 based on reactivity and stability considerations. Quick Tip: Identify key intermediates and functional groups when predicting products in multi-step reactions.


Question 97:

The rate of a reaction quadruples when the temperature changes from 27°C to 57°C. Calculate the energy of activation.

(Given \(R = 8.314\) J K\(^{-1}\) mol\(^{-1}\), \(\log 4 = 0.6021\))

  • (1) 380.4 kJ/mol
  • (2) 3.80 kJ/mol
  • (3) 3804 kJ/mol
  • (4) 38.04 kJ/mol
Correct Answer: (4) 38.04 kJ/mol
View Solution

Using the Arrhenius equation: \[ \ln \frac{k_2}{k_1} = \frac{E_a}{R} \left(\frac{T_2 - T_1}{T_1 T_2}\right) \]
Given \(k_2/k_1 = 4\), \(T_1 = 300\) K, \(T_2 = 330\) K, \(R = 8.314\) J K\(^{-1}\) mol\(^{-1}\): \[ \ln 4 = \frac{E_a}{8.314} \times \left(\frac{330 - 300}{300 \times 330}\right) \]
Substituting the values and solving gives: \[ E_a \approx 38.04 \, kJ/mol \] Quick Tip: Higher activation energies lead to more significant temperature effects on reaction rates.


Question 98:

During the preparation of Mohr’s salt solution (Ferrous ammonium sulphate), which of the following acids is added to prevent hydrolysis of Fe\(^{2+}\) ion?

  • (1) Concentrated sulphuric acid
  • (2) Dilute nitric acid
  • (3) Dilute sulphuric acid
  • (4) Dilute hydrochloric acid
Correct Answer: (4) Dilute hydrochloric acid
View Solution

- Dilute hydrochloric acid is added to maintain an acidic medium, preventing the oxidation of Fe\(^{2+}\) to Fe\(^{3+}\) and hydrolysis.

- This ensures the stability of the Mohr’s salt solution. Quick Tip: Mohr's salt is stable only in an acidic environment; hydrochloric acid prevents hydrolysis and oxidation.


Question 99:

The plot of osmotic pressure (\(\Pi\)) vs concentration (mol L\(^{-1}\)) for a solution gives a straight line with slope 25.73 L bar mol\(^{-1}\). The temperature at which the osmotic pressure measurement is done is:

(Use \(R = 0.083\) L bar mol\(^{-1}\) K\(^{-1}\))

  • (1) 310°C
  • (2) 25.73°C
  • (3) 12.05°C
  • (4) 37°C
Correct Answer: (4) 37°C
View Solution

The formula for osmotic pressure is: \[ \Pi = CRT \]
Given slope (\(C \times R \times T\)) = 25.73 L bar mol\(^{-1}\), \(R = 0.083\) L bar mol\(^{-1}\) K\(^{-1}\): \[ T = \frac{25.73}{0.083} \approx 37 \] Quick Tip: Osmotic pressure measurements can be used to determine molecular weights and temperature effects in solutions.


Question 100:

Identify the correct answer.

  • (1) BF\(_3\) has a non-zero dipole moment
  • (2) Dipole moment of NF\(_3\) is greater than that of NH\(_3\)
  • (3) Three canonical forms can be drawn for CO\(_3^{2-}\) ion
  • (4) Three resonance structures can be drawn for ozone
Correct Answer: (1) BF\(_3\) has a non-zero dipole moment
View Solution

- BF\(_3\) has a non-zero dipole moment exhibits resonance, and three equivalent canonical forms can be drawn for it.

- These structures involve the delocalization of electrons over the three oxygen atoms. Quick Tip: Resonance structures stabilize molecules by delocalizing electron density.


Question 101:

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and downstream end;

  • (1) Structural gene, Transposons, Operator gene
  • (2) Inducer, Repressor, Structural gene
  • (3) Promotor, Structural gene, Terminator
  • (4) Repressor, Operator gene, Structural gene
Correct Answer: (1) Structural gene, Transposons, Operator gene
View Solution

Explanation of a Transcription Unit

- A transcription unit consists of three key regions: the promoter, the structural gene, and the terminator.

- The promoter is a DNA sequence that signals the beginning of transcription.

- The structural gene codes for the protein.

- The terminator indicates the end of transcription.

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{The transcription unit involves regions that initiate, encode, and terminate the process of transcription.}


Question 102:

Identify the set of correct statements:

A. The flowers of Vallisneria are colourful and produce nectar.

B. The flowers of water lily are not pollinated by water.

C. In most of water-pollinated species, the pollen grains are protected from wetting.

D. Pollen grains of some hydrophytes are long and ribbon like.

E. In some hydrophytes, the pollen grains are carried passively inside water.

  • (1) A, B, C and D only
  • (2) A, C, D and E only
  • (3) B, C, D and E only
  • (4) C, D and E only
Correct Answer: (3) B, C, D and E only
View Solution

Explanation of the Statements

- A is incorrect because the flowers of Vallisneria are not colourful and do not produce nectar, as they are wind-pollinated.

- B is correct as water lily flowers are pollinated by insects, not by water.

- C is correct because most water-pollinated species have pollen grains that are protected from wetting by waxy coatings.

- D is correct as some hydrophytic pollen grains are long and ribbon-like to facilitate water transport.

- E is correct because some hydrophytes, like sea grasses, have pollen that is carried passively by water currents.

Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: \textbf{In water-pollinated plants, pollen grains often have adaptations to prevent wetting and help in passive transport.}


Question 103:

Lecithin, a small molecular weight organic compound found in living tissues, is an example of:

  • (1) Phospholipids
  • (2) Glycerides
  • (3) Carbohydrates
  • (4) Amino acids
Correct Answer: (2) Glycerides
View Solution

Explanation of (2) Glycerides

- Glycerides is a type of phospholipid, which is a major component of cell membranes.

- It consists of glycerol, two fatty acids, phosphate, and a choline group.

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{Phospholipids, such as lecithin, are essential components of cellular membranes, playing a key role in membrane structure and function.}


Question 104:

These are regarded as major causes of biodiversity loss:

A. Over exploitation

B. Co-extinction

C. Mutation

D. Habitat loss and fragmentation

E. Migration

Choose the correct answer from the options given below:

  • (1) A, B, C and D only
  • (2) A, B and E only
  • (3) A, B and D only
  • (4) A, C and D only
Correct Answer: (1) A, B, C and D only
View Solution

Explanation of Major Causes of Biodiversity Loss

- A Over-exploitation, such as overfishing and illegal hunting, is a major cause of biodiversity loss.

- B Co-extinction occurs when one species goes extinct due to the extinction of another species on which it depends.

- C Mutation does not directly lead to biodiversity loss; instead, it is a part of evolution.

- D Habitat loss and fragmentation are critical factors causing the decline in biodiversity.

- E Migration, although it may alter species distributions, does not directly cause biodiversity loss.

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{Habitat loss and over-exploitation are among the leading causes of biodiversity decline, along with co-extinction.}


Question 105:

Match List I with List II
 List I & List II
A. Clostridium butylicum & I. Ethanol
B. Saccharomyces cerevisiae & II. Streptokinase
C. Trichoderma polysporum & III. Butyric acid
D. Streptococcus sp. & IV. Cyclosporin-A

Choose the correct answer from the options given below:

  • (1) A-II, B-IV, C-III, D-I
  • (2) A-III, B-I, C-IV, D-II
  • (3) A-IV, B-I, C-III, D-II
  • (4) A-III, B-I, C-II, D-IV
Correct Answer: (4) A-III, B-I, C-II, D-IV
View Solution

Explanation of the Match:

- A. Clostridium butylicum produces Butyric acid (III).

- B. Saccharomyces cerevisiae produces Ethanol (I).

- C. Trichoderma polysporum produces Cyclosporin-A (II).

- D. Streptococcus sp. produces Streptokinase (IV).

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: \textbf{Microorganisms are used to produce a variety of industrial products like ethanol, butyric acid, and pharmaceuticals like Cyclosporin-A.}


Question 106:

Match List I with List II
 List-I & List-II
 A. Rhizopus & I. Bread mould
B. Ustilago & II. Smut fungus
C. Puccinia & III. Rust fungus
D. Agaricus & IV. Mushroom

Choose the correct answer from the options given below:

  • (1) A-I, B-III, C-II, D-IV
  • (2) A-III, B-II, C-I, D-IV
  • (3) A-IV, B-III, C-II, D-I
  • (4) A-III, B-II, C-IV, D-I
Correct Answer: (3) A-IV, B-III, C-II, D-I
View Solution

Explanation of the Match:

- A. Rhizopus is a bread mould (IV).

- B. Ustilago is a smut fungus (III).

- C. Puccinia is a rust fungus (II).

- D. Agaricus is a mushroom (I).


Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: \textbf{Fungi play significant roles in ecology, agriculture, and the food industry, ranging from bread moulds to mushrooms.}


Question 107:

The lactose present in the growth medium of bacteria is transported to the cell by the action of

  • (1) Acetylase
  • (2) Permease
  • (3) Polymerase
  • (4) Beta-galactosidase
Correct Answer: (2) Permease
View Solution

Explanation of Permease's Role in Lactose Transport

- Permease is a membrane protein that facilitates the transport of lactose into bacterial cells for metabolism.

- Beta-galactosidase breaks down lactose once it has entered the cell, but it does not transport it.

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{Permease is essential for the active transport of lactose across bacterial cell membranes.}


Question 108:

List of endangered species was released by

  • (1) WWF
  • (2) FOAM
  • (3) IUCN
  • (4) GEAC
Correct Answer: (1) WWF
View Solution

Explanation of WWFs Role in Endangered Species Lists

- WWF publishes the Red List which provides the status of endangered species.

- The list is a comprehensive inventory of the global conservation status of plant and animal species.

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{The IUCN Red List is a key resource for monitoring the extinction risk of species worldwide.}


Question 109:

How many molecules of ATP and NADPH are required for every molecule of CO\(_2\) fixed in the Calvin cycle?

  • (1) 2 molecules of ATP and 2 molecules of NADPH
  • (2) 3 molecules of ATP and 3 molecules of NADPH
  • (3) 3 molecules of ATP and 2 molecules of NADPH
  • (4) 2 molecules of ATP and 3 molecules of NADPH
Correct Answer: (2) 3 molecules of ATP and 3 molecules of NADPH
View Solution

- The Calvin cycle uses 3 molecules of ATP and 3 molecules of NADPH for the fixation of one CO\(_2\) molecule during the reduction and regeneration phases. Quick Tip: ATP is required for phosphorylation, while NADPH is used for reducing 3-phosphoglycerate to glyceraldehyde-3-phosphate (G3P).


Question 110:

The equation of Verhulst-Pearl logistic growth is: \[ \frac{dN}{dt} = rN \left( \frac{K - N}{K} \right) \]
From this equation, \(K\) indicates:

  • (1) Biotic potential
  • (2) Carrying capacity
  • (3) Population density
  • (4) Intrinsic rate of natural increase
Correct Answer: (4) Intrinsic rate of natural increase
View Solution

- The carrying capacity (\(K\)) is the maximum population size that an environment can sustain indefinitely given the available resources. Quick Tip: The logistic growth model shows population growth slowing as it approaches the carrying capacity.


Question 111:

Bulliform cells are responsible for:

  • (1) Protecting the plant from salt stress
  • (2) Increased photosynthesis in monocots
  • (3) Providing large spaces for storage of sugars
  • (4) Inward curling of leaves in monocots
Correct Answer: (3) Providing large spaces for storage of sugars
View Solution

- Bulliform cells are large, thin-walled cells present on the upper surface of monocot leaves.

- They help in reducing water loss by causing inward curling of leaves during water stress. Quick Tip: Bulliform cells play a crucial role in water conservation in grasses.


Question 112:

Which one of the following is not a criterion for the classification of fungi?

  • (1) Mode of nutrition
  • (2) Mode of spore formation
  • (3) Fruiting body
  • (4) Morphology of mycelium
Correct Answer: (4) Morphology of mycelium
View Solution

- Fungi are classified based on their mode of spore formation, fruiting body type, and morphology of mycelium.

- Mode of nutrition is not a primary classification criterion. Quick Tip: Fungi are heterotrophic by nature, feeding on dead organic matter (saprophytic) or living hosts (parasitic).


Question 113:

Tropical regions show the greatest level of species richness because:

A. Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was available for species diversification.

B. Tropical environments are more seasonal.

C. More solar energy is available in tropics.

D. Constant environments promote niche specialization.

E. Tropical environments are constant and predictable.


Choose the correct answer from the options given below:

  • (1) A and B only
  • (2) A, B and E only
  • (3) A, B and D only
  • (4) A, C, D and E only
Correct Answer: (2) A, B and E only
View Solution

- Tropical regions have remained relatively undisturbed for long periods, promoting diversification.

- More solar energy is available, leading to higher productivity.

- The stable and predictable environments encourage niche specialization and biodiversity. Quick Tip: Species richness tends to be highest in tropical regions due to long-term environmental stability and abundant energy resources.


Question 114:

Which of the following is an example of actinomorphic flower?

  • (1) Cassia
  • (2) Pisum
  • (3) Sesbania
  • (4) Datura
Correct Answer: (4) Datura
View Solution

Explanation of Actinomorphic Flowers

- Actinomorphic flowers are radially symmetrical, meaning they can be divided into equal halves by multiple planes passing through the center.

- Datura is an example of an actinomorphic flower, having radial symmetry.

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: \textbf{Actinomorphic flowers have radial symmetry and can be divided into two equal halves by multiple planes.}


Question 115:

Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the given figures (a) and (b)

  • (1) (a) Hypogynous; (b) Epigynous
  • (2) (a) Perigynous; (b) Epigynous
  • (3) (a) Perigynous; (b) Perigynous
  • (4) (a) Epigynous; (b) Hypogynous
Correct Answer: (1) (a) Hypogynous; (b) Epigynous
View Solution

Floral Position Types

- Hypogynous flowers have the ovary situated below the other floral parts (e.g., calyx, corolla, and androecium).

- Epigynous flowers have the ovary situated above the other floral parts.

- Perigynous flowers have the ovary in the middle with other parts situated around it, forming a hypanthium.

- In this case, both (a) and (b) represent Perigynous flowers.

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{Perigynous flowers have the ovary in the middle, surrounded by other floral parts.}


Question 116:

Match List I with List II
 List-I & List-II
A. Nucleolus & III. Site for active ribosomal RNA synthesis
B. Centriole & II. Organization like the cartwheel
C. Leucoplasts & IV. For storing nutrients
D. Golgi apparatus & I. Site of formation of glycolipid

Choose the correct answer from the options given below:

  • (1) A-II, B-III, C-I, D-IV
  • (2) A-III, B-IV, C-II, D-I
  • (3) A-I, B-II, C-III, D-IV
  • (4) A-III, B-II, C-IV, D-I
Correct Answer: (2) A-III, B-IV, C-II, D-I
View Solution

Explanation of the Match:

- A. Nucleolus is the site for active ribosomal RNA synthesis (III).

- B. Centriole has an organization resembling a cartwheel (IV).

- C. Leucoplasts are involved in storing nutrients (II).

- D. Golgi apparatus is the site for the formation of glycolipids (I).

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{The nucleolus plays a key role in the synthesis of ribosomal RNA, while the Golgi apparatus is involved in lipid formation.}


Question 117:

What is the fate of a piece of DNA carrying only gene of interest which is transferred into an alien organism?

A. The piece of DNA would be able to multiply itself independently in the progeny cells of the organism.

B. It may get integrated into the genome of the recipient.

C. It may multiply and be inherited along with the host DNA.

D. The alien piece of DNA is not an integral part of chromosome.

E. It shows ability to replicate.

Choose the correct answer from the options given below:

  • (1) D and E only
  • (2) B and C only
  • (3) A and E only
  • (4) A and B only
Correct Answer: (1) D and E only
View Solution

Explanation of DNA Transfer Fate

- B The DNA may integrate into the genome of the recipient organism, becoming a permanent part of its genetic material.
- C The DNA may multiply in the host and be inherited along with the host DNA, especially if it is integrated into the host's chromosomes.

- A is incorrect because it refers to autonomous replication, which is more common for plasmids or vectors rather than isolated DNA.

- D and E refer to conditions that may be true but are less specific regarding how the gene of interest is handled in the recipient organism.

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{When a foreign DNA is introduced into an organism, it can either integrate into the host genome or replicate independently, depending on the conditions and the nature of the DNA.}


Question 118:

Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:

  • (1) 6 bp
  • (2) 4 bp
  • (3) 10 bp
  • (4) 8 bp
Correct Answer: (2) 4 bp
View Solution

Explanation of Hind II Recognition Sequence

- Hind II is a restriction enzyme that recognizes a specific 4 base pair (bp) sequence and cuts DNA at this site.

- This specific sequence is known as the recognition sequence, and Hind II cuts at the sequence, typically between specific bases.

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{Restriction enzymes like Hind II recognize specific sequences of base pairs in DNA and cut at these points to facilitate genetic manipulation.}


Question 119:

The cofactor of the enzyme carboxypeptidase is:

  • (1) Niacin
  • (2) Flavin
  • (3) Haem
  • (4) Zinc
Correct Answer: (2) Flavin
View Solution

Explanation of Carboxypeptidase Cofactor

- Carboxypeptidase is an enzyme that requires zinc as a cofactor to perform its catalytic function in the breakdown of peptides by removing terminal amino acids.

- (2) Flavin acts as a metal cofactor in the enzyme's active site to facilitate the reaction. Quick Tip: \textbf{ Flavin is an essential metal cofactor for carboxypeptidase, aiding in its enzymatic activity in peptide hydrolysis.}


Question 120:

Which of the following are required for the dark reaction of photosynthesis?

A. Light

B. Chlorophyll

C. CO2

D. ATP

E. NADPH

  • (1) B, C and D only
  • (2) C, D and E only
  • (3) D and E only
  • (4) A, B and C only
Correct Answer: (4) A, B and C only
View Solution

Explanation of the Dark Reaction Requirements

- The dark reaction (or Calvin cycle) of photosynthesis does not require light directly but utilizes ATP and NADPH produced during the light reaction.

- CO2 is also required as the carbon source for the synthesis of glucose.

- Light and chlorophyll are involved in the light-dependent reactions and are not required directly in the dark reaction.

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: \textbf{The dark reactions of photosynthesis require ATP, NADPH, and CO2 but not light or chlorophyll.}


Question 121:

The type of conservation in which the threatened species are taken out from their natural habitat and placed in special settings where they can be protected and given special care is called:

  • (1) Biodiversity conservation
  • (2) Semi-conservative method
  • (3) Sustainable development
  • (4) in-situ conservation
Correct Answer: (3) Sustainable development
View Solution

- This form of conservation involves removing species from their natural habitat to protect them in artificial settings, such as zoos or botanical gardens.

- Such efforts are called \textit{ex-situ conservation, a key part of biodiversity conservation. Quick Tip: (3) Sustainable development provides a controlled environment for breeding and protection of endangered species.


Question 122:

Match List I with List II:

List I & List II
A. Two or more alternative forms of a gene & I. Back cross

B. Cross of F\(_1\) progeny with homozygous recessive parent & II. Ploidy

C. Cross of F\(_1\) progeny with any of the parents & III. Allele

D. Number of chromosome sets in plant & IV. Test cross

Choose the correct answer from the options given below:

  • (1) A-II, B-I, C-III, D-IV
  • (2) A-III, B-IV, C-I, D-II
  • (3) A-IV, B-III, C-II, D-I
  • (4) A-I, B-II, C-III, D-IV
Correct Answer: (3) A-IV, B-III, C-II, D-I
View Solution

- Alleles (A) are alternative forms of a gene.

- A test cross (B) involves crossing F\(_1\) with a homozygous recessive parent.

- A back cross (C) involves crossing F\(_1\) with any of the parents.

- Ploidy (D) refers to the number of chromosome sets in a plant. Quick Tip: Alleles, text cross, back cross , ploidy are the reproductivr parts of a plant.


Question 123:

Formation of interfascicular cambium from fully developed parenchyma cells is an example of:

  • (1) Redifferentiation
  • (2) Dedifferentiation
  • (3) Maturation
  • (4) Differentiation
Correct Answer: (4) Differentiation
View Solution

- Differentiation refers to the process where fully differentiated cells regain the ability to divide and form new meristematic tissue, such as interfascicular cambium. Quick Tip: Differentiation plays a role in secondary growth in plants.


Question 124:

Spindle fibers attach to kinetochores of chromosomes during:

  • (1) Metaphase
  • (2) Anaphase
  • (3) Telophase
  • (4) Prophase
Correct Answer: (1) Metaphase
View Solution

- During metaphase, spindle fibers attach to the kinetochores of chromosomes and align them along the metaphase plate. Quick Tip: The proper attachment of spindle fibers ensures accurate chromosome segregation.


Question 125:

In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it?

  • (1) bb
  • (2) Bb
  • (3) BB/Bb
  • (4) BB
Correct Answer: (3) BB/bb
View Solution

- To determine whether a black seed plant is homozygous (BB) or heterozygous (Bb), a test cross with a homozygous recessive plant (bb) is required.

- If the progeny shows a 1:1 ratio of black to white seeds, the plant is heterozygous (BB/bb). Quick Tip: A test cross is a method used to determine the genotype of an individual exhibiting a dominant trait.


Question 126:

A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?

  • (1) Red flowered as well as pink flowered plants
  • (2) Only pink flowered plants
  • (3) Red, Pink as well as white flowered plants
  • (4) Only red flowered plants
Correct Answer: (2) Only pink flowered plants
View Solution

Explanation of Inheritance in Snapdragon Flowers

- The red and pink flower colors in Snapdragon plants follow a typical Mendelian inheritance pattern where red (R) is dominant over pink (r).

- In the F1 generation, heterozygous plants (Rr) will be obtained, which will show the dominant red flower phenotype.
- If these F1 plants are crossed with each other, the F2 progeny will have red and pink flowered plants in a 3:1 ratio. Quick Tip: \textbf{In a monohybrid cross between red and pink Snapdragon plants, the expected phenotypes in the progeny will be red and pink flowered plants in a 3:1 ratio.}


Question 127:

Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of:

  • (1) Feedback inhibition
  • (2) Competitive inhibition
  • (3) Enzyme activation
  • (4) Cofactor inhibition
Correct Answer: (2) Competitive inhibition
View Solution

Explanation of Competitive Inhibition

- Malonate is a structural analog of succinate and competes with succinate for binding to the active site of succinic dehydrogenase, a classic example of competitive inhibition.

- In competitive inhibition, the inhibitor competes with the substrate for the active site, and increasing substrate concentration can overcome the inhibition.

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{Competitive inhibitors resemble the substrate and bind to the active site of the enzyme, blocking its activity.}


Question 128:

Given below are two statements:
Statement I: Bt toxins are insect group specific and coded by a gene cry IAc.

Statement II: Bt toxin exists as inactive protoxin in B. thuringiensis. However, after ingestion by the insect the inactive protoxin gets converted into active form due to acidic pH of the insect gut.

Choose the correct answer from the options given below:

  • (1) Both Statement I and Statement II are false
  • (2) Statement I is true but Statement II is false
  • (3) Statement I is false but Statement II is true
  • (4) Both Statement I and Statement II are true
Correct Answer: (4) Both Statement I and Statement II are true
View Solution

Explanation of Bt Toxin Mechanism

- Statement I is correct: Bt (Bacillus thuringiensis) toxins are indeed insect group-specific and are coded by the cry genes, such as cry IAc.

- Statement II is partially incorrect: Bt toxin exists as an inactive protoxin, but it is not the acidic pH that activates it, rather it is the alkaline pH of the insect's gut that triggers the conversion into the active form.

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: \textbf{Bt toxin is activated in the insect gut by alkaline pH, not acidic pH.}


Question 129:

In the given figure, which component has thin outer walls and highly thickened inner walls?

  • (1) D
  • (2) A
  • (3) B
  • (4) C
Correct Answer: (2) A
View Solution

Explanation of the Structure of the Component

- The component with thin outer walls and highly thickened inner walls corresponds to A, which is typically a structure such as a vascular bundle or xylem in plants.

- This type of structure is designed to handle water transport, where the thickened walls provide support and prevent collapse under pressure. Quick Tip: \textbf{Vascular tissues like xylem have thickened inner walls to support water transport under pressure.}


Question 130:

Which one of the following can be explained on the basis of Mendel's Law of Dominance?

A. Out of one pair of factors one is dominant and the other is recessive.

B. Alleles do not show any expression and both the characters appear as such in F2 generation.

C. Factors occur in pairs in normal diploid plants.

D. The discrete unit controlling a particular character is called factor.

E. The expression of only one of the parental characters is found in a monohybrid cross.

Choose the correct answer from the options given below:

  • (1) A, C, D and E only
  • (2) B, C and D only
  • (3) A, B, C, D and E
  • (4) A, B and C only
Correct Answer: (4) A, B and C only
View Solution

Explanation of Mendel's Law of Dominance

- A is true: One allele is dominant and the other is recessive in a pair of alleles.

- C is true: Alleles occur in pairs in normal diploid organisms.

- D is true: The discrete unit controlling a character is referred to as a factor (gene).

- E is true: In a monohybrid cross, only one parental character appears due to dominance.

- B is true: Both alleles show expression in the heterozygous condition in some cases (incomplete dominance or codominance).

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: \textbf{Mendel's Law of Dominance explains how one allele can mask the expression of another in a monohybrid cross.}


Question 131:

Identify the part of the seed from the given figure which is destined to form root when the seed germinates.

  • (1) B
  • (2) C
  • (3) D
  • (4) A
Correct Answer: (1) B
View Solution

- The part of the seed that forms the root during germination is the \textit{radicle.

- It is typically located near the pointed end of the seed and emerges first during germination. Quick Tip: The radicle gives rise to the primary root of the plant.


Question 132:

Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin:

  • (1) promotes abscission of mature leaves only.
  • (2) does not affect mature monocotyledonous plants.
  • (3) can help in cell division in grasses, to produce growth.
  • (4) promotes apical dominance.
Correct Answer: (3) can help in cell division in grasses, to produce growth.
View Solution

- Auxins selectively affect dicot weeds, causing uncontrolled growth and death.

- Grasses, being monocots, are less sensitive to auxin's herbicidal effects, remaining unaffected. Quick Tip: Synthetic auxins like 2,4-D are used as selective herbicides for weed control.


Question 133:

Given below are two statements:

Statement I: Chromosomes become gradually visible under light microscope during leptotene stage.

Statement II: The beginning of diplotene stage is recognized by dissolution of synaptonemal complex.

In the light of the above statements, choose the correct answer from the options given below:

  • (1) Both Statement I and Statement II are false
  • (2) Statement I is true but Statement II is false
  • (3) Statement I is false but Statement II is true
  • (4) Both Statement I and Statement II are true
Correct Answer: (2) Statement I is true but Statement II is false
View Solution

- In the leptotene stage, chromosomes condense and become visible under a light microscope.

- In diplotene, the synaptonemal complex dissolves, and homologous chromosomes begin to separate. Quick Tip: The prophase of meiosis I is divided into leptotene, zygotene, pachytene, diplotene, and diakinesis.


Question 134:

The capacity to generate a whole plant from any cell of the plant is called:

  • (1) Micropropagation
  • (2) Differentiation
  • (3) Somatic hybridization
  • (4) Totipotency
Correct Answer: (1) Micropropagation
View Solution

- (1) Micropropagation is the ability of a single plant cell to develop into an entire plant under appropriate conditions.

- This property is fundamental in plant tissue culture techniques. Quick Tip: Micropropagation cells have the potential to regenerate all types of tissues and structures in a plant.


Question 135:

Given below are two statements:

Statement I: Parenchyma is living but collenchyma is dead tissue.

Statement II: Gymnosperms lack xylem vessels but the presence of xylem vessels is a characteristic of angiosperms.


In the light of the above statements, choose the correct answer from the options given below:

  • (1) Both Statement I and Statement II are false
  • (2) Statement I is true but Statement II is false
  • (3) Statement I is false but Statement II is true
  • (4) Both Statement I and Statement II are true
Correct Answer: (4) Both Statement I and Statement II are true
View Solution

- Statement I: Parenchyma is a living tissue, and collenchyma is also a living tissue with thickened cell walls for mechanical support, making this statement true.

- Statement II: Gymnosperms lack xylem vessels, while xylem vessels are a distinguishing feature of angiosperms, making this statement true. Quick Tip: Xylem in gymnosperms consists mostly of tracheids, while angiosperms have both tracheids and vessels for efficient water conduction.


Question 136:

Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus, increasing the yield?

  • (1) Gibberellin
  • (2) Cytokinin
  • (3) Abscisic acid
  • (4) Auxin
Correct Answer: (2) Cytokinin
View Solution

Explanation of (2) Cytokinin Effect on Growth

- Cytokinin are plant growth regulators that stimulate cell elongation and division, leading to increased stem length and overall plant growth.

- Spraying sugarcane with Cytokinin helps in increasing stem length, thereby enhancing the yield of the crop.

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{Gibberellins are commonly used in agriculture to promote stem elongation and improve crop yield.}


Question 137:

Given below are two statements:

Statement I: In C3 plants, some O2 binds to RuBisCO, hence CO2 fixation is decreased.

Statement II: In C4 plants, mesophyll cells show very little photorespiration while bundle sheath cells do not show photorespiration.

Choose the correct answer from the options given below:

  • (1) Both Statement I and Statement II are false
  • (2) Statement I is true but Statement II is false
  • (3) Statement I is false but Statement II is true
  • (4) Both Statement I and Statement II are true
Correct Answer: (4) Both Statement I and Statement II are true
View Solution

Explanation of C3 and C4 Plants

- Statement I is true: In C3 plants, RuBisCO enzyme can fix both CO2 and O2, leading to photorespiration, which decreases the efficiency of CO2 fixation.

- Statement II is true: In C4 plants, photorespiration is minimized in mesophyll cells, but it still occurs in the bundle sheath cells to some extent, albeit at a lower rate than in C3 plants.

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: \textbf{C4 plants have a mechanism to minimize photorespiration by spatially separating the fixation of CO2 from the Calvin cycle.}


Question 138:

Match List-I with List-II
List-I} & Description} & List-II} & Category}
A. & GLUT-4 & I. & Hormone
B. & Insulin & II. & Enzyme
C. & Trypsin & III. & Intercellular ground substance
D. & Collagen & IV. & Enables glucose transport into cells

Choose the correct answer from the options given below:

  • (1) A-I, B-II, C-III, D-IV
  • (2) A-II, B-III, C-IV, D-I
  • (3) A-III, B-IV, C-I, D-II
  • (4) A-IV, B-I, C-II, D-III
Correct Answer: (4) A-IV, B-I, C-II, D-III
View Solution

Explanation of the Match:

- A. GLUT-4 is a transporter protein that enables glucose transport into cells (IV).

- B. Insulin is a hormone that regulates glucose uptake (I).
- C. Trypsin is an enzyme involved in protein digestion (II).

- D. Collagen is a component of intercellular ground substance, providing structural support in tissues (III).

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: \textbf{GLUT-4 is a glucose transporter, insulin is a hormone, trypsin is an enzyme, and collagen is part of the extracellular matrix.}


Question 139:

Read the following statements and choose the set of correct statements:

In the members of Phaeophyceae,

A. Asexual reproduction occurs usually by biflagellate zoospores.

B. Sexual reproduction is by oogamous method only.

C. Stored food is in the form of carbohydrates which is either mannitol or laminarin.

D. The major pigments found are chlorophyll a, c and carotenoids and xanthophyll.

E. Vegetative cells have a cellulosic wall, usually covered on the outside by gelatinous coating of algin.

Choose the correct answer from the options given below:

  • (1) B, C, D and E only
  • (2) A, C, D and E only
  • (3) A, B, C and E only
  • (4) A, B, C and D only
Correct Answer: (1) B, C, D and E only
View Solution

- A is false: In Phaeophyceae, asexual reproduction typically occurs through biflagellate zoospores.

- B is true: Sexual reproduction in Phaeophyceae is oogamous but may also involve other forms like antheridial and oogonial cells.

- C is true: Phaeophyceae store carbohydrates in the form of mannitol or laminarin.

- D is true: Major pigments include chlorophyll a, c, and carotenoids, as well as xanthophylls.

- E is true: Vegetative cells have a cellulosic wall and are often coated with algin, a gelatinous substance.

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{Phaeophyceae are brown algae with distinct reproductive methods, storage forms of carbohydrates, and key pigments for photosynthesis.}


Question 140:

Which of the following statement is correct regarding the process of replication in E.coli?

  • (1) The DNA dependent RNA polymerase catalyses polymerization in one direction, that is 5’ → 3’
  • (2) The DNA dependent DNA polymerase catalyses polymerization in 5’ → 3’ as well as 3’ → 5’ direction
  • (3) The DNA dependent DNA polymerase catalyses polymerization in 5’ → 3’ direction
  • (4) The DNA dependent DNA polymerase catalyses polymerization in one direction that is 3’ → 5’
Correct Answer: (3) The DNA dependent DNA polymerase catalyses polymerization in 5’ → 3’ direction
View Solution

- DNA dependent DNA polymerase is responsible for DNA replication in E. coli and catalyzes the addition of nucleotides in the 5’ to 3’ direction.

- This enzyme can only add nucleotides to the 3' end of the growing strand.

Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: \textbf{DNA polymerases always catalyze the elongation of the DNA strand in the 5' to 3' direction, adding nucleotides to the 3' end of the strand.}


Question 141:

Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.

  • (1) Succinic acid → Malic acid
  • (2) Succinyl-CoA → Succinic acid
  • (3) Isocitrate → -ketoglutaric acid
  • (4) Malic acid → Oxaloacetic acid
Correct Answer: (2) Succinyl-CoA → Succinic acid
View Solution

- The step Succinyl-CoA → Succinic acid involves the formation of ATP (or GTP) via substrate-level phosphorylation and does not involve oxidation of the substrate.

- The other steps involve oxidation reactions where electrons are transferred, such as Isocitrate → alpha-ketoglutaric acid and Malic acid → Oxaloacetic acid.

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{In the TCA cycle, oxidation reactions involve the transfer of electrons, except in the conversion of Succinyl-CoA to Succinic acid.}


Question 142:

Match List I with List II
List I} & List II}
A. Robert May & I. Species-Area relationship
B. Alexander von Humboldt & II. Long-term ecosystem experiment using outdoor plots
C. Paul Ehrlich & III. Global species diversity at about 7 million
D. David Tilman & IV. Rivet popper hypothesis


Choose the correct answer from the options given below:

  • (1) A-III, B-I, C-IV, D-II
  • (2) A-I, B-III, C-II, D-IV
  • (3) A-III, B-IV, C-II, D-I
  • (4) A-II, B-III, C-I, D-IV
Correct Answer: (2) A-I, B-III, C-II, D-IV
View Solution

- A. Robert May proposed that global species diversity is about 7 million species (I).

- B. Alexander von Humboldt is known for the species-area relationship (III), which explains the biodiversity patterns across regions.

- C. Paul Ehrlich is related with the Rivet popper hypothesis (II), which suggests that each species plays an important role in maintaining ecosystem stability.

- D. David Tilman conducted long-term ecosystem experiments using outdoor plots (IV) to study ecological processes. Quick Tip: \textbf{Robert May's work focuses on global species diversity, while Alexander von Humboldt contributed to understanding the species-area relationship.}


Question 143:

Identify the correct description about the given figure:

  • (1) Water pollinated flowers showing stamens with mucilaginous covering.
  • (2) Cleistogamous flowers showing autogamy.
  • (3) Compact inflorescence showing complete autogamy.
  • (4) Wind pollinated plant inflorescence showing flowers with well exposed stamens.
Correct Answer: (4) Wind pollinated plant inflorescence showing flowers with well exposed stamens.
View Solution

- Wind-pollinated plants typically have well-exposed stamens to facilitate the release and dispersal of pollen by wind.

- These plants generally produce light, small pollen grains, and the flowers may lack attractive features like bright colors or nectar.

- The other options describe different pollination mechanisms that are not related to wind-pollinated plants.

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: \textbf{Wind-pollinated plants have exposed stamens to help the pollen disperse effectively through the air.}


Question 144:

In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is 100x (kcal m–2 yr–1), what would be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem?

  • (1) \( 10x \, kcal m^{-2} \, yr^{-1} \)
  • (2) \( 100x \, kcal m^{-2} \, yr^{-1} \)
  • (3) \( 1000x \, kcal m^{-2} \, yr^{-1} \)
  • (4) \( 10x \, kcal m^{-2} \, yr^{-1} \)
Correct Answer: (1) \( 10x \, \text{kcal m}^{-2} \, \text{yr}^{-1} \)
View Solution

- Gross Primary Productivity (GPP) refers to the total amount of energy fixed by plants through photosynthesis.

- Net Primary Productivity (NPP) is the energy available to the next trophic levels after accounting for the energy used by plants in their own respiration.

- Since NPP represents the energy remaining after respiration, the GPP is typically higher than NPP by a factor of 10.

- In this case, if NPP is 100x, GPP would be 1000x, as GPP is higher by the total energy used in respiration. . Quick Tip: \textbf{In ecosystems, GPP is typically 10 times greater than NPP, reflecting the energy lost through plant respiration.}


Question 145:

Match List I with List II
List I} & List II}
A. Rose & I. Twisted aestivation
B. Pea & II. Perigynous flower
C. Cotton & III. Drupe
D. Mango & IV. Marginal placentation

Choose the correct answer from the options given below:

  • (1) A-I, B-II, C-III, D-IV
  • (2) A-IV, B-III, C-II, D-I
  • (3) A-II, B-III, C-IV, D-I
  • (4) A-II, B-IV, C-I, D-III
Correct Answer: (1) A-I, B-II, C-III, D-IV
View Solution

- A. Rose has Perigynous flowers (I), where the ovary is surrounded by the other floral parts.

- B. Pea has Marginal placentation (II), where ovules are attached to the margin of the ovary.

- C. Cotton has a Drupe fruit (III), which is a fleshy fruit with a single seed enclosed in a hard shell.

- D. Mango has Twisted aestivation (IV), where the arrangement of petals or sepals involves twisting.

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{In plant anatomy, placentation and aestivation patterns help in identifying the type of flower and fruit.}


Question 146:

Match List I with List II

List-I (Types of Stamens) & List-II (Example)
A. Monoadelphous & I. Citrus
B. Diadelphous & II. Pea
C. Polyadelphous & III. Lily
D. Epiphyllous & IV. China-rose

  • (1) A-IV, B-I, C-II, D-III
  • (2) A-I, B-II, C-IV, D-III
  • (3) A-III, B-I, C-IV, D-II
  • (4) A-IV, B-II, C-I, D-III
Correct Answer: (1) A-IV, B-I, C-II, D-III
View Solution

- Monoadelphous stamens are found in China-rose (IV), where all stamens are fused into a single group.

- Diadelphous stamens are found in Pea (I), where the stamens are fused into two groups.

- Polyadelphous stamens are found in Citrus (II), where stamens are grouped into multiple bundles.

- Epiphyllous stamens are found in Lily (III), where the stamens arise from the leaf-like structure. Quick Tip: \textbf{Stamen arrangements such as monoadelphous and diadelphous help in identifying plant species and their pollination mechanisms.}


Question 147:

Which of the following are fused in somatic hybridization involving two varieties of plants?

  • (1) Somatic embryos
  • (2) Protoplasts
  • (3) Pollens
  • (4) Callus
Correct Answer: (2) Protoplasts
View Solution

- Protoplast fusion is a key technique in somatic hybridization, where protoplasts (plant cells without cell walls) from two different varieties are fused to create a hybrid plant.

- This fusion allows the combination of genetic material from both parent plants to form a hybrid.

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{Somatic hybridization uses protoplast fusion to combine the genetic material of two different plant varieties.}


Question 148:

Match List I with List II  List-I & List-II
A. Frederick Griffith & I. Genetic code
B. Francois Jacob \& Jacque Monod & II. Semi-conservative mode of DNA replication
C. Har Gobind Khorana & III. Transformation
D. Meselson \& Stahl & IV. Lac operon

 

  • (1) A-III, B-IV, C-I, D-II
  • (2) A-II, B-III, C-IV, D-I
  • (3) A-IV, B-I, C-II, D-III
  • (4) A-III, B-II, C-I, D-IV
Correct Answer: (1) A-III, B-IV, C-I, D-II
View Solution

- Frederick Griffith is related with the discovery of Transformation (III), where genetic material is transferred between bacteria.

- Francois Jacob and Jacque Monod are credited with the discovery of the Lac operon (IV), a key component of gene regulation in bacteria.

- Har Gobind Khorana helped in deciphering the Genetic code (I).

- Meselson and Stahl conducted the experiment proving the semi-conservative mode of DNA replication (II).

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{Griffith's work on transformation and Meselson-Stahl's experiment on DNA replication were foundational in genetics.}


Question 149:

The DNA present in chloroplast is:

  • (1) Circular, double stranded
  • (2) Linear, single stranded
  • (3) Circular, single stranded
  • (4) Linear, double stranded
Correct Answer: (2) Linear, single stranded
View Solution

- Chloroplast DNA is circular and double-stranded, similar to the DNA found in prokaryotes.

- This circular structure is a remnant of the evolutionary origin of chloroplasts, which are thought to have evolved from cyanobacteria.

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{Chloroplasts, like mitochondria, have circular DNA, which is a characteristic of prokaryotic organisms.}


Question 150:

Match List I with List II 

List-I & List-II
A. Citric acid cycle & I. Cytoplasm
B. Glycolysis & II. Mitochondrial matrix
C. Electron transport system & III. Intermembrane space of mitochondria
D. Proton gradient & IV. Inner mitochondrial membrane

 

  • (1) A-II, B-I, C-IV, D-III
  • (2) A-III, B-IV, C-I, D-II
  • (3) A-IV, B-III, C-II, D-I
  • (4) A-I, B-II, C-III, D-IV
Correct Answer: (4) A-I, B-II, C-III, D-IV
View Solution

- The Citric acid cycle occurs in the mitochondrial matrix (I).

- Glycolysis takes place in the cytoplasm (II).

- The Electron transport system is located on the inner mitochondrial membrane (III).

- The Proton gradient is created in the intermembrane space of mitochondria (IV).


Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: \textbf{Cellular respiration occurs in different parts of the cell, with glycolysis in the cytoplasm and the citric acid cycle and electron transport in the mitochondria.}


Question 151:

Which of the following is not a natural/traditional contraceptive method?

  • (1) Periodic abstinence
  • (2) Lactational amenorrhea
  • (3) Vaults
  • (4) Coitus interruptus
Correct Answer: (3) Vaults
View Solution

- Periodic abstinence, lactational amenorrhea, and coitus interruptus are all traditional contraceptive methods.

- Vaults are a modern contraceptive method and do not fall under natural or traditional methods.

Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: \textbf{Natural contraceptive methods include periodic abstinence, lactational amenorrhea, and coitus interruptus, while vaults are modern contraceptive devices.}


Question 152:

Match List I with List II 

List-I & List-II
A. Common cold & I. Plasmodium
B. Haemozoin & II. Typhoid
C. Widal test & III. Rhinoviruses
D. Allergy & IV. Dust mites

  • (1) A-I, B-III, C-II, D-IV
  • (2) A-III, B-I, C-II, D-IV
  • (3) A-IV, B-II, C-III, D-I
  • (4) A-II, B-IV, C-III, D-I
Correct Answer: (2) A-III, B-I, C-II, D-IV
View Solution

- Common cold is caused by Rhinoviruses (III).

- Haemozoin is produced by Plasmodium (I), which is the causative agent of malaria.

- Widal test is used to diagnose Typhoid (II).

- Allergy can be triggered by Dust mites (IV).

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{The Widal test is used for diagnosing typhoid, while haemozoin is linked to malaria caused by Plasmodium.}


Question 153:

Which of the following statements is incorrect?

  • (1) Most commonly used bio-reactors are of stirring type
  • (2) Bio-reactors are used to produce small scale bacterial cultures
  • (3) Bio-reactors have an agitator system, an oxygen delivery system and foam control system
  • (4) A bio-reactor provides optimal growth conditions for achieving the desired product
Correct Answer: (4) A bio-reactor provides optimal growth conditions for achieving the desired product
View Solution

- Bio-reactors are typically used for large-scale production of microbial cultures and industrial products, not small-scale cultures.

- They are equipped with systems to provide optimal conditions for growth, such as an agitator, oxygen delivery, and foam control. Quick Tip: \textbf{Bio-reactors are mainly used in large-scale production of microbial cultures and bioproducts, rather than for small-scale cultures.}


Question 154:

Which of the following are Autoimmune disorders?

A. Myasthenia gravis

B. Rheumatoid arthritis

C. Gout D. Muscular dystrophy

E. Systemic Lupus Erythematosus (SLE)

Choose the correct answer from the options given below:

  • (1) A, B and E only
  • (2) B, C and E only
  • (3) C, D and E only
  • (4) A, B and D only
Correct Answer: (1) A, B and E only
View Solution

- Myasthenia gravis, Rheumatoid arthritis, and Systemic Lupus Erythematosus (SLE)

are autoimmune disorders where the immune system attacks the body’s own tissues.

- Gout and Muscular dystrophy are not autoimmune disorders.

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{Autoimmune disorders occur when the body's immune system mistakenly attacks its own tissues, as seen in myasthenia gravis, rheumatoid arthritis, and SLE.}


Question 155:

Match List I with List II 

List-I & List-II
A. Down’s syndrome & I. 11th chromosome
B. Alpha-Thalassemia & II. ‘X’ chromosome
C. Beta-Thalassemia & III. 21st chromosome
D. Klinefelter’s syndrome & IV. 16th chromosome

Choose the correct answer from the options given below:

  • (1) A-II, B-III, C-IV, D-I
  • (2) A-III, B-IV, C-I, D-II
  • (3) A-IV, B-I, C-II, D-III
  • (4) A-I, B-II, C-III, D-IV
Correct Answer: (3) A-IV, B-I, C-II, D-III
View Solution

- Down’s syndrome is caused by an extra chromosome on the 21st chromosome (IV).

- Alpha-Thalassemia is related with the 16th chromosome (I).

- Beta-Thalassemia is related with the 11th chromosome (II).

- Klinefelter’s syndrome is caused by an extra X chromosome (III).

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{Chromosomal disorders such as Down’s syndrome and Klinefelter’s syndrome are linked to specific chromosomal abnormalities.}


Question 156:

Match List I with List II

List-I (Type of IUD) & List-II (Example)
A. Non-medicated IUD & I. Multiload 375
B. Copper releasing IUD & III. Lippes loop
C. Hormone releasing IUD & IV. LNG-20
D. Implants & II. Progestogens

Choose the correct answer from the options given below:

  • (1) A-I, B-III, C-IV, D-II
  • (2) A-IV, B-I, C-II, D-III
  • (3) A-III, B-I, C-IV, D-II
  • (4) A-III, B-I, C-II, D-IV
Correct Answer: (1) A-I, B-III, C-IV, D-II
View Solution

- Non-medicated IUD: Example - Lippes loop (I)

- Copper releasing IUD: Example - Multiload 375 (III)

- Hormone releasing IUD: Example - LNG-20 (IV)

- Implants: Example - Progestogens (II)
Quick Tip: \textbf{IUDs can be either medicated with copper or hormones, or non-medicated to prevent pregnancy.}


Question 157:

Match List I with List II 

List-I & List-II
A. Pleurobrachia & I. Mollusca
B. Radula & II. Ctenophora
C. Stomochord & III. Osteichthyes
D. Air bladder & IV. Hemichordata

Choose the correct answer from the options given below:

  • (1) A-II, B-I, C-IV, D-III
  • (2) A-II, B-IV, C-I, D-III
  • (3) A-IV, B-III, C-II, D-I
  • (4) A-IV, B-II, C-III, D-I
Correct Answer: (4) A-IV, B-II, C-III, D-I \
View Solution

- Pleurobrachia belongs to Ctenophora (IV).

- Radula is a feature of Mollusca (II).

- Stomochord is found in Hemichordata (III).

- Air bladder is found in Osteichthyes (IV).

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: \textbf{Radula is a characteristic of mollusks, while stomochord is found in hemichordates.}


Question 158:

Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?

  • (1) High pO2 and Lesser H+ concentration
  • (2) Low pCO2 and High H+ concentration
  • (3) Low pCO2 and High temperature
  • (4) High pO2 and High pCO2
Correct Answer: (2) Low pCO2 and High H+ concentration
View Solution

- Oxyhaemoglobin formation occurs when oxygen binds to hemoglobin in the alveoli, which is facilitated by high partial pressure of oxygen (pO2) and lower hydrogen ion concentration (pH), which favors oxygen binding.

- Low pCO2 conditions lead to the release of oxygen from hemoglobin (Bohr effect). Quick Tip: \textbf{Oxyhaemoglobin formation is favored by high oxygen levels and a lower concentration of hydrogen ions in the alveoli.}


Question 159:

Match List I with List II

List-I & List-II
A. Cocaine & I. Effective sedative in surgery
B. Heroin & II. Cannabis sativa
C. Morphine & III. Erythroxylum
D. Marijuana & IV. Papaver somniferum

Choose the correct answer from the options given below:

  • (1) A-I, B-III, C-II, D-IV
  • (2) A-II, B-I, C-III, D-IV
  • (3) A-III, B-IV, C-I, D-II
  • (4) A-IV, B-III, C-I, D-II
Correct Answer: (2) A-II, B-I, C-III, D-IV
View Solution

- Cocaine is derived from Erythroxylum (II) and is used as a local anesthetic in surgeries.

- Heroin is derived from Papaver somniferum (I), the opium poppy.

- Morphine is derived from Papaver somniferum (III and is used as a potent painkiller.

- Marijuana is derived from Cannabis sativa (IV), a plant known for its psychoactive properties.
Quick Tip: \textbf{Cocaine is from Erythroxylum, heroin and morphine are from the poppy plant, and marijuana is from Cannabis sativa.}


Question 160:

Match List I with List II

List-I (Sub Phases of Prophase I) & List-II (Specific Characters)
A. Diakinesis & I. Synaptonemal complex formation
B. Pachytene & II. Completion of terminalisation of chiasmata
C. Zygotene & III. Chromosomes look like thin threads
D. Leptotene & IV. Appearance of recombination nodules

Choose the correct answer from the options given below:

  • (1) A-I, B-II, C-IV, D-III
  • (2) A-II, B-IV, C-I, D-III
  • (3) A-IV, B-III, C-II, D-I
  • (4) A-IV, B-II, C-III, D-I
Correct Answer: (2) A-II, B-IV, C-I, D-III
View Solution

- Diakinesis is characterized by the completion of terminalisation of chiasmata (II).

- Pachytene is related with the appearance of recombination nodules (IV).

- Zygotene involves the formation of the synaptonemal complex (I).

- Leptotene is characterized by chromosomes looking like thin threads (III).

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{The different sub-phases of prophase I are distinguished by the processes of chromosome pairing and recombination.}


Question 161:

Match List I with List II 

List-I & List-II
A. Fibrous joints & I. Adjacent vertebrae, limited movement
B. Cartilaginous joints & II. Humerus and Pectoral girdle, rotational movement
C. Hinge joints & III. Skull, don’t allow any movement
D. Ball and socket joints & IV. Knee, help in locomotion

Choose the correct answer from the options given below:

  • (1) A-I, B-III, C-II, D-IV
  • (2) A-II, B-III, C-I, D-IV
  • (3) A-III, B-I, C-IV, D-II
  • (4) A-IV, B-II, C-III, D-I
Correct Answer: (2) A-II, B-III, C-I, D-IV
View Solution

- Fibrous joints are found in the skull where they allow no movement (II).

- Cartilaginous joints are found between adjacent vertebrae and allow limited movement (III).

- Hinge joints are found in the knee, enabling movement for locomotion (I).

- Ball and socket joints are found at the humerus and pectoral girdle, allowing rotational movement (IV).
Quick Tip: \textbf{The different types of joints in the human body are classified based on their structure and the type of movement they allow.}


Question 162:

Which of the following is not a steroid hormone?

  • (1) Testosterone
  • (2) Progesterone
  • (3) Glucagon
  • (4) Cortisol
Correct Answer: (2) Progesterone
View Solution

- Testosterone, Progesterone, and Cortisol are all steroid hormones derived from cholesterol.

- Glucagon, on the other hand, is a peptide hormone produced by the pancreas, not a steroid. Quick Tip: \textbf{Steroid hormones are derived from cholesterol, while peptide hormones like glucagon are made of amino acids.}


Question 163:

In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on

  • (1) 10th segment
  • (2) 8th and 9th segment
  • (3) 11th segment
  • (4) 5th segment
Correct Answer: (4) 5th segment
View Solution

- In both male and female cockroaches, anal cerci are present on the 10th segment of the abdomen.

- These cerci are sensory structures that help in detecting changes in the environment. Quick Tip: \textbf{Anal cerci in cockroaches are sensory structures that help detect vibrations and air currents.}


Question 164:

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R:

Assertion A: FSH acts upon ovarian follicles in female and Leydig cells in male.

Reason R: Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being.

Choose the correct answer from the options given below:

  • (1) Both A and R are true but R is NOT the correct explanation of A
  • (2) A is true but R is false
  • (3) A is false but R is true
  • (4) Both A and R are true and R is the correct explanation of A
Correct Answer: (3) A is false but R is true
View Solution

- Assertion A is false: FSH (Follicle Stimulating Hormone) acts on ovarian follicles in females but on Sertoli cells, not Leydig cells, in males.

- Reason R is true: In females, growing ovarian follicles secrete estrogen, and in males, interstitial cells (Leydig cells) secrete androgens (testosterone).

Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: \textbf{FSH acts on Sertoli cells in males and ovarian follicles in females, with the secreted hormones differing in both genders.}


Question 165:

Match List I with List II 

List-I (Pulmonary Volumes) & List-II (Corresponding Volumes)
A. Expiratory capacity & I. Expiratory reserve volume + Tidal volume + Inspiratory reserve volume
B. Functional residual capacity & II. Tidal volume + Expiratory reserve volume
C. Vital capacity & III. Tidal volume + Inspiratory reserve volume
D. Inspiratory capacity & IV. Expiratory reserve volume + Residual volume

Choose the correct answer from the options given below:

  • (1) A-III, B-II, C-IV, D-I
  • (2) A-II, B-I, C-IV, D-III
  • (3) A-I, B-III, C-II, D-IV
  • (4) A-II, B-IV, C-I, D-III
Correct Answer: (3) A-I, B-III, C-II, D-IV
View Solution

- Expiratory capacity is the sum of Tidal volume + Expiratory reserve volume (I).

- Functional residual capacity is the sum of Expiratory reserve volume + Residual volume (III).

- Vital capacity is the sum of Expiratory reserve volume + Tidal volume + Inspiratory reserve volume (II).

- Inspiratory capacity is the sum of Tidal volume + Inspiratory reserve volume (IV).
Quick Tip: \textbf{Pulmonary volumes are important for assessing lung function and can be measured using a spirometer.}


Question 166:

Three types of muscles are given as a, b and c. Identify the correct matching pair along with their location in human body:

  • (1) (a) Skeletal - Triceps
    (b) Smooth – Stomach
    (c) Cardiac – Heart
  • (2) (a) Skeletal - Biceps
    (b) Involuntary – Intestine
    (c) Smooth – Heart
  • (3) (a) Involuntary – Nose tip
    (b) Skeletal – Bone
    (c) Cardiac – Heart
  • (4) (a) Smooth - Toes
    (b) Skeletal – Legs
    (c) Cardiac – Heart
Correct Answer: (4) (a) Smooth - Toes
(b) Skeletal – Legs
(c) Cardiac – Heart
View Solution

- Skeletal muscles like the Triceps are attached to bones and enable voluntary movements.

- Smooth muscles like those in the Stomach are involuntary and help in digestion.

- Cardiac muscles are specialized muscles in the Heart that contract involuntarily to pump blood.
Quick Tip: \textbf{Skeletal muscles are under voluntary control, smooth muscles are involuntary, and cardiac muscles are specialized for heart function.}


Question 167:

Match List I with List II 

List-I & List-II
A. Lipase & I. Peptide bond
B. Nuclease & II. Ester bond
C. Protease & III. Glycosidic bond
D. Amylase & IV. Phosphodiester bond
Choose the correct answer from the options given below:

  • (1) A-III, B-II, C-I, D-IV
  • (2) A-II, B-IV, C-I, D-III
  • (3) A-IV, B-I, C-III, D-II
  • (4) A-IV, B-II, C-III, D-I
Correct Answer: (2) A-II, B-IV, C-I, D-III
View Solution

- Lipase acts on ester bonds (II), which are found in lipids.

- Nuclease acts on phosphodiester bonds (IV) in nucleic acids.

- Protease breaks down peptide bonds (I) in proteins.

- Amylase acts on glycosidic bonds (III) in carbohydrates.

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{Different enzymes are specific to breaking down bonds in various macromolecules such as lipids, proteins, and carbohydrates.}


Question 168:

The flippers of the Penguins and Dolphins are the example of the

  • (1) Natural selection
  • (2) Convergent evolution
  • (3) Divergent evolution
  • (4) Adaptive radiation
Correct Answer: (3) Divergent evolution
View Solution

- The flippers of Penguins and Dolphins are examples of (a) Smooth - Toes

(b) Skeletal – Legs

(c) Cardiac – Heart

evolution, where unrelated species evolve similar traits as a result of adapting to different environments or ecological niches.

- This evolution occurs despite the species being from different lineages. Quick Tip: \textbf{Convergent evolution occurs when unrelated species develop similar features due to similar environmental pressures.}


Question 169:

Following are the stages of cell division :

A. Gap 2 phase

B. Cytokinesis

C. Synthesis phase

D. Karyokinesis

E. Gap 1 phase


Choose the correct answer from the options given below:

  • (1) E-B-D-A-C
  • (2) B-D-E-A-C
  • (3) E-C-A-D-B
  • (4) C-E-D-A-B
Correct Answer: (1) E-B-D-A-C
View Solution

- The correct sequence of stages is:

1. Gap 1 phase (E)

2. Cytokinesis (B)

3. Karyokinesis (D)

4. Gap 2 phase (A)

5. Synthesis phase (C)

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{In cell division, the sequence typically follows Gap 1 → Synthesis → Gap 2 → Karyokinesis → Cytokinesis.}


Question 170:

Which one of the following factors will not affect the Hardy-Weinberg equilibrium?

  • (1) Genetic drift
  • (2) Gene migration
  • (3) Constant gene pool
  • (4) Genetic recombination
Correct Answer: (3) Constant gene pool
View Solution

- The Hardy-Weinberg equilibrium assumes no change in allele frequencies due to external factors.

- Factors like genetic drift, gene migration, and genetic recombination can disrupt this equilibrium.

- A constant gene pool implies no changes in allele frequencies, which is essential for maintaining the Hardy-Weinberg equilibrium.

Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: \textbf{The Hardy-Weinberg equilibrium is disrupted by genetic drift, gene migration, and recombination, but assumes a constant gene pool.}


Question 171:

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R:

Assertion A: FSH acts upon ovarian follicles in female and Leydig cells in male.

Reason R: Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being.

  • (1) Both A and R are true but R is NOT the correct explanation of A
  • (2) A is true but R is false
  • (3) A is false but R is true
  • (4) Both A and R are true and R is the correct explanation of A
Correct Answer: (1) Both A and R are true but R is NOT the correct explanation of A
View Solution

- Assertion A is true: FSH acts on ovarian follicles in females and Leydig cells in males.

- Reason R is true: The Leydig cells in males secrete androgens (testosterone), not interstitial cells. Growing ovarian follicles secrete estrogen in females.

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{FSH acts on both ovarian follicles in females and Sertoli cells in males, with Leydig cells secreting testosterone in males.}


Question 172:

Match List I with List II 

List-I & List-II
A. Typhoid & I. Fungus
B. Leishmaniasis & II. Nematode
C. Ringworm & III. Protozoa
D. Filariasis & IV. Bacteria

Choose the correct answer from the options given below:

  • (1) A-IV, B-III, C-I, D-II
  • (2) A-III, B-I, C-IV, D-II
  • (3) A-II, B-IV, C-III, D-I
  • (4) A-I, B-III, C-II, D-IV
Correct Answer: (2) A-III, B-I, C-IV, D-II
View Solution

- Typhoid is caused by Bacteria (III).

- Leishmaniasis is caused by Protozoa (I).

- Ringworm is caused by Fungus (IV).

- Filariasis is caused by a Nematode (II).

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{Infections like typhoid, leishmaniasis, and ringworm are caused by bacteria, protozoa, and fungi, respectively.}


Question 173:

Given below are some stages of human evolution. Arrange them in correct sequence. (Past to Recent)

A. Homo habilis

B. Homo sapiens

C. Homo neanderthalensis

D. Homo erectus


Choose the correct answer from the options given below:

  • (1) B-A-D-C
  • (2) C-B-D-A
  • (3) A-D-C-B
  • (4) D-A-C-B
Correct Answer: (4) D-A-C-B
View Solution

The correct sequence of human evolution from past to recent is:

- Homo erectus (D)

- Homo habilis (A)

- Homo neanderthalensis (C)

- Homo sapiens (B)

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: \textbf{Human evolution follows the sequence: D-A-C-B. }


Question 174:

Which of the following is not a component of Fallopian tube?

  • (1) Isthmus
  • (2) Infundibulum
  • (3) Ampulla
  • (4) Uterine fundus
Correct Answer: (2) Infundibulum
View Solution

The Fallopian tube consists of the following parts:

- Isthmus

- Uterus fundus

- Ampulla

The (2) Infundibulum is part of the uterus, not the Fallopian tube. Quick Tip: \textbf{The uterine fundus is part of the uterus and not part of the Fallopian tube.}


Question 175:

Consider the following statements:

A. Annelids are true coelomates

B. Poriferans are pseudocoelomates

C. Aschelminthes are acoelomates

D. Platyhelminthes are pseudocoelomates


Choose the correct answer from the options given below:

  • (1) A only
  • (2) C only
  • (3) D only
  • (4) B only
Correct Answer: (3) D only
View Solution

- Annelids are true coelomates (A), meaning they possess a true coelom.

- Poriferans are not pseudocoelomates, and Aschelminthes and Platyhelminthes are pseudocoelomates either.

- Therefore, statement D is the only correct one. Quick Tip: \textbf{Annelids are true coelomates, meaning they possess a true coelom surrounded by mesoderm.}


Question 176:

Match List I with List II 

List-I & List-II
A. Axoneme & I. Centriole
B. Cartwheel pattern & II. Cilia and flagella
C. Crista & III. Chromosome
D. Satellite & IV. Mitochondria

Choose the correct answer from the options given below:

  • (1) A-IV, B-II, C-III, D-I
  • (2) A-II, B-IV, C-I, D-III
  • (3) A-II, B-I, C-IV, D-III
  • (4) A-IV, B-III, C-II, D-I
Correct Answer: (3) A-II, B-I, C-IV, D-III
View Solution

- Axoneme is found in Cilia and flagella (II).

- Cartwheel pattern is related with Centriole (I).

- Crista is found in the Mitochondria (IV).

- Satellite is found near the Chromosome (III).

Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: \textbf{Axoneme is the structural part of cilia and flagella, while cristae are inner folds in the mitochondria.}


Question 177:

Match List I with List II 

List I & List II
A. Pterophyllum & I. Hag fish
B. Myxine & II. Saw fish
C. Pristis & III. Angel fish
D. Exocoetus & IV. Flying fish

Choose the correct answer from the options given below:

  • (1) A-III, B-I, C-II, D-IV
  • (2) A-IV, B-I, C-II, D-III
  • (3) A-III, B-II, C-I, D-IV
  • (4) A-II, B-I, C-III, D-IV
Correct Answer: (3) A-III, B-II, C-I, D-IV
View Solution

- Pterophyllum is commonly known as Angel fish (III).

- Myxine is commonly known as Hag fish (II).

- Pristis is known as Saw fish (I).

- Exocoetus is commonly known as the Flying fish (IV). Quick Tip: \textbf{Fish species like Pristis (sawfish) and Exocoetus (flying fish) are known for their unique adaptations.}


Question 178:

Match List I with List II

List-I & List-II
A. Pons & I. Provides additional space for Neurons, regulates posture and balance.
B. Hypothalamus & II. Controls respiration and gastric secretions.
C. Medulla & III. Connects different regions of the brain.
D. Cerebellum & IV. Neuro secretory cells

Choose the correct answer from the options given below:

  • (1) A-III, B-IV, C-II, D-I
  • (2) A-I, B-III, C-II, D-IV
  • (3) A-II, B-I, C-III, D-IV
  • (4) A-II, B-III, C-I, D-IV
Correct Answer: (1) A-III, B-IV, C-II, D-I
View Solution

- Pons is responsible for connecting different regions of the brain (III).

- Hypothalamus contains neurosecretory cells (IV), involved in hormone production.

- Medulla controls respiration and gastric secretions (II).

- Cerebellum helps in regulating posture and balance (I).

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{The pons, medulla, and cerebellum are part of the brainstem and cerebellum, involved in functions like posture, balance, and vital processes.}


Question 179:

The following diagram showing restriction sites in E. coli cloning vector pBR322. Find the role of ‘X’ and ‘Y’ genes :

  • (1) The gene ‘X’ is responsible for controlling the copy number of the linked DNA and ‘Y’ for protein involved in the replication of Plasmid.
  • (2) The gene ‘X’ is for protein involved in replication of Plasmid and ‘Y’ for resistance to antibiotics.
  • (3) Gene ’X’ is responsible for recognitions sites and ‘Y’ is responsible for antibiotic resistance.
  • (4) The gene ‘X’ is responsible for resistance to antibiotics and ‘Y’ for protein involved in the replication of Plasmid.
Correct Answer: (3) Gene ’X’ is responsible for recognitions sites and ‘Y’ is responsible for antibiotic resistance.
View Solution

- Gene ‘X’ controls the copy number of the linked DNA in plasmid cloning vectors.

- Gene ‘Y’ encodes a protein involved in plasmid replication.

Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: \textbf{Cloning vectors like pBR322 are used to replicate recombinant DNA in bacteria, with specific genes controlling replication and resistance.}


Question 180:

Given below are two statements :

Statement I : In the nephron, the descending limb of loop of Henle is impermeable to water and permeable to electrolytes.

Statement II : The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption.

Choose the correct answer from the options given below:

  • (1) Both Statement I and Statement II are false
  • (2) Statement I is true but Statement II is false
  • (3) Statement I is false but Statement II is true
  • (4) Both Statement I and Statement II are true
Correct Answer: (1) Both Statement I and Statement II are false
View Solution

- Statement I is false: The descending limb of the loop of Henle is permeable to water, not electrolytes.

- Statement II is also false: The proximal convoluted tubule is lined by simple cuboidal epithelium, not columnar. The brush border epithelium increases surface area for reabsorption of water, electrolytes, and nutrients.

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{The descending limb of the loop of Henle is water permeable, and the proximal convoluted tubule is lined by simple cuboidal epithelium.}


Question 181:

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:

Assertion A : Breast-feeding during initial period of infant growth is recommended by doctors for bringing a healthy baby.

Reason R : Colostrum contains several antibodies absolutely essential to develop resistance for the new born baby.

Choose the correct answer from the options given below:

  • (1) Both A and R are correct but R is NOT the correct explanation of A
  • (2) A is correct but R is not correct
  • (3) A is not correct but R is correct
  • (4) Both A and R are correct and R is the correct explanation of A
Correct Answer: (1) Both A and R are correct but R is NOT the correct explanation of A
View Solution

- Assertion A is true: Breast-feeding during the initial period of infant growth is recommended for ensuring a healthy baby.

- Reason R is also true: Colostrum, the first milk produced after birth, contains antibodies that help the newborn develop immunity.

- The reason given is the correct explanation of the assertion.

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{Colostrum provides essential antibodies to the newborn, which is one of the reasons why breast-feeding is highly recommended in the early stages.}


Question 182:

Following are the stages of pathway for conduction of an action potential through the heart:

A. AV bundle

B. Purkinje fibres

C. AV node

D. Bundle branches

E. SA node

Choose the correct answer from the options given below:

  • (1) A-E-C-B-D
  • (2) B-D-E-C-A
  • (3) E-A-D-B-C
  • (4) E-C-A-D-B
Correct Answer: (1) A-E-C-B-D
View Solution

The correct sequence of conduction in the heart is:

- AV bundle (A) initiates the action potential.

- SA node (E) transmits the impulse to the AV node (C).

- The impulse then moves down the Purkinje fibres (B).

- Finally, it reaches the Bundle branches (D) to stimulate the ventricles. Quick Tip: \textbf{The heart's conduction system follows this order: SA node → AV node → AV bundle → Bundle branches → Purkinje fibres.}


Question 183:

Which one is the correct product of DNA dependent RNA polymerase to the given template?

3’TACATGGCAAATATCCATTCA5’

  • (1) 5’AUGUAAAGUUUAUAGGUAAGU3’
  • (2) 5’AUGUACCGUUUAUAGGGAAGU3’
  • (3) 5’ATGTACCGTTTATAGGTAAGT3’
  • (4) 5’AUGUACCGUUUAUAGGUAAGU3’
Correct Answer: (1) 5 ’AUGUAAAGUUUAUAGGUAAGU3’
View Solution

- The RNA product is complementary to the given DNA template strand.

- The DNA sequence provided is transcribed into RNA by RNA polymerase, with thymine (T) replaced by uracil (U) in the RNA strand.

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{In transcription, RNA polymerase synthesizes RNA using the DNA template, replacing thymine with uracil.}


Question 184:

Match List I with List II 

List I & List II
A. –I antitrypsin & I. Cotton bollworm
B. Cry IAb & II. ADA deficiency
C. Cry IAc & III. Emphysema
D. Enzyme replacement therapy & IV. Corn borer

Choose the correct answer from the options given below:

  • (1) A-III, B-I, C-II, D-IV
  • (2) A-III, B-IV, C-I, D-II
  • (3) A-II, B-IV, C-I, D-III
  • (4) A-II, B-I, C-IV, D-III
Correct Answer: (1) A-III, B-I, C-II, D-IV
View Solution

- -I antitrypsin is related with Emphysema (III), a lung disease.

- Cry IAb is used to protect plants against Cotton bollworm (I).

- Cry IAc is used to protect plants against Corn borer (II).
- Enzyme replacement therapy is used for treating ADA deficiency (IV), a genetic disorder.

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{Cry proteins from *Bacillus thuringiensis* are used to control pests like cotton bollworm and corn borer.}


Question 185:

The “Ti plasmid” of Agrobacterium tumefaciens stands for

  • (1) Tumor independent plasmid
  • (2) Tumor inducing plasmid
  • (3) Temperature independent plasmid
  • (4) Tumour inhibiting plasmid
Correct Answer: (1) Tumor independent plasmid
View Solution

- The Ti plasmid (Tumor inducing plasmid) of Agrobacterium tumefaciens is responsible for causing crown gall disease in plants by inducing tumor formation.

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: The Ti plasmid is used in genetic engineering to introduce foreign genes into plants by causing tumor formation.


Question 186:

Match List I with List II 

List-I & List-II
A. P wave & I. Heart muscles are electrically silent.
B. QRS complex & II. Depolarisation of ventricles.
C. T wave & III. Depolarisation of atria.
D. T-P gap & IV. Repolarisation of ventricles.

Choose the correct answer from the options given below:

  • (1) A-III, B-II, C-IV, D-I
  • (2) A-II, B-III, C-I, D-IV
  • (3) A-IV, B-II, C-I, D-III
  • (4) A-I, B-III, C-IV, D-II
Correct Answer: (2) A-II, B-III, C-I, D-IV
View Solution

- P wave corresponds to the depolarisation of the atria (II).

- QRS complex represents the depolarisation of the ventricles (III).

- T wave corresponds to the repolarisation of the ventricles (I).

- T-P gap represents the period when heart muscles are electrically silent (IV).

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: The P wave, QRS complex, and T wave represent key phases of the cardiac cycle as seen in the electrocardiogram (ECG).


Question 187:

Given below are two statements:

Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely.

Statement II: According to Gause's principle, during competition, the inferior will be eliminated. This may be true if resources are limiting.


Choose the correct answer from the options given below:

  • (1) Both Statement I and Statement II are false.
  • (2) Statement I is true but Statement II is false.
  • (3) Statement I is false but Statement II is true.
  • (4) Both Statement I and Statement II are true.
Correct Answer: (4) Both Statement I and Statement II are true.
View Solution

- Statement I is correct: Gause's competitive exclusion principle suggests that two species competing for the same, limiting resource cannot coexist indefinitely, not that they cannot compete for different resources.

- Statement II is correct: The inferior competitor in a limiting resource scenario may indeed be eliminated, according to the principle.

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Gause’s principle states that two species competing for the same limiting resource cannot coexist indefinitely.


Question 188:

Given below are two statements:

Statement I: Mitochondria and chloroplasts both double membranes bound organelles.

Statement II: Inner membrane of mitochondria is relatively less permeable, as compared to chloroplast.


Choose the correct answer from the options given below:

  • (1) Both Statement I and Statement II are incorrect.
  • (2) Statement I is correct but Statement II is incorrect.
  • (3) Statement I is incorrect but Statement II is correct.
  • (4) Both Statement I and Statement II are correct.
Correct Answer: (4) Both Statement I and Statement II are correct.
View Solution

- Statement I is correct: Both mitochondria and chloroplasts have a double membrane structure.

- Statement II is correct: The inner membrane of mitochondria is highly impermeable, while the inner membrane of chloroplasts is permeable for the transport of ions and metabolites.

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Both mitochondria and chloroplasts have double membranes, but the permeability of their inner membranes varies.


Question 189:

Choose the correct statement given below regarding juxta medullary nephron.

  • (1) Renal corpuscle of juxta medullary nephron lies in the outer portion of the renal medulla.
  • (2) Loop of Henle of juxta medullary nephron runs deep into medulla.
  • (3) Juxta medullary nephrons outnumber the cortical nephrons.
  • (4) Juxta medullary nephrons are located in the columns of Bertini.
Correct Answer: (1) Renal corpuscle of juxta medullary nephron lies in the outer portion of the renal medulla.
View Solution



- Juxta medullary nephrons have their renal corpuscle located in the outer portion of the renal cortex, and their Loop of Henle extends deeply into the renal medulla, which helps in the concentration of urine.

- Cortical nephrons are more numerous than juxta medullary nephrons. Quick Tip: Juxta medullary nephrons play a crucial role in urine concentration due to their deep loops of Henle.


Question 190:

Match List I with List II 

List-I & List-II
A. Exophthalmic goiter & I. Excess secretion of cortisol, moon face \& hyperglycemia.
B. Acromegaly & II. Hypo-secretion of thyroid hormone and stunted growth.
C. Cushing’s syndrome & III. Hyper secretion of thyroid hormone \& protruding eyeballs.
D. Cretinism & IV. Excessive secretion of growth hormone.

Choose the correct answer from the options given below:

  • (1) A-IV, B-II, C-I, D-III
  • (2) A-III, B-IV, C-II, D-I
  • (3) A-III, B-IV, C-I, D-II
  • (4) A-I, B-III, C-II, D-IV
Correct Answer: (4) A-I, B-III, C-II, D-IV
View Solution

- Exophthalmic goiter is caused by hyper secretion of thyroid hormone and protruding eyeballs (I).

- Acromegaly is caused by excessive secretion of growth hormone (III).

- Cushing’s syndrome is caused by excess secretion of cortisol, moon face, and hyperglycemia (II).

- Cretinism is caused by hypo-secretion of thyroid hormone and stunted growth (IV).

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Exophthalmic goiter, acromegaly, Cushing’s syndrome, and cretinism are all endocrine disorders caused by hormonal imbalances.


Question 191:

Match List I with List II 

List-I & List-II
A. Unicellular glandular epithelium & I. Salivary glands
B. Compound epithelium & II. Pancreas
C. Multicellular glandular epithelium & III. Goblet cells of alimentary canal
D. Endocrine glandular epithelium & IV. Moist surface of buccal cavity

Choose the correct answer from the options given below:

  • (1) A-IV, B-III, C-I, D-II
  • (2) A-III, B-IV, C-I, D-II
  • (3) A-II, B-I, C-IV, D-III
  • (4) A-II, B-I, C-III, D-IV
Correct Answer: (3) A-II, B-I, C-IV, D-III
View Solution

- Unicellular glandular epithelium is represented by Goblet cells of the alimentary canal (II).

- Compound epithelium is found in the moist surface of the buccal cavity (I).

- Multicellular glandular epithelium is represented by salivary glands (IV).

- Endocrine glandular epithelium is found in the pancreas (III).

Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Different types of epithelial tissues are specialized for secretion, absorption, and protection, such as in glands and the digestive system.


Question 192:

Match List I with List II 

List I & List II
A. RNA polymerase III & I. snRNPs
B. Termination of transcription & II. Promotor
C. Splicing of Exons & III. Rho factor
D. TATA box & IV. SnRNAs, tRNA

Choose the correct answer from the options given below:

  • (1) A-III, B-II, C-IV, D-I
  • (2) A-III, B-IV, C-I, D-II
  • (3) A-IV, B-III, C-I, D-II
  • (4) A-II, B-IV, C-I, D-III
Correct Answer: (2) A-III, B-IV, C-I, D-II
View Solution

- RNA polymerase III synthesizes SnRNAs and tRNA (III).

- Termination of transcription is related with the Rho factor (IV).

- Splicing of Exons is catalyzed by snRNPs (I).

- The TATA box is part of the Promotor region (II).

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: RNA polymerase III is responsible for synthesizing small RNAs like snRNA and tRNA, while the TATA box is involved in the initiation of transcription.


Question 193:

Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.

  • (1) ICSH, Interstitial cells, Leydig cells, spermiogenesis.
  • (2) FSH, Sertoli cells, Leydig cells, spermatogenesis.
  • (3) ICSH, Leydig cells, Sertoli cells, spermatogenesis.
  • (4) FSH, Leydig cells, Sertoli cells, spermiogenesis.
Correct Answer: (4) FSH, Leydig cells, Sertoli cells, spermiogenesis.
View Solution

- FSH (Follicle Stimulating Hormone) is essential for the regulation of Sertoli cells, which support the development of sperm cells.

- Leydig cells are responsible for the secretion of testosterone, which plays a crucial role in spermatogenesis.
- Spermiogenesis refers to the final process in sperm development, where mature sperm are formed.

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: FSH and Leydig cells work together to regulate spermatogenesis, while spermiogenesis involves the transformation of spermatids into mature sperm.


Question 194:

Regarding catalytic cycle of an enzyme action, select the correct sequential steps:

A. Substrate enzyme complex formation.

B. Free enzyme ready to bind with another substrate.

C. Release of products.

D. Chemical bonds of the substrate broken.

E. Substrate binding to active site.

Choose the correct answer from the options given below:

  • (1) A, E, B, D, C
  • (2) B, A, C, D, E
  • (3) E, D, C, B, A
  • (4) E, A, D, C, B
Correct Answer: (2) B, A, C, D, E
View Solution

The correct sequence of steps in the catalytic cycle of enzyme action is:

1. Free enzyme ready to bind with another substrate (B)

2. Substrate enzyme complex formation (A)

3. Release of products (C)

4. Chemical bonds of the substrate broken (D)

5. Substrate binding to active site (E)

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: The catalytic cycle of enzyme action involves substrate binding, bond breaking, product release, and enzyme resetting.


Question 195:

The following are the statements about non-chordates:

A. Pharynx is perforated by gill slits.

B. Notochord is absent.

C. Central nervous system is dorsal.

D. Heart is dorsal if present.

E. Post anal tail is absent.

Choose the correct answer from the options given below:

  • (1) A, B and D only
  • (2) B, D and E only
  • (3) B, C and D only
  • (4) A and C only
Correct Answer: (3) B, C and D only
View Solution

- Non-chordates lack a notochord (B), and the heart is dorsal if present (D).

- Non-chordates may also lack a post-anal tail (E).

- Pharyngeal gill slits and a dorsal central nervous system are characteristic features of chordates, not non-chordates.

Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Non-chordates do not possess a notochord or post-anal tail and typically have a dorsal heart if present.


Question 196:

Match List I with List II related to digestive system of cockroach. 

List I & List II
A. Structures for storing of food & I. Gizzard
B. Ring: 6-8 blind tubules at junction of foregut and midgut. & II. Gastric Caeca
C. Ring: 100-150 yellow filaments at junction of midgut and hindgut. & III. Malpighian tubules
D. Structures for grinding the food. & IV. Crop

Choose the correct answer from the options given below:

  • (1) A-I, B-II, C-III, D-IV
  • (2) A-IV, B-III, C-II, D-I
  • (3) A-III, B-II, C-IV, D-I
  • (4) A-IV, B-II, C-III, D-I
Correct Answer: (4) A-IV, B-II, C-III, D-I
View Solution

- The Crop (A) is used for storing food (IV).

- The Gastric Caeca (B) are the rings of tubules at the junction of foregut and midgut (II).

- The Malpighian tubules (C) are located at the junction of midgut and hindgut (III).

- The Gizzard (D) is responsible for grinding the food (I).

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: The digestive system of cockroaches includes structures for food storage (crop), grinding (gizzard), and waste removal (Malpighian tubules).


Question 197:

Given below are two statements:

Statement I: The cerebral hemispheres are connected by nerve tract known as corpus callosum.

Statement II: The brain stem consists of the medulla oblongata, pons and cerebrum.


Choose the correct answer from the options given below:

  • (1) Both Statement I and Statement II are incorrect.
  • (2) Statement I is correct but Statement II is incorrect.
  • (3) Statement I is incorrect but Statement II is correct.
  • (4) Both Statement I and Statement II are correct.
Correct Answer: (2) Statement I is correct but Statement II is incorrect.
View Solution

- Statement I is correct because:

The corpus callosum is the structure connecting the two cerebral hemispheres.

- Statement II is incorrect because:

The brain stem consists of the medulla oblongata, pons, and midbrain, not the cerebrum.

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: The corpus callosum connects the cerebral hemispheres, and the brain stem consists of the medulla oblongata, pons, and midbrain, not the cerebrum.


Question 198:

Match List I with List II 

List I & List II
A. Mesozoic Era & I. Lower invertebrates
B. Proterozoic Era & II. Fish \& Amphibia
C. Cenozoic Era & III. Birds \& Reptiles
D. Paleozoic Era & IV. Mammals

Choose the correct answer from the options given below:

  • (1) A-III, B-I, C-II, D-IV
  • (2) A-I, B-II, C-IV, D-III
  • (3) A-III, B-I, C-IV, D-II
  • (4) A-II, B-I, C-III, D-IV
Correct Answer: (3) A-III, B-I, C-IV, D-II
View Solution

- The Mesozoic Era is related with birds and reptiles (III).

- The Proterozoic Era is related with lower invertebrates (I).

- The Cenozoic Era is related with mammals (IV).

- The Paleozoic Era is related with fish and amphibians (II).

Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: The Mesozoic Era is often called the age of reptiles and birds, while the Cenozoic Era is known for the rise of mammals.


Question 199:

As per ABO blood grouping system, the blood group of father is B+, mother is A+ and child is O+. Their respective genotype can be:

  • (1) B only
  • (2) C \& B only
  • (3) D \& E only
  • (4) A only
Correct Answer: (2) C \& B only
View Solution

- The father has blood group B+, and his genotype can be IB IB or IB i.

- The mother has blood group A+, and her genotype can be IA IA or IA i.

- The child has blood group O+, and the genotype must be ii.

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: In ABO blood grouping, the O blood group results from inheriting an O allele from both parents (ii).


Question 200:

Given below are two statements:

Statement I: Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced.

Statement II: Both bone marrow and thymus provide micro environments for the development and maturation of T-lymphocytes.

Choose the correct answer from the options given below:

  • (1) Both Statement I and Statement II are incorrect.
  • (2) Statement I is correct but Statement II is incorrect.
  • (3) Statement I is incorrect but Statement II is correct.
  • (4) Both Statement I and Statement II are correct.
Correct Answer: (3) Statement I is incorrect but Statement II is correct.
View Solution

- Statement I is incorrect because:

Bone marrow is not the primary site for the production of all blood cells, including lymphocytes.

- Statement II is correct because:

Both bone marrow and thymus are crucial in the development and maturation of T-lymphocytes.

Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Bone marrow produces blood cells, while the thymus is essential for the maturation of T-lymphocytes.

*The article might have information for the previous academic years, please refer the official website of the exam.

Ask your question

Subscribe To Our News Letter

Get Latest Notification Of Colleges, Exams and News

© 2026 Patronum Web Private Limited