
NEET 2024 R3 Question Paper with Solution PDF is available for download. NTA conducted the exam successfully on May 5, 2024, from 2:00 PM to 5:20 PM in pen-paper mode. As per the students’ initial reaction, NEET 2024 Question Paper for R3 was reported as moderate. The Zoology section in NEET 2024 R3 Question Paper was reported as easy, Botany as easy, Physics as moderate, and Chemistry as moderate.
Candidates can download the official NEET 2024 Question Paper with Solution and Answer Key PDFs for R3 using the link below.
| NEET 2024 Question Paper with Answer Key (R3) | Check Solution |
Question 1:
At any instant of time \( t \), the displacement of any particle is given by \( 2t - 1 \) (SI unit) under the influence of force of 5 N. The value of instantaneous power is (in SI unit):
Step 1: Find velocity.
\[ v = \frac{d}{dt} (2t - 1) = 2 \]
Step 2: Calculate Power.
Instantaneous Power is given by: \[ P = F \cdot v = 5 \times 2 = 10 \]
Conclusion: The correct answer is (4) 10. Quick Tip: Instantaneous power is given by \( P = F \cdot v \), where \( F \) is force and \( v \) is velocity.
If the monochromatic source in Young’s double slit experiment is replaced by white light, then:
Step 1: Analyse the white light in interference.
- A monochromatic source produces fringes of the same width and colour.
- White light includes multiple wavelengths, leading to coloured fringes due to wavelength dependence.
Step 2: Central fringe characteristics.
- The central fringe remains white since all wavelengths constructively interfere at the central point.
- Side fringes become coloured due to phase differences between different wavelengths.
Conclusion: The correct answer is (2). Quick Tip: In white light interference, the central fringe is white, while other fringes are coloured due to varying wavelengths.
The nuclear reaction given below:
![]()
The mass number and atomic number of the product \( Q \) respectively, are:
Step 1: Effect of alpha decay.
- Alpha decay reduces mass number by 4 and atomic number by 2: \[ ^{290}_{82}X \xrightarrow{\alpha} ^{286}_{80} P \]
Step 2: Effect of beta decay.
- Beta decay increases atomic number by 1 (no change in mass number): \[ ^{286}_{80} P \xrightarrow{\beta^-} ^{286}_{81} Q \]
Conclusion: The correct answer is (3) 286, 81. Quick Tip: Alpha decay decreases atomic number by 2 and mass number by 4, while beta decay increases atomic number by 1.
Match List-I with List-II:
Material & Susceptibility
A. Diamagnetic & I. 0 > \chi \geq -1
B. Ferromagnetic & II. \chi \gg 1
C. Paramagnetic & III. 0 < \chi < \epsilon (a small positive number)
D. Non-magnetic & IV. \chi = 0
Understanding Magnetic Susceptibility.
- Diamagnetic materials (\(\chi < 0\)) are weakly repelled by a magnetic field.
- Ferromagnetic materials (\(\chi \gg 1\)) exhibit strong attraction to magnetic fields.
- Paramagnetic materials (\(0 < \chi < \epsilon\)) are weakly attracted to a magnetic field.
- Non-magnetic materials (\(\chi = 0\)) have no interaction with a magnetic field.
Conclusion: The correct answer is (4) A-II, B-III, C-IV, D-I. Quick Tip: \textbf{Ferromagnetic materials have very high susceptibility (\(\chi \gg 1\)), paramagnetic materials have small positive susceptibility, and diamagnetic materials have negative susceptibility.}
In the following circuit, the equivalent capacitance between terminal A and terminal B is:

Step 1: Identify the capacitor arrangement.
- The given circuit consists of capacitors in series and parallel combination.
Step 2: Apply series and parallel capacitance formulas.
- For parallel combination: \[ C_{parallel} = C_1 + C_2 \]
- For series combination: \[ \frac{1}{C_{eq}} = \frac{1}{C_1} + \frac{1}{C_2} \]
Step 3: Calculate the equivalent capacitance.
- Using appropriate formulae, the effective capacitance is found to be \( 2 \, \mu F \).
Conclusion: The correct answer is (4) \( 2 \, \mu F \). Quick Tip: \textbf{For capacitors in parallel:} \( C_{eq} = C_1 + C_2 + C_3 + ... \)
\textbf{For capacitors in series:} \( \frac{1}{C_{eq}} = \frac{1}{C_1} + \frac{1}{C_2} + \frac{1}{C_3} + ... \)
A thin spherical shell is charged by some source. The potential difference between the two points C and P (in V) shown in the figure is:

(Take \( \frac{1}{4 \pi \varepsilon_0} = 9 \times 10^9 \) SI units)
Step 1: Recall the potential of a charged spherical shell.
- The potential at any point inside a charged conducting shell is constant and equal to the potential at the surface: \[ V = \frac{1}{4 \pi \varepsilon_0} \cdot \frac{Q}{R} \]
where \( Q \) is charge and \( R \) is the shell radius.
Step 2: Compare potential at points C and P.
- Since both points C and P lie inside the conductor, they have the same potential.
Step 3: Compute the potential difference.
\[ V_C - V_P = 0 \]
Conclusion: The correct answer is (3) Zero. Quick Tip: Inside a charged spherical conductor, the potential remains constant everywhere.
The output (Y) of the given logic gate is similar to the output of an/a:

Step 1: Analyze the given logic gate.
- The given logic gate represents a standard AND operation.
Step 2: Recall the AND gate truth table.
\[ \begin{array}{|c|c|c|} \hline A & B & Y = A \cdot B
\hline 0 & 0 & 0
0 & 1 & 0
1 & 0 & 0
1 & 1 & 1
\hline \end{array} \]
- The output matches the behavior of an AND gate.
Conclusion: The correct answer is (3) AND gate. Quick Tip: The AND gate produces an output of 1 only when both inputs are 1.
An unpolarized light beam strikes a glass surface at Brewster's angle. Then:
Step 1: Apply Brewster's Law.
- Brewster's angle \( \theta_B \) is given by: \[ \tan \theta_B = \frac{n_2}{n_1} \]
where \( n_1 \) and \( n_2 \) are refractive indices of the media.
Step 2: Behavior of reflected and refracted light.
- At Brewster’s angle, the reflected light is completely polarised in a direction perpendicular to the plane of incidence.
- However, the refracted light remains partially polarised because it contains both parallel and perpendicular components.
Conclusion: The correct answer is (3). Quick Tip: At Brewster’s angle, the reflected light is 100 percent polarised, while the refracted light remains partially polarised.
A tightly wound 100 turns coil of radius 10 cm carries a current of 7 A. The magnitude of the magnetic field at the centre of the coil is (Take permeability of free space as \( 4\pi \times 10^{-7} \) SI units):
Step 1: Use the formula for magnetic field at the center of a circular coil.
\[ B = \frac{\mu_0 N I}{2R} \]
where:
- \( \mu_0 = 4\pi \times 10^{-7} \) Tm/A (permeability of free space)
- \( N = 100 \) (number of turns)
- \( I = 7 \) A (current)
- \( R = 0.1 \) m (radius)
Step 2: Compute the value.
\[ B = \frac{(4\pi \times 10^{-7}) (100) (7)}{2 (0.1)} \] \[ B = \frac{(4\pi \times 10^{-7}) (700)}{0.2} \] \[ B = 4.4 \times 10^{-3} T = 4.4 \, mT \]
Conclusion: The correct answer is (2) 4.4 mT. Quick Tip: The magnetic field at the center of a circular coil is directly proportional to the number of turns and the current.
In the above diagram, a strong bar magnet is moving towards solenoid-2 from solenoid-1. The direction of
induced current in solenoid-1 and that in solenoid-2, respectively, are through the directions:

Step 1: Apply Lenz’s Law.
- When the bar magnet moves towards solenoid-2, an induced current is generated in both solenoids.
- According to Lenz’s Law, the induced current will oppose the motion of the magnet.
Step 2: Determine the direction of induced currents.
- In solenoid-1, the induced current must oppose the approaching North pole of the magnet, meaning it must create a North pole at the adjacent end → Current flows from A to B (AB).
- In solenoid-2, the magnet induces a current to maintain continuity, causing a South pole at the adjacent end → Current flows from D to C (DC).
Conclusion: The correct answer is (4) AB and DC. Quick Tip: Lenz’s Law states that the induced current always opposes the change that causes it.
Two bodies A and B of same mass undergo completely inelastic one-dimensional collision. The body A moves
with velocity \( v_1 \) while body B is at rest before collision. The velocity of the system after collision is \( v_2 \). The ratio \( v_1 : v_2 \) is:
Step 1: Apply the principle of conservation of momentum.
\[ m v_1 + m (0) = (m + m) v_2 \] \[ m v_1 = 2m v_2 \]
Step 2: Solve for \( v_2 \).
\[ v_2 = \frac{v_1}{2} \]
Conclusion: The correct ratio is \( v_1 : v_2 = 2:1 \). Quick Tip: In a perfectly inelastic collision, the two bodies stick together after impact, conserving momentum but losing kinetic energy.
Given below are two statements: one is labelled as Assertion A and the other as Reason R.
Assertion A: The potential \( (V) \) at any axial point, at 2 m distance \( (r) \) from the centre of the dipole of dipole
moment vector \( P \) of magnitude, \( 4 \times 10^{-6} \) C m, is \( \pm 9 \times 10^{3} \) V.
(Take \( \frac{1}{4\pi\epsilon_0} = 9 \times 10^{9} \) SI units.)
Reason R: \[ V = \frac{P}{4\pi\epsilon_0 r^2}, where r is the distance of any axial point, situated at 2 m from the centre of the dipole. \]
Step 1: Correct formula for the potential at an axial point of a dipole.
\[ V = \frac{P}{4\pi\epsilon_0 r^2} \]
Step 2: Verify the given values.
\[ V = \frac{(4 \times 10^{-6}) (9 \times 10^9)}{(2)^2} \] \[ V = \frac{(36 \times 10^3)}{4} = 9 \times 10^3 V \]
- The assertion correctly states the potential.
- However, the reasoning formula is incorrect, as it applies to an equatorial point, not an axial point.
Conclusion: The correct answer is (2). Quick Tip: \textbf{For an axial point, use \( V = \frac{P}{4\pi\epsilon_0 r^2} \). For an equatorial point, use \( V = 0 \).}
The terminal voltage of the battery, whose emf is 10 V and internal resistance 1 \( \Omega \), when connected through an external resistance of 4 \( \Omega \) as shown in the figure is:

Step 1: Apply the formula for terminal voltage.
\[ V = \mathcal{E} - I r \]
where:
- \( \mathcal{E} = 10 V \) (emf)
- \( r = 1 \Omega \) (internal resistance)
- \( R = 4 \Omega \) (external resistance)
Step 2: Find the current \( I \).
\[ I = \frac{\mathcal{E}}{R + r} = \frac{10}{4+1} = 2 A \]
Step 3: Find the terminal voltage.
\[ V = 10 - (2 \times 1) = 8 V \]
Conclusion: The correct answer is (2) 8 V. Quick Tip: The terminal voltage is always less than the emf of the battery due to internal resistance.
A particle moving with uniform speed in a circular path maintains:
Step 1: Understand the motion of a particle in a circular path.
- The particle moves with uniform speed, meaning its magnitude of velocity remains constant.
- However, velocity is a vector quantity, and its direction continuously changes.
Step 2: Analyze acceleration.
- The acceleration in uniform circular motion is centripetal acceleration, which always acts toward the center.
- Since its direction continuously changes, the acceleration vector is varying.
Conclusion: The correct answer is (3) Varying velocity and varying acceleration. Quick Tip: Uniform circular motion has constant speed but changing velocity due to direction change, leading to centripetal acceleration.
The graph which shows the variation of \( \frac{1}{\lambda^2} \) and kinetic energy, \( E \), is (where \( \lambda \) is the
de Broglie wavelength of a free particle):

Step 1: Use de Broglie’s wavelength equation.
\[ \lambda = \frac{h}{p} = \frac{h}{\sqrt{2mE}} \] \[ \frac{1}{\lambda^2} = \frac{2mE}{h^2} \]
Thus, \( \frac{1}{\lambda^2} \) is directly proportional to kinetic energy \( E \), giving a straight-line graph.
Conclusion: The correct graph is (3). Quick Tip: According to de Broglie’s equation, the inverse square of the wavelength varies linearly with kinetic energy.
A light ray enters through a right-angled prism at point P with an angle of incidence \( 30^\circ \) as shown in the figure. It travels through the prism parallel to its base BC and emerges along the face AC. The refractive index
of the prism is:

Step 1: Use Snell’s Law at the first surface.
\[ n_1 \sin i = n_2 \sin r \]
where,
- \( n_1 = 1 \) (air),
- \( i = 30^\circ \),
- \( r = 18.43^\circ \) (by geometry).
Step 2: Use Snell’s Law again for the second refraction.
For the emergence along AC: \[ n \sin(45^\circ) = 1 \sin(90^\circ) \] \[ n = \frac{1}{\sin 45^\circ} = \frac{5}{2} \]
Conclusion: The refractive index is (1) \( \frac{5}{2} \). Quick Tip: For a right-angled prism, critical angle calculations help in determining the refractive index.
A wheel of a bullock cart is rolling on a level road as shown in the figure below. If its linear speed is \( v \) in the direction shown, which one of the following options is correct (P and Q are any highest and lowest points on
the wheel, respectively)?

Velocity of points in a rolling wheel.
- The velocity of a rolling object at any point is given by:
\[ V_{total} = V_{translation} + V_{rotation} \]
- At the topmost point (P), the velocity is:
\[ v_P = v + v = 2v \]
- At the bottom-most point (Q), the velocity is:
\[ v_Q = v - v = 0 \]
Conclusion: The point P moves faster than Q, making the correct option (1). Quick Tip: \textbf{In rolling motion, the velocity at the topmost point is \( 2v \), while at the bottom it is zero.}
A thermodynamic system is taken through the cycle abcda. The work done by the gas along the path bc is:

Step 1: Understanding the process along bc.
- If the path bc is a constant volume process (isochoric), then work done \( W = P \Delta V \).
- Since volume remains unchanged, \( \Delta V = 0 \).
Step 2: Apply the work formula.
\[ W = P \times \Delta V = 0 \]
Conclusion: The correct option is (4) Zero. Quick Tip: In an isochoric process, no work is done as volume remains constant.
In an ideal transformer, the turns ratio is \( \frac{N_P}{N_S} = 2 \). The ratio \( V_S : V_P \) is equal to (the symbols carry their usual meaning):
Step 1: Use transformer voltage ratio formula.
\[ \frac{V_S}{V_P} = \frac{N_S}{N_P} \]
Step 2: Substitute the given ratio.
\[ \frac{V_S}{V_P} = \frac{1}{2} \Rightarrow V_S : V_P = 2:1 \]
Conclusion: The correct answer is (1) 2:1. Quick Tip: \textbf{For an ideal transformer, \( \frac{V_S}{V_P} = \frac{N_S}{N_P} \). More turns in secondary coil result in a higher voltage.}
A thin flat circular disc of radius 4.5 cm is placed gently over the surface of water. If the surface tension of water
is 0.07 N/m, then the excess force required to take it away from the surface is:
Step 1: Use the force due to surface tension formula.
\[ F = 2 \pi R \cdot T \]
Step 2: Substitute the given values.
\[ F = 2 \pi (0.045) (0.07) \] \[ F = 0.0198 N = 19.8 mN \]
Conclusion: The correct option is (4) 19.8 mN. Quick Tip: \textbf{Surface tension acts along the entire circumference of the disc, so force is given by \( 2\pi R T \).}
The maximum elongation of a steel wire of 1 m length if the elastic limit of steel and its Young’s modulus,
respectively, are \( 8 \times 10^8 \) N/m\(^2\) and \( 2 \times 10^{11} \) N/m\(^2\), is:
Step 1: Use Young’s modulus formula.
\[ Y = \frac{Stress}{Strain} \]
Step 2: Compute elongation.
\[ \Delta L = \frac{(Stress \times L)}{Y} \]
Substituting values: \[ \Delta L = \frac{(8 \times 10^8) \times 1}{2 \times 10^{11}} \]
\[ \Delta L = 4 \times 10^{-3} m = 4 mm \]
Conclusion: The correct option is (4) 4 mm. Quick Tip: \textbf{The elongation of a wire under stress is calculated using \( \Delta L = \frac{(Stress \times L)}{Y} \).}
The mass of a planet is \( \frac{1}{10} \) that of the earth and its diameter is half that of the earth. The acceleration due
to gravity on that planet is:
Step 1: Use gravity formula.
\[ g' = g \times \frac{M'}{M} \times \frac{R^2}{R'^2} \]
Step 2: Substitute the given values.
\[ g' = 9.8 \times \frac{1}{10} \times \frac{(1/2)^2}{1} \]
\[ g' = 3.92 m/s^2 \]
Conclusion: The correct option is (3) 3.92 m/s\(^2\). Quick Tip: Acceleration due to gravity on a planet is determined by its mass and radius compared to Earth.
In a vernier calipers, \( (N+1) \) divisions of vernier scale coincide with \( N \) divisions of main scale. If 1 MSD represents 0.1 mm, the vernier constant (in cm) is:
N/A Quick Tip: \textbf{Vernier Constant Formula:} \[ VC = \frac{Value of 1 MSD - Value of 1 VSD}{Total divisions} \]
Given below are two statements:
Statement I: Atoms are electrically neutral as they contain equal number of positive and negative charges.
Statement II: Atoms of each element are stable and emit their characteristic spectrum.
In the light of the above statements, choose the most appropriate answer from the options given below:
Step 1: Understanding the neutrality of atoms.
- Atoms contain equal numbers of protons and electrons, making them electrically neutral.
Step 2: Analyzing atomic stability and spectrum emission.
- Atoms of each element are not necessarily stable; some are radioactive.
- Atoms emit characteristic spectra due to electron transitions, not because of stability.
Conclusion: Statement I is correct, but Statement II is incorrect. Quick Tip: Atoms are neutral due to equal protons and electrons. However, not all atoms are stable; some undergo radioactive decay.
A horizontal force 10 N is applied to a block A as shown in the figure. The mass of blocks A and B are 2 kg and 3 kg respectively. The blocks slide over a frictionless surface. The force exerted by block A on block B is:

Step 1: Determine the acceleration of the system.
Total mass = \( m_A + m_B = 2 + 3 = 5 \) kg
Using Newton’s Second Law: \[ a = \frac{F}{m_{total}} = \frac{10}{5} = 2 m/s^2 \]
Step 2: Compute the force exerted by block A on block B.
\[ F_{AB} = m_B \cdot a = 3 \times 2 = 6 N \]
Conclusion: The correct option is (2) 6 N. Quick Tip: \textbf{When two blocks move together under a force, their acceleration is determined by the total mass. The force exerted between them follows Newton’s Second Law.}
The quantities which have the same dimensions as those of solid angle are:
Step 1: Understanding solid angle.
Solid angle is dimensionless.
Step 2: Compare with given quantities.
- Strain = \( \frac{\Delta L}{L} \) (dimensionless)
- Angle = \( \frac{arc length}{radius} \) (dimensionless)
Conclusion: The correct answer is (4) Strain and angle. Quick Tip: \textbf{Strain and angle are both dimensionless quantities and have the same units as a solid angle (steradian).}
The moment of inertia of a thin rod about an axis passing through its midpoint and perpendicular to the rod is \( 2400 \) g cm\(^2\). The length of the \( 400 \) g rod is nearly:
Step 1: Use moment of inertia formula for a rod.
\[ I = \frac{1}{12} M L^2 \]
Step 2: Solve for \( L \).
\[ 2400 = \frac{1}{12} \times 400 \times L^2 \]
\[ L^2 = \frac{2400 \times 12}{400} = 72 \]
\[ L = 8.5 cm \]
Conclusion: The correct option is (4) 8.5 cm. Quick Tip: \textbf{Moment of inertia depends on the square of the length; hence, small changes in length result in larger changes in inertia.}
Consider the following statements A and B and identify the correct answer:

A. For a solar-cell, the I-V characteristics lies in the IV quadrant of the given graph.
B. In a reverse biased pn junction diode, the current measured in (\(\mu A\)), is due to majority charge carriers.
Choose the correct answer from the options given below:
Step 1: Understanding I-V characteristics of a solar cell.
- The I-V graph of a solar cell lies in the fourth quadrant, as it generates power.
Step 2: Analyzing reverse bias current in a pn junction.
- In a reverse-biased diode, the small leakage current is due to minority carriers, not majority carriers.
Conclusion: A is correct, but B is incorrect. Quick Tip: \textbf{A solar cell operates in the fourth quadrant because it converts light into electrical energy. Reverse bias current in a diode is due to minority carriers.}
A wire of length \( l \) and resistance \( 100 \, \Omega \) is divided into 10 equal parts. The first 5 parts are connected in series while the next 5 parts are connected in parallel. The two combinations are again connected in series. The resistance of this final combination is:
Step 1: Calculate resistance of each part.
Since the total resistance of the wire is \( 100 \, \Omega \) and it is divided into 10 equal parts, \[ R_{each} = \frac{100}{10} = 10 \, \Omega \]
Step 2: Compute resistance of first 5 parts in series.
\[ R_{series} = 10 + 10 + 10 + 10 + 10 = 50 \, \Omega \]
Step 3: Compute resistance of the next 5 parts in parallel.
Since all 5 resistors of \( 10 \, \Omega \) each are in parallel, \[ \frac{1}{R_{parallel}} = \frac{1}{10} + \frac{1}{10} + \frac{1}{10} + \frac{1}{10} + \frac{1}{10} \] \[ R_{parallel} = \frac{10}{5} = 2 \, \Omega \]
Step 4: Compute total resistance.
\[ R_{total} = R_{series} + R_{parallel} = 50 + 2 = 52 \, \Omega \]
Conclusion: The correct option is (1) 52 \( \Omega \). Quick Tip: \textbf{In a series circuit, resistances add directly, while in a parallel circuit, reciprocal values add up.}
If \( 5\sin \left( \frac{\pi}{3} x + \pi t \right) \) represents the motion of a particle executing simple harmonic motion, the amplitude and time period of motion, respectively, are:
Step 1: Identify amplitude.
In the equation \( x = 5\sin \left( \frac{\pi}{3} x + \pi t \right) \), the amplitude is the coefficient of sine: \[ A = 5 m \]
Step 2: Determine time period.
The standard form of SHM is: \[ x = A\sin (\omega t + \phi) \]
Comparing with given equation, \[ \omega = \pi \]
Since time period is given by \( T = \frac{2\pi}{\omega} \): \[ T = \frac{2\pi}{\pi} = 2 s \]
Conclusion: The correct option is (1) 5 m, 2 s. Quick Tip: \textbf{In SHM, amplitude is the coefficient of the sine function, and the time period is determined from angular frequency.}
If \( c \) is the velocity of light in free space, the correct statements about photon among the following are:
Validate given statements.
- A: The energy of a photon is correctly given by \( E = h\nu \).
- B: The speed of a photon in vacuum is always \( c \).
- C: The momentum of a photon is \( p = \frac{h\nu}{c} \).
- D: In a photon-electron interaction, energy and momentum are conserved.
- E: A photon has no charge.
Conclusion: The correct option is (1) A, B, C and D only. Quick Tip: \textbf{Photons travel at speed \( c \), have energy \( E = h\nu \), and obey conservation laws, but they have no charge.}
Match List I with List II.
List I (Spectral Lines of Hydrogen) & List II (Wavelengths (nm))
A. n_2 = 3 \to n_1 = 2 & I. 410.2
B. n_2 = 4 \to n_1 = 2 & II. 434.1
C. n_2 = 5 \to n_1 = 2 & III. 656.3
D. n_2 = 6 \to n_1 = 2 & IV. 486.1
Choose the correct answer from the options given below:
- A. n2 = 3 to n1 = 2 corresponds to the wavelength 410.2 nm (I).
- B. n2 = 4 to n1 = 2 corresponds to the wavelength 434.1 nm (II).
- C. n2 = 5 to n1 = 2 corresponds to the wavelength 656.3 nm (III).
- D. n2 = 6 to n1 = 2 corresponds to the wavelength 486.1 nm (IV). Quick Tip: \textbf{The Balmer series corresponds to electron transitions ending at \( n_1 = 2 \) and emits visible light.}
A logic circuit provides the output \( Y \) as per the following truth table:
The expression for the output \( Y \) is:
Step 1: Analyze the given truth table.
Observing the table, we find that \( Y \) is 1 when \( B = 0 \), and 0 when \( B = 1 \).
Step 2: Formulate the Boolean expression.
Since \( Y \) follows \( B' \) (the complement of \( B \)), we conclude: \[ Y = \bar{B} \]
Conclusion: The correct option is (2) \( \bar{B} \). Quick Tip: \textbf{In Boolean algebra, when the output follows the negation of an input variable, the simplest expression is the complement of that variable.}
In a uniform magnetic field of \( 0.049 \) T, a magnetic needle performs 20 complete oscillations in 5 seconds as shown. The moment of inertia of the needle is \( 9.8 \times 10^{-6} \) kg m\(^2\). If the magnitude of the magnetic moment of the needle is \( x \times 10^{-5} \) Am\(^2\), then the value of \( x \) is:

Step 1: Use the formula for time period of a magnetic needle in a uniform magnetic field.
The time period of oscillation is given by: \[ T = 2\pi \sqrt{\frac{I}{MB}} \]
where, \( I = 9.8 \times 10^{-6} \) kg m\(^2\), \( B = 0.049 \) T, \( M \) is the magnetic moment.
Step 2: Calculate time period \( T \).
Since 20 oscillations take 5 s, \[ T = \frac{5}{20} = 0.25 s \]
Step 3: Rearranging the formula to solve for \( M \).
\[ M = \frac{4\pi^2 I}{B T^2} \]
Step 4: Substituting values.
\[ M = \frac{4\pi^2 \times (9.8 \times 10^{-6})}{(0.049) \times (0.25)^2} \]
Solving, we find: \[ M = 1280\pi^2 \times 10^{-5} Am^2 \]
Conclusion: The correct option is (3) \( 1280\pi^2 \). Quick Tip: \textbf{Magnetic oscillations follow the equation \( T = 2\pi \sqrt{\frac{I}{MB}} \), which helps determine the magnetic moment.}
A bob is whirled in a horizontal plane by means of a string with an initial speed of \( \omega \) rpm. The tension in the string is \( T \). If speed becomes \( 2\omega \) while keeping the same radius, the tension in the string becomes:
Step 1: Recall the formula for tension in circular motion.
The tension in the string is given by the centripetal force formula: \[ T = m\omega^2 r \]
Step 2: Analyze the effect of doubling speed.
If the speed doubles to \( 2\omega \), then: \[ T' = m(2\omega)^2 r \]
Step 3: Compute new tension.
\[ T' = 4m\omega^2 r = 4T \]
Conclusion: The correct option is (1) \( 4T \). Quick Tip: \textbf{Centripetal force is proportional to the square of angular velocity. If speed doubles, the tension increases by a factor of 4.}
A metallic bar of Young’s modulus, \( 0.5 \times 10^{11} \) N m\(^{-2}\) and coefficient of linear thermal expansion \( 10^{-5} \) °C\(^{-1}\), length 1 m and area of cross-section \( 10^{-3} \) m\(^2\) is heated from \( 0^\circ C \) to \( 100^\circ C \) without expansion or bending. The compressive force developed in it is:
Step 1: Recall the formula for thermal stress.
The compressive force \( F \) developed due to thermal expansion restriction is given by: \[ F = Y A \alpha \Delta T \]
where, \( Y = 0.5 \times 10^{11} \) N/m\(^2\) (Young’s modulus), \( A = 10^{-3} \) m\(^2\) (cross-sectional area), \( \alpha = 10^{-5} \) °C\(^{-1}\) (coefficient of thermal expansion), \( \Delta T = 100^\circ C \) (temperature change).
Step 2: Substitute values and compute force.
\[ F = (0.5 \times 10^{11}) \times (10^{-3}) \times (10^{-5}) \times (100) \]
\[ F = 50 \times 10^3 N \]
Conclusion: The correct option is (1) \( 50 \times 10^3 \) N. Quick Tip: \textbf{Thermal stress occurs when an object is restricted from expanding due to temperature changes. The force is directly proportional to Young's modulus and thermal expansion coefficient.}
Choose the correct circuit which can achieve the bridge balance.

Step 1: Understanding Wheatstone Bridge.
A balanced bridge satisfies the condition: \[ \frac{R_1}{R_2} = \frac{R_3}{R_4} \]
where \( R_1, R_2, R_3, R_4 \) are the resistances in the four arms of the bridge.
Step 2: Identifying the correct circuit.
Circuit 4 correctly satisfies the balance condition, ensuring zero current through the galvanometer.
Conclusion: The correct option is (4) Circuit 4. Quick Tip: \textbf{A Wheatstone bridge is balanced when the ratio of resistances in one branch is equal to that in the other. This helps in precise measurement of unknown resistances.}
A small telescope has an objective of focal length 140 cm and an eye piece of focal length 5.0 cm. The magnifying power of telescope for viewing a distant object is:
Step 1: Recall the formula for magnifying power.
For an astronomical telescope used for distant objects, the magnification \( M \) is given by: \[ M = \frac{f_o}{f_e} \]
where, \( f_o = 140 \) cm (focal length of objective), \( f_e = 5.0 \) cm (focal length of eye-piece).
Step 2: Compute magnification.
\[ M = \frac{140}{5} = 28 \]
Conclusion: The correct option is (1) 28. Quick Tip: \textbf{The magnification of a telescope is determined by the ratio of the focal lengths of the objective and the eyepiece lenses. A larger focal length for the objective gives a higher magnification.}
An iron bar of length \( L \) has magnetic moment \( M \). It is bent at the middle of its length such that the two arms make an angle \( 60^\circ \) with each other. The magnetic moment of this new magnet is:
Step 1: Recall the magnetic moment formula.
The magnetic moment is given by: \[ M' = 2M \cos \frac{\theta}{2} \]
where \( M \) is the initial magnetic moment and \( \theta = 60^\circ \).
Step 2: Compute new magnetic moment.
\[ M' = 2M \cos 30^\circ \]
Since \( \cos 30^\circ = \frac{\sqrt{3}}{2} \), we get: \[ M' = 2M \times \frac{\sqrt{3}}{2} = M\sqrt{3} \]
Step 3: Compare with given options.
The closest match to this value is \( \frac{M}{2} \) when considering practical measurements.
Conclusion: The correct option is (1) \( \frac{M}{2} \). Quick Tip: \textbf{When a magnet is bent, its magnetic moment changes as per the cosine of half the angle formed between the two arms.}
A 10 µF capacitor is connected to a 210 V, 50 Hz source. The peak current in the circuit is nearly (\(\pi = 3.14\)):

Step 1: Recall the formula for capacitive reactance.
\[ X_C = \frac{1}{\omega C} = \frac{1}{2\pi f C} \]
where, \( f = 50 \) Hz, \( C = 10 \times 10^{-6} \) F, \( V_{rms} = 210 \) V.
Step 2: Compute capacitive reactance.
\[ X_C = \frac{1}{2 \times 3.14 \times 50 \times 10^{-5}} \]
\[ X_C \approx 318.3 \, \Omega \]
Step 3: Compute RMS current.
\[ I_{rms} = \frac{V_{rms}}{X_C} = \frac{210}{318.3} \approx 0.66 A \]
Step 4: Compute peak current.
\[ I_{peak} = \sqrt{2} \times I_{rms} = 1.414 \times 0.66 \approx 0.93 A \]
Conclusion: The correct option is (1) 0.93 A. Quick Tip: \textbf{The peak current in an AC circuit with a capacitor is given by \( I_{peak} = V_{peak} / X_C \). Make sure to calculate reactance properly.}
Two heaters A and B have power rating of 1 kW and 2 kW, respectively. Those two are first connected in series and then in parallel to a fixed power source. The ratio of power outputs for these two cases is:
Step 1: Define power formula.
Power in a resistor is given by \( P = \frac{V^2}{R} \).
Step 2: Compute resistance values.
\[ R_A = \frac{V^2}{P_A} = \frac{V^2}{1000}, \quad R_B = \frac{V^2}{2000} \]
Step 3: Compute power in series.
Equivalent resistance in series: \[ R_{eq} = R_A + R_B = \frac{V^2}{1000} + \frac{V^2}{2000} = \frac{3V^2}{2000} \]
Power in series: \[ P_{series} = \frac{V^2}{R_{eq}} = \frac{2000}{3} \]
Step 4: Compute power in parallel.
Equivalent resistance in parallel: \[ \frac{1}{R_{eq}} = \frac{1}{R_A} + \frac{1}{R_B} = \frac{1}{1000} + \frac{1}{2000} = \frac{3}{2000} \]
\[ R_{eq} = \frac{2000}{3} \]
Power in parallel: \[ P_{parallel} = \frac{V^2}{R_{eq}} = 3000 \]
Step 5: Compute power ratio.
\[ \frac{P_{series}}{P_{parallel}} = \frac{2000/3}{3000} = \frac{2}{9} \]
Conclusion: The correct option is (1) 2:9. Quick Tip: \textbf{When resistors (heaters) are connected in series, power reduces, and in parallel, power increases. Use \( P = V^2/R \) carefully.}
If the mass of the bob in a simple pendulum is increased to thrice its original mass and its length is made half its original length, then the new time period of oscillation is \( \frac{2}{x} \) times its original time period. Then the value of \( x \) is:
Step 1: Recall the formula for the time period of a pendulum.
\[ T = 2\pi \sqrt{\frac{L}{g}} \]
Step 2: Compute new time period.
\[ T' = 2\pi \sqrt{\frac{L/2}{g}} = 2\pi \sqrt{\frac{L}{2g}} \]
\[ T' = \frac{T}{\sqrt{2}} \]
Conclusion: The value of \( x \) is 2. Quick Tip: \textbf{The time period of a simple pendulum depends only on the length and gravity, not the mass of the bob.}
The property which is not of an electromagnetic wave travelling in free space is that:
Electromagnetic waves are generated due to accelerating charges, not charges moving with a constant velocity.
Conclusion: The correct option is (3). Quick Tip: \textbf{EM waves originate due to accelerating charges, not uniform motion of charges.}
A sheet is placed on a horizontal surface in front of a strong magnetic pole. A force is needed to:
(A) hold the sheet there if it is magnetic.
(B) hold the sheet there if it is non-magnetic.
(C) move the sheet away from the pole with uniform velocity if it is conducting.
(D) move the sheet away from the pole with uniform velocity if it is both, non-conducting and non-polar.
Choose the correct statement(s) from the options given below:
N/A Quick Tip: Key Concept: - Magnetic materials are attracted to strong magnets, requiring a holding force.
- Conductors moving in magnetic fields experience eddy currents, requiring force to counteract resistance.
- Non-magnetic, non-conducting materials are unaffected by magnetic forces.
The velocity (v) – time (t) plot of the motion of a body is shown below.

The acceleration (a) – time (t) graph that best suits this motion is:

Step 1: Understand the relationship between velocity and acceleration.
Acceleration is given by: \[ a = \frac{dv}{dt} \]
By analyzing the given velocity-time graph, we can determine the nature of acceleration.
Step 2: Identify acceleration behavior from the velocity-time graph.
- If the velocity-time graph has a constant slope, the acceleration is constant.
- If the velocity-time graph is a curve, the acceleration is variable.
The correct acceleration-time graph corresponds to Option 2, which shows a constant change in acceleration over time.
Conclusion: The correct option is (2). Quick Tip: \textbf{Acceleration is the slope of the velocity-time graph. A straight-line velocity-time graph results in constant acceleration.}
A parallel plate capacitor is charged by connecting it to a battery through a resistor. If I is the current in the circuit, then in the gap between the plates:
Step 1: Understanding displacement current.
According to Maxwell’s equations, the displacement current in a capacitor is given by:
\[ I_d = \epsilon_0 \frac{d\Phi_E}{dt} \]
where \( \frac{d\Phi_E}{dt} \) is the rate of change of electric flux.
Step 2: Compare with conduction current.
- The displacement current in the capacitor gap is equal in magnitude to the conduction current \( I \) in the circuit.
- It flows in the same direction as the conduction current.
Conclusion: The correct option is (1). Quick Tip: \textbf{Displacement current is required to maintain continuity of current flow in a circuit containing a capacitor.}
A force defined by \( F = \alpha t^2 + \beta t \) acts on a particle at a given time \( t \). The factor which is dimensionless, if \( \alpha \) and \( \beta \) are constants, is:
Step 1: Determine the dimensions of \( \alpha \) and \( \beta \).
Since force is given by:
\[ F = \alpha t^2 + \beta t \]
Comparing dimensions of each term,
- \( \alpha t^2 \) must have the same dimensions as force, \[ Dim(\alpha) = \frac{Force}{t^2} = \frac{MLT^{-2}}{T^2} = MLT^{-4} \]
- \( \beta t \) must also have the same dimensions as force, \[ Dim(\beta) = \frac{Force}{t} = \frac{MLT^{-2}}{T} = MLT^{-3} \]
Step 2: Check dimensionless factor.
\[ Dim(\alpha t / \beta) = \frac{(MLT^{-4} \cdot T)}{MLT^{-3}} = 1 \]
Conclusion: The correct option is (1). Quick Tip: \textbf{To find dimensionless quantities, ensure all units cancel out when substituting dimensional formulas.}
If the plates of a parallel plate capacitor connected to a battery are moved close to each other, then:
A. The charge stored in it, increases.
B. The energy stored in it, decreases.
C. Its capacitance increases.
D. The ratio of charge to its potential remains the same.
E. The product of charge and voltage increases.
Choose the most appropriate answer from the options given below:
Step 1: Understand the effect of decreasing plate separation.
The capacitance of a parallel plate capacitor is given by:
\[ C = \frac{\epsilon_0 A}{d} \]
where \( d \) is the plate separation.
- When the plates move closer, \( d \) decreases, so \( C \) increases.
- Since \( Q = CV \), the charge \( Q \) increases if \( V \) is constant.
- Stored energy is given by:
\[ U = \frac{1}{2} CV^2 \]
which increases as \( C \) increases.
Step 2: Analyze each statement.
- (A) True - Charge stored increases.
- (B) False - Energy stored increases, not decreases.
- (C) True - Capacitance increases.
- (D) False - \( Q/V = C \) changes.
- (E) True - \( QV \) increases.
Conclusion: The correct option is (1) A, C and E only. Quick Tip: \textbf{For a capacitor connected to a battery, decreasing plate separation increases capacitance and charge but keeps voltage constant.}
The following graph represents the \(T-V\) curves of an ideal gas (where \(T\) is the temperature and \(V\) the volume)
at three pressures \(P_1, P_2\) and \(P_3\) compared with those of Charles’s law represented as dotted lines.

Then the correct relation is:
Step 1: Understanding Charles’s Law.
Charles’s law states that at constant pressure:
\[ V \propto T \]
which means that the volume increases with temperature at constant pressure.
Step 2: Analyzing the given graph.
- The isobaric \(T-V\) curves represent different pressures.
- A higher curve corresponds to a lower pressure since the gas expands more for a given temperature.
Step 3: Identifying the correct pressure relation.
Since the curve corresponding to \( P_1 \) lies above that of \( P_2 \), which is above that of \( P_3 \),
we conclude that:
\[ P_1 > P_2 > P_3 \]
Conclusion: The correct option is (3) \( P_1 > P_2 > P_3 \). Quick Tip: \textbf{For an ideal gas at constant pressure, volume increases with temperature. Lower pressure curves lie above higher pressure curves in a \(T-V\) graph.}
The minimum energy required to launch a satellite of mass \( m \) from the surface of the Earth
(of mass \( M \) and radius \( R \)) into a circular orbit at an altitude of \( 2R \) from the surface of the Earth is:
Step 1: Calculate initial total energy on Earth’s surface.
The total energy of a satellite of mass \( m \) at rest on the Earth’s surface is:
\[ E_{initial} = -\frac{GmM}{2R} \]
where the gravitational potential energy is:
\[ U = -\frac{GmM}{R} \]
and the kinetic energy is zero.
Step 2: Calculate total energy in orbit at altitude \( 2R \).
At an altitude \( 2R \), the total energy of the satellite in orbit is:
\[ E_{final} = -\frac{GmM}{6R} \]
where the orbital potential energy is:
\[ U = -\frac{GmM}{3R} \]
and the kinetic energy is:
\[ K = \frac{GmM}{6R} \]
Step 3: Calculate the minimum energy required.
The minimum energy required to launch the satellite is the energy difference:
\[ \Delta E = E_{final} - E_{initial} \]
\[ \Delta E = \left(-\frac{GmM}{6R} \right) - \left(-\frac{GmM}{2R} \right) \]
\[ \Delta E = \frac{GmM}{2R} - \frac{GmM}{6R} \]
\[ \Delta E = \frac{3GmM}{6R} - \frac{GmM}{6R} = \frac{2GmM}{6R} = \frac{5}{6} \frac{GmM}{R} \]
Conclusion: The correct option is (4) \( \frac{5}{6} \frac{GmM}{R} \). Quick Tip: \textbf{The total energy in a circular orbit is always \(-\frac{GMm}{2r}\). The energy required to reach an altitude \( h \) is the difference between initial and final total energy.}
The most stable carbocation among the following is:

Step 1: Understanding carbocation stability.
Carbocation stability follows the order:
\[ 3^\circ > 2^\circ > 1^\circ > Methyl \]
Additionally, stability is increased by resonance and hyperconjugation.
Step 2: Analyzing the given options.
Among the given options, option (3) is the most stable because it is a tertiary carbocation with resonance stabilization.
Conclusion: The correct option is (3). Quick Tip: \textbf{Carbocation stability is enhanced by hyperconjugation and resonance. Benzyl and allyl carbocations are exceptionally stable due to delocalization.}
For the reaction \(2A \rightleftharpoons B + C\), \(K_C = 4 \times 10^{-3}\).
At a given time, the composition of the reaction mixture is:
\[ [A] = [B] = [C] = 2 \times 10^{-3} M \]
Then, which of the following is correct?
N/A Quick Tip: \textbf{If \(Q_C > K_C\), the reaction shifts backward. If \(Q_C < K_C\), it shifts forward. When \(Q_C = K_C\), the reaction is at equilibrium.}
‘Spin only’ magnetic moment is same for which of the following ions?
A. Ti\(^{3+}\)
B. Cr\(^{2+}\)
C. Mn\(^{2+}\)
D. Fe\(^{2+}\)
E. Sc\(^{3+}\)
Choose the most appropriate answer from the options given below.
N/A Quick Tip: \textbf{Magnetic moment is dependent on the number of unpaired electrons. Use \( \mu_s = \sqrt{n(n+2)} \) BM to calculate it.}
The energy of an electron in the ground state (\(n = 1\)) for He\(^{+}\) ion is \(-x\) J, then that for an electron in \(n = 2\)
state for Be\(^{3+}\) ion in J is:
N/A Quick Tip: \textbf{For hydrogen-like species, energy levels scale as:} \[ E_n = \frac{-13.6 Z^2}{n^2} eV \] \textbf{Use this formula to compare different ions and energy levels.}
Which reaction is NOT a redox reaction?
N/A Quick Tip: \textbf{A reaction is NOT redox if no change in oxidation state occurs for any element. Double displacement reactions like precipitation reactions are typically not redox.}
Match List I with List II.
List I (Molecule) & List II (Number and types of bond/s between two carbon atoms)
A. Ethane & I. One \sigma -bond
B. Ethene & II. One \sigma -bond and one \pi -bond
C. Carbon molecule, C_2 & III. Two \pi -bonds
D. Ethyne & IV. One \sigma -bond and two \pi -bonds
Choose the correct answer from the options given below:
N/A Quick Tip: \textbf{Use bond notation:} - Single bond = One \(\sigma\)-bond
- Double bond = One \(\sigma\)-bond + One \(\pi\)-bond
- Triple bond = One \(\sigma\)-bond + Two \(\pi\)-bonds
Match List I with List II.
List I (Complex) & List II (Type of isomerism)
A. [Co(NH_3)_5(NO_2)]Cl_2 & I. Linkage isomerism
B. [Co(NH_3)_5(SO_4)]Br & II. Ionization isomerism
C. [Co(NH_3)_6][Cr(CN)_6] & III. Coordination isomerism
D. [Co(H_2O)_6]Cl_3 & IV. Solvate isomerism
N/A Quick Tip: \textbf{To identify isomerism:} - Look for exchange of counter-ions → Ionization isomerism
- Look for different binding atoms of a ligand → Linkage isomerism
- Ligands switching between cation/anion complexes → Coordination isomerism
The \(E^\circ\) value for the Mn\(^{3+}/Mn^{2+}\) couple is more positive than that of Cr\(^{3+}/Cr^{2+}\) or Fe\(^{3+}/Fe^{2+}\) due to change of
N/A Quick Tip: \textbf{Half-filled (\(d^5\)) and fully-filled (\(d^{10}\)) configurations are highly stable, leading to higher \(E^\circ\) values.}
The highest number of helium atoms is in
N/A Quick Tip: \textbf{Remember:} - 1 mole of any substance contains Avogadro's number (\(6.022 \times 10^{23}\)) of atoms/molecules. - 1 mole of gas at STP occupies 22.4 L.
Which plot of ln k vs \( \frac{1}{T} \) is consistent with Arrhenius equation?

N/A Quick Tip: \textbf{Arrhenius Equation Key Points:} - A plot of \( \ln k \) vs \( \frac{1}{T} \) gives a straight line.
- The slope is negative, equal to \( -\frac{E_a}{R} \).
The compound that will undergo SN1 reaction with the fastest rate is

N/A Quick Tip: \textbf{SN1 Reaction Key Points:} - Favored by tertiary carbocations due to their stability. - More resonance and hyperconjugation → Faster SN1 reaction.
Match List I with List II (Quantum Number and Information Provided)
List I (Quantum Number)} & \textbf{List II (Information Provided)}
A. m_l & I. Shape of orbital
B. m_s & I. Size of orbital
C. l & III. Orientation of orbital
D. n & IV. Orientation of spin of electron
Choose the correct answer from the options given below :
N/A Quick Tip: \textbf{Quantum Number Summary:}
- n (Principal): Size of orbital.
- l (Azimuthal): Shape of orbital.
- m-l (Magnetic): Orientation of orbital.
- m-s (Spin): Electron spin direction.
The Henry’s law constant (K-H) values of three gases (A, B, C) in water are 145, 2 × 10 {-5}, and 35 kbar, respectively. The solubility of these gases in water follows the order:
N/A Quick Tip: \textbf{Henry’s Law Summary:} - Lower \( K_H \) → Higher solubility. - Higher \( K_H \) → Lower solubility.
In which of the following processes entropy increases?
A. A liquid evaporates to vapour.
B. Temperature of a crystalline solid lowered from 130 K to 0 K.
C. \(2NaHCO_3(s) \rightarrow Na_2CO_3(s) + CO_2(g) + H_2O(g)\)
D. \(Cl_2(g) \rightarrow 2Cl(g)\)
Choose the correct answer from the options given below:
N/A Quick Tip: \textbf{Key Rules for Entropy Change:}
- Gas formation increases entropy.
- Evaporation and melting increase entropy.
- Cooling reduces molecular motion, decreasing entropy.
Given below are two statements:
Statement I: Aniline does not undergo Friedel-Crafts alkylation reaction.
Statement II: Aniline cannot be prepared through Gabriel synthesis.
N/A Quick Tip: \textbf{Key Concepts:} - Aromatic amines (like aniline) do not undergo Friedel-Crafts alkylation.
- Gabriel synthesis is effective only for aliphatic primary amines.
Fehling’s solution ‘A’ is:
N/A Quick Tip: \textbf{Fehling’s Test Key Points:} - Fehling’s solution detects reducing sugars like glucose.
- Fehling’s solution A = Copper sulfate solution.
- Fehling’s solution B = Rochelle’s salt (Alkaline sodium potassium tartrate).
Activation energy of any chemical reaction can be calculated if one knows the value of:
N/A Quick Tip: \textbf{Activation Energy Calculation:} - Requires rate constants at two different temperatures. - Based on the Arrhenius equation.
Arrange the following elements in increasing order of first ionization enthalpy: Li, Be, B, C, N
N/A Quick Tip: \textbf{Ionization Enthalpy Trend:}
- Increases across a period.
- Be > B due to stable full \( s \)-orbital.
1 gram of sodium hydroxide was treated with 25 mL of 0.75 M HCl solution, the mass of sodium hydroxide left unreacted is equal to:
N/A Quick Tip: \textbf{Neutralization Rule:} - If acid is in excess, some NaOH will be fully reacted.
- If base is in excess, some NaOH will remain unreacted.
A compound with a molecular formula of \( C_6H_{14} \) has two tertiary carbons. Its IUPAC name is:
N/A Quick Tip: \textbf{Identifying Tertiary Carbons:} - Look for carbons bonded to three other carbon atoms.
- Branched alkanes often contain tertiary carbons.
Given below are two statements:
Statement I: The boiling point of three isomeric pentanes follows the order \[ n-pentane > isopentane > neopentane \]
Statement II: When branching increases, the molecule attains a shape of a sphere. This results in a smaller surface area for contact, reducing intermolecular forces and lowering the boiling point.
N/A Quick Tip: \textbf{Boiling Point and Branching:} - More branching → Lower boiling point.
- Less branching (linear chain) → Higher boiling point.
In which of the following equilibria, \( K_p \) and \( K_c \) are NOT equal?
N/A Quick Tip: \textbf{When \( K_p = K_c \) holds true:} - If \( \Delta n = 0 \), then \( K_p = K_c \).
- If \( \Delta n \neq 0 \), then \( K_p \neq K_c \).
The reagents with which glucose does not react to give the corresponding tests/products are
A. Tollen’s reagent
B. Schiff’s reagent
C. HCN
D. NH2OH
E. NaHSO3
- Tollen’s reagent reacts with glucose because glucose is an aldehyde and can undergo oxidation.
- Schiff’s reagent reacts with aldehydes, and glucose being an aldehyde also reacts with it.
- HCN does not react with glucose under normal conditions, so it is not involved in the corresponding test.
- NH2OH (hydroxylamine) does not react with glucose in the same way it reacts with reducing sugars, so it is not part of the expected tests.
- NaHSO3 reacts with glucose as it is a reducing sugar, hence it is part of the corresponding test.
Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{Glucose reacts with Tollen’s and Schiff’s reagents, but does not react with HCN and NH2OH under standard conditions.}
Match List I with List II.
List I (Compound) & List II (Shape/Geometry)
A. NH3 & I. Trigonal Pyramidal
B. BrF5 & II. Square Planar
C. XeF4 & III. Octahedral
D. SF6 & IV. Square Pyramidal
N/A Quick Tip: Remember to use VSEPR theory to predict molecular geometry.
Among Group 16 elements, which one does NOT show \(-2\) oxidation state?
N/A Quick Tip: Polonium behaves more like a metal, limiting its ability to adopt a \(-2\) oxidation state.
Match List I with List II.
N/A Quick Tip: Identify characteristic reagents for specific types of organic transformations.
Arrange the following elements in increasing order of electronegativity: \[ N, O, F, C, Si \]
Choose the correct answer from the options given below:
N/A Quick Tip: \textbf{Electronegativity Rule:} - Fluorine is the most electronegative element.
- Moving across a period, electronegativity increases.
- Moving down a group, electronegativity decreases.
Intramolecular hydrogen bonding is present in:

Step 1: Understanding Hydrogen Bonding
- Intramolecular hydrogen bonding occurs when hydrogen bonding takes place within the same molecule.
- It is commonly seen in ortho-hydroxy benzene derivatives, diketones, and compounds containing adjacent donor-acceptor groups.
Step 2: Identifying Intramolecular Hydrogen Bonding
- HF has strong intermolecular hydrogen bonding, not intramolecular.
- The correct compound in option (2) has intramolecular hydrogen bonding.
Conclusion: The correct answer is (2). Quick Tip: \textbf{Intramolecular vs Intermolecular Hydrogen Bonding:} - Intramolecular: Hydrogen bonding within the same molecule. - Intermolecular: Hydrogen bonding between different molecules.
Identify the correct reagents that would bring about the following transformation.
![]()
Step 1: Understanding the Reaction Sequence
- Step 2: Hydroboration-Oxidation (\( BH_3 \) followed by \( H_2O_2/ OH^- \)) converts an alkene to an anti-Markovnikov alcohol.
- Step 3: PCC (Pyridinium chlorochromate) oxidizes the primary alcohol to an aldehyde.
Conclusion: The correct answer is (1). Quick Tip: \textbf{Hydroboration-Oxidation:} - Converts alkene to primary alcohol (anti-Markovnikov).
- PCC selectively oxidizes alcohols to aldehydes without further oxidation to carboxylic acids.
Match List I with List II.
List I (Conversion)} & List II (Number of Faraday required)}
A. 1 mol of H_2O to O_2 & I. 3F
B. 1 mol of MnO_4^- to Mn^{2+} & II. 2F
C. 1.5 mol of Ca from molten CaCl_2 & III. 1F
D. 1 mol of FeO to Fe_2O_3 & IV. 5F
Choose the correct answer from the options given below:
Step 1: Understanding Faraday’s Law
\[ Moles of electrons required = Faraday's constant \times number of moles \]
- (A) Water oxidation to O\(_2\) (H\(_2\)O \(\to\) O\(_2\)):
\(2H_2O \to O_2 + 4H^+ + 4e^-\)
\(\Rightarrow\) 2 Faraday per mole of \(O_2\)
A → III
- (B) MnO\(_4^-\) to Mn\(^{2+}\):
\(MnO_4^- + 8H^+ + 5e^- \to Mn^{2+} + 4H_2O\)
\(\Rightarrow\) 5 Faraday per mole
B → IV
- (C) Ca from molten CaCl\(_2\) (1.5 mol):
\(Ca^{2+} + 2e^- \to Ca\)
1 mol needs 2 Faraday, so 1.5 mol needs 3 Faraday
C → II
- (D) FeO to Fe\(_2\)O\(_3\):
1 Faraday per mole
D → I
Conclusion: The correct answer is (3). Quick Tip: \textbf{Faraday’s Law in Electrochemistry:}
- 1 Faraday \(= 96,485\) C/mole of electrons.
- Oxidation states help determine required electron transfer.
Given below are two statements:
Statement I: The boiling point of hydrides of Group 16 elements follow the order: \[ H_2O > H_2Te > H_2Se > H_2S. \]
Statement II: On the basis of molecular mass, \( H_2O \) is expected to have a lower boiling point than the other members of the group, but due to the presence of extensive hydrogen bonding in \( H_2O \), it has a higher boiling point.
Choose the correct answer from the options given below:
Step 1: Understanding Boiling Point Trends in Group 16 Hydrides
- General Trend: Boiling points usually increase down a group due to increasing molecular mass and van der Waals forces.
- Exception: Water (\( H_2O \)) has an unusually high boiling point due to strong hydrogen bonding.
Step 2: Comparison of Molecular Mass and Hydrogen Bonding
\[ H_2O \gg H_2Te > H_2Se > H_2S \]
Conclusion: Both statements are true, so the correct answer is (1). Quick Tip: \textbf{Boiling Point Trends:}
- Water has the highest boiling point among Group 16 hydrides due to strong hydrogen bonding.
- Other hydrides follow mass-based trends with increasing van der Waals forces.
Given below are two statements:
Statement I: Both \( [Co(NH_3)_6]^{3+} \) and \( [CoF_6]^{3-} \) complexes are octahedral but differ in their magnetic behavior.
Statement II: \( [Co(NH_3)_6]^{3+} \) is diamagnetic, whereas \( [CoF_6]^{3-} \) is paramagnetic.
Choose the correct answer from the options given below:
Understanding Coordination Complexes :
- \( [Co(NH_3)_6]^{3+} \): \( NH_3 \) is a strong field ligand, leading to low-spin d^6 configuration in Co\(^{3+}\), which is diamagnetic.
- \( [CoF_6]^{3-} \): \( F^- \) is a weak field ligand, leading to high-spin d^6 configuration, which is paramagnetic.
Conclusion: Both statements are true, so the correct answer is (3). Quick Tip: \textbf{Ligand Field Theory:} - Strong field ligands (NH\(_3\), CN\(^-\)) lead to low-spin configurations (diamagnetic).
- Weak field ligands (F\(^-\), Cl\(^-\)) lead to high-spin configurations (paramagnetic).
Which one of the following alcohols reacts instantaneously with Lucas reagent?
N/A Quick Tip: \textbf{Lucas Test for Alcohols:}
- Tertiary alcohols → Instant reaction (cloudy solution).
- Secondary alcohols → Slow reaction. - Primary alcohols → No visible reaction.
Match List I with List II.
List I (Process)} & List II (Conditions)}
A. Isothermal process & I. No heat exchange
B. Isochoric process & II. Carried out at constant temperature
C. Isobaric process & III. Carried out at constant volume
D. Adiabatic process & IV. Carried out at constant pressure
Understanding Thermodynamic Processes
- Isothermal Process: \( \Delta T = 0 \), so it occurs at constant temperature.
- Isochoric Process: \( \Delta V = 0 \), so it occurs at constant volume.
- Isobaric Process: \( \Delta P = 0 \), so it occurs at constant pressure.
- Adiabatic Process: No heat exchange (\( Q = 0 \)).
Conclusion: The correct answer is (3). Quick Tip: \textbf{Thermodynamic Processes:}
- Isothermal: \( T = constant \)
- Isochoric: \( V = constant \)
- Isobaric: \( P = constant \)
- Adiabatic: \( Q = 0 \) (no heat exchange)
On heating, some solid substances change from solid to vapour state without passing through the liquid state.
The technique used for the purification of such solid substances based on the above principle is known as:
N/A Quick Tip: Sublimation is an effective technique for purifying solids that sublimate upon heating.
The products A and B obtained in the following reactions, respectively, are \[ 3ROH + PCl_3 \rightarrow 3RCl + A \] \[ ROH + PCl_5 \rightarrow RCl + HCl + B \]
- In the reaction with phosphorus trichloride (PCl\(_3\)), phosphorous acid (H\(_3\)PO\(_3\)) is formed as product A.
- In the reaction with phosphorus pentachloride (PCl\(_5\)), phosphoryl chloride (POCl\(_3\)) is produced as product B.
- Thus, the correct answer is (4) POCl\(_3\) and H\(_3\)PO\(_3\) . Quick Tip: Phosphorus trichloride forms H\(_3\)PO\(_3\) (phosphorous acid), while phosphorus pentachloride forms POCl\(_3\) (phosphoryl chloride).
Mass in grams of copper deposited by passing 9.6487 A current through a voltmeter containing copper sulfate solution for 100 seconds is (Given: Molar mass of Cu: 63 g/mol, 1 F = 96487 C)
- According to Faraday's first law, mass deposited is given by:
\[ m = \frac{I \times t \times M}{n \times F} \]
where \(I = 9.6487 \, A, \, t = 100 \, seconds, \, M = 63 \, g/mol, \, n = 2, \, F = 96487 \, C/mol\)
- Substituting the values:
\[ m = \frac{9.6487 \times 100 \times 63}{2 \times 96487} \approx 0.0315 \, g \] Quick Tip: Faraday's laws relate current, time, and molar mass for electroplating calculations.
Consider the following reaction in a sealed vessel at equilibrium with concentrations of
N\(_2\) = 3.0 \(\times\) 10\(^{-3}\) M, O\(_2\) = 4.2 \(\times\) 10\(^{-3}\) M, and NO = 2.8 \(\times\) 10\(^{-3}\) M. \[ 2NO(g) \leftrightarrow N_2(g) + O_2(g) \]
If 0.1 mol/L of NO(g) is taken in a closed vessel, what will be the degree of dissociation (\(\alpha\)) of NO(g) at equilibrium?
- The equilibrium concentration of NO is 2.8 \(\times\) 10\(^{-3}\) M.
- Given initial concentration of NO is 0.1 M.
- Degree of dissociation \(\alpha\) is calculated as:
\[ \alpha = \frac{Initial concentration - Equilibrium concentration}{Initial concentration} \]
\[ \alpha = \frac{0.1 - 2.8 \times 10^{-3}}{0.1} \approx 0.717 \] Quick Tip: The degree of dissociation can be calculated by comparing initial and equilibrium concentrations of reactants.
Given below are two statements:
Statement I: [Co(NH\(_3\))\(_6\)]\(^{3+}\) is a homoleptic complex whereas [Co(NH\(_3\))\(_4\)Cl\(_2\)]\(^{+}\) is a heteroleptic complex.
Statement II: Complex [Co(NH\(_3\))\(_6\)]\(^{3+}\) has only one kind of ligands but [Co(NH\(_3\))\(_4\)Cl\(_2\)]\(^{+}\) has more than one kind of ligands.
In the light of the above statements, choose the correct answer from the options given below.
- [Co(NH\(_3\))\(_6\)]\(^{3+}\) contains only NH\(_3\) ligands and is therefore a homoleptic complex.
- [Co(NH\(_3\))\(_4\)Cl\(_2\)]\(^{+}\) contains both NH\(_3\) and Cl\(^-\) ligands and is heteroleptic.
- Both statements are correct. Quick Tip: A homoleptic complex has only one type of ligand, while a heteroleptic complex has multiple types of ligands.
Identify the major product C formed in the following reaction sequence:

- The first step involves nucleophilic substitution of iodine by CN\(^-\) to form propyl cyanide (A).
- Partial hydrolysis of propyl cyanide forms propionamide (B).
- Further treatment with Br\(_2\)/NaOH gives propylamine (C) via the Hoffmann bromamide degradation reaction. Quick Tip: The Butylamine degradation reaction converts amides to primary amines by loss of a carbon atom.
The pair of lanthanoid ions which are diamagnetic is:
- A diamagnetic substance has all electrons paired, meaning no unpaired electrons are present.
- Ce\(^{4+}\) has an empty 4f orbital (no unpaired electrons).
- Yb\(^{2+}\) has a fully filled 4f orbital (all electrons are paired).
- Thus, Ce\(^{4+}\) and Yb\(^{2+}\) are diamagnetic. Quick Tip: Diamagnetic species have all their electrons paired, leading to no net magnetic moment.
For the given reaction:

- The correct reaction mechanism supports the formation of Compound 1 based on reactivity and stability considerations. Quick Tip: Understand the conditions for chemical transformations when identifying products.
A compound X contains 32% of A, 20% of B, and the remaining percentage of C. Then, the empirical formula of X is:
(Given atomic masses of A = 64; B = 40; C = 32 u)
- Calculating the moles of each element:
\[ Moles of A = \frac{32}{64} = 0.5 \]
\[ Moles of B = \frac{20}{40} = 0.5 \]
\[ Moles of C = \frac{48}{32} = 1.5 \]
- The simplest whole number ratio is A:B:C = 1:1:3.
- Hence, the empirical formula is ABC\(_3\). Quick Tip: Divide by the smallest number of moles to get the simplest whole-number ratio for the empirical formula.
Given below are certain cations. Using inorganic qualitative analysis, arrange them in increasing group number from 0 to VI.
A. Al\(^{3+}\)
B. Cu\(^{2+}\)
C. Ba\(^{2+}\)
D. Co\(^{2+}\)
E. Mg\(^{2+}\)
Choose the correct answer from the options given below:
- Based on qualitative group analysis for cations, the correct order is B, A, D, C, E, corresponding to increasing group numbers. Quick Tip: Remember the cation classification based on their precipitation and group properties.
The work done during reversible isothermal expansion of one mole of hydrogen gas at 25°C from a pressure of 20 atmosphere to 10 atmosphere is (Given \(R = 2.0\) cal K\(^{-1}\) mol\(^{-1}\))
- The formula for work done in isothermal expansion is:
\[ W = -nRT \ln \frac{P_2}{P_1} \]
Substituting the values:
\[ W = -1 \times 2 \times (273 + 25) \times \ln \frac{10}{20} \]
\[ W \approx 100 \, calories \] Quick Tip: In reversible isothermal expansion, work done is related to the natural logarithm of the pressure ratio.
Major products A and B formed in the following reaction sequence, are:

- The reaction mechanism supports the formation of products A and B
corresponding to Compound 4 based on reactivity and stability considerations. Quick Tip: Identify key intermediates and functional groups when predicting products in multi-step reactions.
The rate of a reaction quadruples when the temperature changes from 27°C to 57°C. Calculate the energy of activation.
(Given \(R = 8.314\) J K\(^{-1}\) mol\(^{-1}\), \(\log 4 = 0.6021\))
Using the Arrhenius equation: \[ \ln \frac{k_2}{k_1} = \frac{E_a}{R} \left(\frac{T_2 - T_1}{T_1 T_2}\right) \]
Given \(k_2/k_1 = 4\), \(T_1 = 300\) K, \(T_2 = 330\) K, \(R = 8.314\) J K\(^{-1}\) mol\(^{-1}\): \[ \ln 4 = \frac{E_a}{8.314} \times \left(\frac{330 - 300}{300 \times 330}\right) \]
Substituting the values and solving gives: \[ E_a \approx 38.04 \, kJ/mol \] Quick Tip: Higher activation energies lead to more significant temperature effects on reaction rates.
During the preparation of Mohr’s salt solution (Ferrous ammonium sulphate), which of the following acids is added to prevent hydrolysis of Fe\(^{2+}\) ion?
- Dilute hydrochloric acid is added to maintain an acidic medium, preventing the oxidation of Fe\(^{2+}\) to Fe\(^{3+}\) and hydrolysis.
- This ensures the stability of the Mohr’s salt solution. Quick Tip: Mohr's salt is stable only in an acidic environment; hydrochloric acid prevents hydrolysis and oxidation.
The plot of osmotic pressure (\(\Pi\)) vs concentration (mol L\(^{-1}\)) for a solution gives a straight line with slope 25.73 L bar mol\(^{-1}\). The temperature at which the osmotic pressure measurement is done is:
(Use \(R = 0.083\) L bar mol\(^{-1}\) K\(^{-1}\))
The formula for osmotic pressure is: \[ \Pi = CRT \]
Given slope (\(C \times R \times T\)) = 25.73 L bar mol\(^{-1}\), \(R = 0.083\) L bar mol\(^{-1}\) K\(^{-1}\): \[ T = \frac{25.73}{0.083} \approx 37 \] Quick Tip: Osmotic pressure measurements can be used to determine molecular weights and temperature effects in solutions.
Identify the correct answer.
- BF\(_3\) has a non-zero dipole moment exhibits resonance, and three equivalent canonical forms can be drawn for it.
- These structures involve the delocalization of electrons over the three oxygen atoms. Quick Tip: Resonance structures stabilize molecules by delocalizing electron density.
A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and downstream end;
Explanation of a Transcription Unit
- A transcription unit consists of three key regions: the promoter, the structural gene, and the terminator.
- The promoter is a DNA sequence that signals the beginning of transcription.
- The structural gene codes for the protein.
- The terminator indicates the end of transcription.
Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{The transcription unit involves regions that initiate, encode, and terminate the process of transcription.}
Identify the set of correct statements:
A. The flowers of Vallisneria are colourful and produce nectar.
B. The flowers of water lily are not pollinated by water.
C. In most of water-pollinated species, the pollen grains are protected from wetting.
D. Pollen grains of some hydrophytes are long and ribbon like.
E. In some hydrophytes, the pollen grains are carried passively inside water.
Explanation of the Statements
- A is incorrect because the flowers of Vallisneria are not colourful and do not produce nectar, as they are wind-pollinated.
- B is correct as water lily flowers are pollinated by insects, not by water.
- C is correct because most water-pollinated species have pollen grains that are protected from wetting by waxy coatings.
- D is correct as some hydrophytic pollen grains are long and ribbon-like to facilitate water transport.
- E is correct because some hydrophytes, like sea grasses, have pollen that is carried passively by water currents.
Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: \textbf{In water-pollinated plants, pollen grains often have adaptations to prevent wetting and help in passive transport.}
Lecithin, a small molecular weight organic compound found in living tissues, is an example of:
Explanation of (2) Glycerides
- Glycerides is a type of phospholipid, which is a major component of cell membranes.
- It consists of glycerol, two fatty acids, phosphate, and a choline group.
Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{Phospholipids, such as lecithin, are essential components of cellular membranes, playing a key role in membrane structure and function.}
These are regarded as major causes of biodiversity loss:
A. Over exploitation
B. Co-extinction
C. Mutation
D. Habitat loss and fragmentation
E. Migration
Choose the correct answer from the options given below:
Explanation of Major Causes of Biodiversity Loss
- A Over-exploitation, such as overfishing and illegal hunting, is a major cause of biodiversity loss.
- B Co-extinction occurs when one species goes extinct due to the extinction of another species on which it depends.
- C Mutation does not directly lead to biodiversity loss; instead, it is a part of evolution.
- D Habitat loss and fragmentation are critical factors causing the decline in biodiversity.
- E Migration, although it may alter species distributions, does not directly cause biodiversity loss.
Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{Habitat loss and over-exploitation are among the leading causes of biodiversity decline, along with co-extinction.}
Match List I with List II
List I & List II
A. Clostridium butylicum & I. Ethanol
B. Saccharomyces cerevisiae & II. Streptokinase
C. Trichoderma polysporum & III. Butyric acid
D. Streptococcus sp. & IV. Cyclosporin-A
Choose the correct answer from the options given below:
Explanation of the Match:
- A. Clostridium butylicum produces Butyric acid (III).
- B. Saccharomyces cerevisiae produces Ethanol (I).
- C. Trichoderma polysporum produces Cyclosporin-A (II).
- D. Streptococcus sp. produces Streptokinase (IV).
Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: \textbf{Microorganisms are used to produce a variety of industrial products like ethanol, butyric acid, and pharmaceuticals like Cyclosporin-A.}
Match List I with List II
List-I & List-II
A. Rhizopus & I. Bread mould
B. Ustilago & II. Smut fungus
C. Puccinia & III. Rust fungus
D. Agaricus & IV. Mushroom
Choose the correct answer from the options given below:
Explanation of the Match:
- A. Rhizopus is a bread mould (IV).
- B. Ustilago is a smut fungus (III).
- C. Puccinia is a rust fungus (II).
- D. Agaricus is a mushroom (I).
Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: \textbf{Fungi play significant roles in ecology, agriculture, and the food industry, ranging from bread moulds to mushrooms.}
The lactose present in the growth medium of bacteria is transported to the cell by the action of
Explanation of Permease's Role in Lactose Transport
- Permease is a membrane protein that facilitates the transport of lactose into bacterial cells for metabolism.
- Beta-galactosidase breaks down lactose once it has entered the cell, but it does not transport it.
Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{Permease is essential for the active transport of lactose across bacterial cell membranes.}
List of endangered species was released by
Explanation of WWFs Role in Endangered Species Lists
- WWF publishes the Red List which provides the status of endangered species.
- The list is a comprehensive inventory of the global conservation status of plant and animal species.
Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{The IUCN Red List is a key resource for monitoring the extinction risk of species worldwide.}
How many molecules of ATP and NADPH are required for every molecule of CO\(_2\) fixed in the Calvin cycle?
- The Calvin cycle uses 3 molecules of ATP and 3 molecules of NADPH for the fixation of one CO\(_2\) molecule during the reduction and regeneration phases. Quick Tip: ATP is required for phosphorylation, while NADPH is used for reducing 3-phosphoglycerate to glyceraldehyde-3-phosphate (G3P).
The equation of Verhulst-Pearl logistic growth is: \[ \frac{dN}{dt} = rN \left( \frac{K - N}{K} \right) \]
From this equation, \(K\) indicates:
- The carrying capacity (\(K\)) is the maximum population size that an environment can sustain indefinitely given the available resources. Quick Tip: The logistic growth model shows population growth slowing as it approaches the carrying capacity.
Bulliform cells are responsible for:
- Bulliform cells are large, thin-walled cells present on the upper surface of monocot leaves.
- They help in reducing water loss by causing inward curling of leaves during water stress. Quick Tip: Bulliform cells play a crucial role in water conservation in grasses.
Which one of the following is not a criterion for the classification of fungi?
- Fungi are classified based on their mode of spore formation, fruiting body type, and morphology of mycelium.
- Mode of nutrition is not a primary classification criterion. Quick Tip: Fungi are heterotrophic by nature, feeding on dead organic matter (saprophytic) or living hosts (parasitic).
Tropical regions show the greatest level of species richness because:
A. Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was available for species diversification.
B. Tropical environments are more seasonal.
C. More solar energy is available in tropics.
D. Constant environments promote niche specialization.
E. Tropical environments are constant and predictable.
Choose the correct answer from the options given below:
- Tropical regions have remained relatively undisturbed for long periods, promoting diversification.
- More solar energy is available, leading to higher productivity.
- The stable and predictable environments encourage niche specialization and biodiversity. Quick Tip: Species richness tends to be highest in tropical regions due to long-term environmental stability and abundant energy resources.
Which of the following is an example of actinomorphic flower?
Explanation of Actinomorphic Flowers
- Actinomorphic flowers are radially symmetrical, meaning they can be divided into equal halves by multiple planes passing through the center.
- Datura is an example of an actinomorphic flower, having radial symmetry.
Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: \textbf{Actinomorphic flowers have radial symmetry and can be divided into two equal halves by multiple planes.}
Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the given figures (a) and (b)

Floral Position Types
- Hypogynous flowers have the ovary situated below the other floral parts (e.g., calyx, corolla, and androecium).
- Epigynous flowers have the ovary situated above the other floral parts.
- Perigynous flowers have the ovary in the middle with other parts situated around it, forming a hypanthium.
- In this case, both (a) and (b) represent Perigynous flowers.
Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{Perigynous flowers have the ovary in the middle, surrounded by other floral parts.}
Match List I with List II
List-I & List-II
A. Nucleolus & III. Site for active ribosomal RNA synthesis
B. Centriole & II. Organization like the cartwheel
C. Leucoplasts & IV. For storing nutrients
D. Golgi apparatus & I. Site of formation of glycolipid
Choose the correct answer from the options given below:
Explanation of the Match:
- A. Nucleolus is the site for active ribosomal RNA synthesis (III).
- B. Centriole has an organization resembling a cartwheel (IV).
- C. Leucoplasts are involved in storing nutrients (II).
- D. Golgi apparatus is the site for the formation of glycolipids (I).
Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{The nucleolus plays a key role in the synthesis of ribosomal RNA, while the Golgi apparatus is involved in lipid formation.}
What is the fate of a piece of DNA carrying only gene of interest which is transferred into an alien organism?
A. The piece of DNA would be able to multiply itself independently in the progeny cells of the organism.
B. It may get integrated into the genome of the recipient.
C. It may multiply and be inherited along with the host DNA.
D. The alien piece of DNA is not an integral part of chromosome.
E. It shows ability to replicate.
Choose the correct answer from the options given below:
Explanation of DNA Transfer Fate
- B The DNA may integrate into the genome of the recipient organism, becoming a permanent part of its genetic material.
- C The DNA may multiply in the host and be inherited along with the host DNA, especially if it is integrated into the host's chromosomes.
- A is incorrect because it refers to autonomous replication, which is more common for plasmids or vectors rather than isolated DNA.
- D and E refer to conditions that may be true but are less specific regarding how the gene of interest is handled in the recipient organism.
Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{When a foreign DNA is introduced into an organism, it can either integrate into the host genome or replicate independently, depending on the conditions and the nature of the DNA.}
Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:
Explanation of Hind II Recognition Sequence
- Hind II is a restriction enzyme that recognizes a specific 4 base pair (bp) sequence and cuts DNA at this site.
- This specific sequence is known as the recognition sequence, and Hind II cuts at the sequence, typically between specific bases.
Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{Restriction enzymes like Hind II recognize specific sequences of base pairs in DNA and cut at these points to facilitate genetic manipulation.}
The cofactor of the enzyme carboxypeptidase is:
Explanation of Carboxypeptidase Cofactor
- Carboxypeptidase is an enzyme that requires zinc as a cofactor to perform its catalytic function in the breakdown of peptides by removing terminal amino acids.
- (2) Flavin acts as a metal cofactor in the enzyme's active site to facilitate the reaction. Quick Tip: \textbf{ Flavin is an essential metal cofactor for carboxypeptidase, aiding in its enzymatic activity in peptide hydrolysis.}
Which of the following are required for the dark reaction of photosynthesis?
A. Light
B. Chlorophyll
C. CO2
D. ATP
E. NADPH
Explanation of the Dark Reaction Requirements
- The dark reaction (or Calvin cycle) of photosynthesis does not require light directly but utilizes ATP and NADPH produced during the light reaction.
- CO2 is also required as the carbon source for the synthesis of glucose.
- Light and chlorophyll are involved in the light-dependent reactions and are not required directly in the dark reaction.
Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: \textbf{The dark reactions of photosynthesis require ATP, NADPH, and CO2 but not light or chlorophyll.}
The type of conservation in which the threatened species are taken out from their natural habitat and placed in special settings where they can be protected and given special care is called:
- This form of conservation involves removing species from their natural habitat to protect them in artificial settings, such as zoos or botanical gardens.
- Such efforts are called \textit{ex-situ conservation, a key part of biodiversity conservation. Quick Tip: (3) Sustainable development provides a controlled environment for breeding and protection of endangered species.
Match List I with List II:
List I & List II
A. Two or more alternative forms of a gene & I. Back cross
B. Cross of F\(_1\) progeny with homozygous recessive parent & II. Ploidy
C. Cross of F\(_1\) progeny with any of the parents & III. Allele
D. Number of chromosome sets in plant & IV. Test cross
Choose the correct answer from the options given below:
- Alleles (A) are alternative forms of a gene.
- A test cross (B) involves crossing F\(_1\) with a homozygous recessive parent.
- A back cross (C) involves crossing F\(_1\) with any of the parents.
- Ploidy (D) refers to the number of chromosome sets in a plant. Quick Tip: Alleles, text cross, back cross , ploidy are the reproductivr parts of a plant.
Formation of interfascicular cambium from fully developed parenchyma cells is an example of:
- Differentiation refers to the process where fully differentiated cells regain the ability to divide and form new meristematic tissue, such as interfascicular cambium. Quick Tip: Differentiation plays a role in secondary growth in plants.
Spindle fibers attach to kinetochores of chromosomes during:
- During metaphase, spindle fibers attach to the kinetochores of chromosomes and align them along the metaphase plate. Quick Tip: The proper attachment of spindle fibers ensures accurate chromosome segregation.
In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it?
- To determine whether a black seed plant is homozygous (BB) or heterozygous (Bb), a test cross with a homozygous recessive plant (bb) is required.
- If the progeny shows a 1:1 ratio of black to white seeds, the plant is heterozygous (BB/bb). Quick Tip: A test cross is a method used to determine the genotype of an individual exhibiting a dominant trait.
A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?
Explanation of Inheritance in Snapdragon Flowers
- The red and pink flower colors in Snapdragon plants follow a typical Mendelian inheritance pattern where red (R) is dominant over pink (r).
- In the F1 generation, heterozygous plants (Rr) will be obtained, which will show the dominant red flower phenotype.
- If these F1 plants are crossed with each other, the F2 progeny will have red and pink flowered plants in a 3:1 ratio. Quick Tip: \textbf{In a monohybrid cross between red and pink Snapdragon plants, the expected phenotypes in the progeny will be red and pink flowered plants in a 3:1 ratio.}
Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of:
Explanation of Competitive Inhibition
- Malonate is a structural analog of succinate and competes with succinate for binding to the active site of succinic dehydrogenase, a classic example of competitive inhibition.
- In competitive inhibition, the inhibitor competes with the substrate for the active site, and increasing substrate concentration can overcome the inhibition.
Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{Competitive inhibitors resemble the substrate and bind to the active site of the enzyme, blocking its activity.}
Given below are two statements:
Statement I: Bt toxins are insect group specific and coded by a gene cry IAc.
Statement II: Bt toxin exists as inactive protoxin in B. thuringiensis. However, after ingestion by the insect the inactive protoxin gets converted into active form due to acidic pH of the insect gut.
Choose the correct answer from the options given below:
Explanation of Bt Toxin Mechanism
- Statement I is correct: Bt (Bacillus thuringiensis) toxins are indeed insect group-specific and are coded by the cry genes, such as cry IAc.
- Statement II is partially incorrect: Bt toxin exists as an inactive protoxin, but it is not the acidic pH that activates it, rather it is the alkaline pH of the insect's gut that triggers the conversion into the active form.
Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: \textbf{Bt toxin is activated in the insect gut by alkaline pH, not acidic pH.}
In the given figure, which component has thin outer walls and highly thickened inner walls?

Explanation of the Structure of the Component
- The component with thin outer walls and highly thickened inner walls corresponds to A, which is typically a structure such as a vascular bundle or xylem in plants.
- This type of structure is designed to handle water transport, where the thickened walls provide support and prevent collapse under pressure. Quick Tip: \textbf{Vascular tissues like xylem have thickened inner walls to support water transport under pressure.}
Which one of the following can be explained on the basis of Mendel's Law of Dominance?
A. Out of one pair of factors one is dominant and the other is recessive.
B. Alleles do not show any expression and both the characters appear as such in F2 generation.
C. Factors occur in pairs in normal diploid plants.
D. The discrete unit controlling a particular character is called factor.
E. The expression of only one of the parental characters is found in a monohybrid cross.
Choose the correct answer from the options given below:
Explanation of Mendel's Law of Dominance
- A is true: One allele is dominant and the other is recessive in a pair of alleles.
- C is true: Alleles occur in pairs in normal diploid organisms.
- D is true: The discrete unit controlling a character is referred to as a factor (gene).
- E is true: In a monohybrid cross, only one parental character appears due to dominance.
- B is true: Both alleles show expression in the heterozygous condition in some cases (incomplete dominance or codominance).
Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: \textbf{Mendel's Law of Dominance explains how one allele can mask the expression of another in a monohybrid cross.}
Identify the part of the seed from the given figure which is destined to form root when the seed germinates.

- The part of the seed that forms the root during germination is the \textit{radicle.
- It is typically located near the pointed end of the seed and emerges first during germination. Quick Tip: The radicle gives rise to the primary root of the plant.
Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin:
- Auxins selectively affect dicot weeds, causing uncontrolled growth and death.
- Grasses, being monocots, are less sensitive to auxin's herbicidal effects, remaining unaffected. Quick Tip: Synthetic auxins like 2,4-D are used as selective herbicides for weed control.
Given below are two statements:
Statement I: Chromosomes become gradually visible under light microscope during leptotene stage.
Statement II: The beginning of diplotene stage is recognized by dissolution of synaptonemal complex.
In the light of the above statements, choose the correct answer from the options given below:
- In the leptotene stage, chromosomes condense and become visible under a light microscope.
- In diplotene, the synaptonemal complex dissolves, and homologous chromosomes begin to separate. Quick Tip: The prophase of meiosis I is divided into leptotene, zygotene, pachytene, diplotene, and diakinesis.
The capacity to generate a whole plant from any cell of the plant is called:
- (1) Micropropagation is the ability of a single plant cell to develop into an entire plant under appropriate conditions.
- This property is fundamental in plant tissue culture techniques. Quick Tip: Micropropagation cells have the potential to regenerate all types of tissues and structures in a plant.
Given below are two statements:
Statement I: Parenchyma is living but collenchyma is dead tissue.
Statement II: Gymnosperms lack xylem vessels but the presence of xylem vessels is a characteristic of angiosperms.
In the light of the above statements, choose the correct answer from the options given below:
- Statement I: Parenchyma is a living tissue, and collenchyma is also a living tissue with thickened cell walls for mechanical support, making this statement true.
- Statement II: Gymnosperms lack xylem vessels, while xylem vessels are a distinguishing feature of angiosperms, making this statement true. Quick Tip: Xylem in gymnosperms consists mostly of tracheids, while angiosperms have both tracheids and vessels for efficient water conduction.
Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus, increasing the yield?
Explanation of (2) Cytokinin Effect on Growth
- Cytokinin are plant growth regulators that stimulate cell elongation and division, leading to increased stem length and overall plant growth.
- Spraying sugarcane with Cytokinin helps in increasing stem length, thereby enhancing the yield of the crop.
Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{Gibberellins are commonly used in agriculture to promote stem elongation and improve crop yield.}
Given below are two statements:
Statement I: In C3 plants, some O2 binds to RuBisCO, hence CO2 fixation is decreased.
Statement II: In C4 plants, mesophyll cells show very little photorespiration while bundle sheath cells do not show photorespiration.
Choose the correct answer from the options given below:
Explanation of C3 and C4 Plants
- Statement I is true: In C3 plants, RuBisCO enzyme can fix both CO2 and O2, leading to photorespiration, which decreases the efficiency of CO2 fixation.
- Statement II is true: In C4 plants, photorespiration is minimized in mesophyll cells, but it still occurs in the bundle sheath cells to some extent, albeit at a lower rate than in C3 plants.
Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: \textbf{C4 plants have a mechanism to minimize photorespiration by spatially separating the fixation of CO2 from the Calvin cycle.}
Match List-I with List-II
List-I} & Description} & List-II} & Category}
A. & GLUT-4 & I. & Hormone
B. & Insulin & II. & Enzyme
C. & Trypsin & III. & Intercellular ground substance
D. & Collagen & IV. & Enables glucose transport into cells
Choose the correct answer from the options given below:
Explanation of the Match:
- A. GLUT-4 is a transporter protein that enables glucose transport into cells (IV).
- B. Insulin is a hormone that regulates glucose uptake (I).
- C. Trypsin is an enzyme involved in protein digestion (II).
- D. Collagen is a component of intercellular ground substance, providing structural support in tissues (III).
Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: \textbf{GLUT-4 is a glucose transporter, insulin is a hormone, trypsin is an enzyme, and collagen is part of the extracellular matrix.}
Read the following statements and choose the set of correct statements:
In the members of Phaeophyceae,
A. Asexual reproduction occurs usually by biflagellate zoospores.
B. Sexual reproduction is by oogamous method only.
C. Stored food is in the form of carbohydrates which is either mannitol or laminarin.
D. The major pigments found are chlorophyll a, c and carotenoids and xanthophyll.
E. Vegetative cells have a cellulosic wall, usually covered on the outside by gelatinous coating of algin.
Choose the correct answer from the options given below:
- A is false: In Phaeophyceae, asexual reproduction typically occurs through biflagellate zoospores.
- B is true: Sexual reproduction in Phaeophyceae is oogamous but may also involve other forms like antheridial and oogonial cells.
- C is true: Phaeophyceae store carbohydrates in the form of mannitol or laminarin.
- D is true: Major pigments include chlorophyll a, c, and carotenoids, as well as xanthophylls.
- E is true: Vegetative cells have a cellulosic wall and are often coated with algin, a gelatinous substance.
Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{Phaeophyceae are brown algae with distinct reproductive methods, storage forms of carbohydrates, and key pigments for photosynthesis.}
Which of the following statement is correct regarding the process of replication in E.coli?
- DNA dependent DNA polymerase is responsible for DNA replication in E. coli and catalyzes the addition of nucleotides in the 5’ to 3’ direction.
- This enzyme can only add nucleotides to the 3' end of the growing strand.
Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: \textbf{DNA polymerases always catalyze the elongation of the DNA strand in the 5' to 3' direction, adding nucleotides to the 3' end of the strand.}
Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.
- The step Succinyl-CoA → Succinic acid involves the formation of ATP (or GTP) via substrate-level phosphorylation and does not involve oxidation of the substrate.
- The other steps involve oxidation reactions where electrons are transferred, such as Isocitrate → alpha-ketoglutaric acid and Malic acid → Oxaloacetic acid.
Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{In the TCA cycle, oxidation reactions involve the transfer of electrons, except in the conversion of Succinyl-CoA to Succinic acid.}
Match List I with List II
List I} & List II}
A. Robert May & I. Species-Area relationship
B. Alexander von Humboldt & II. Long-term ecosystem experiment using outdoor plots
C. Paul Ehrlich & III. Global species diversity at about 7 million
D. David Tilman & IV. Rivet popper hypothesis
Choose the correct answer from the options given below:
- A. Robert May proposed that global species diversity is about 7 million species (I).
- B. Alexander von Humboldt is known for the species-area relationship (III), which explains the biodiversity patterns across regions.
- C. Paul Ehrlich is related with the Rivet popper hypothesis (II), which suggests that each species plays an important role in maintaining ecosystem stability.
- D. David Tilman conducted long-term ecosystem experiments using outdoor plots (IV) to study ecological processes. Quick Tip: \textbf{Robert May's work focuses on global species diversity, while Alexander von Humboldt contributed to understanding the species-area relationship.}
Identify the correct description about the given figure:

- Wind-pollinated plants typically have well-exposed stamens to facilitate the release and dispersal of pollen by wind.
- These plants generally produce light, small pollen grains, and the flowers may lack attractive features like bright colors or nectar.
- The other options describe different pollination mechanisms that are not related to wind-pollinated plants.
Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: \textbf{Wind-pollinated plants have exposed stamens to help the pollen disperse effectively through the air.}
In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is 100x (kcal m–2 yr–1), what would be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem?
- Gross Primary Productivity (GPP) refers to the total amount of energy fixed by plants through photosynthesis.
- Net Primary Productivity (NPP) is the energy available to the next trophic levels after accounting for the energy used by plants in their own respiration.
- Since NPP represents the energy remaining after respiration, the GPP is typically higher than NPP by a factor of 10.
- In this case, if NPP is 100x, GPP would be 1000x, as GPP is higher by the total energy used in respiration. . Quick Tip: \textbf{In ecosystems, GPP is typically 10 times greater than NPP, reflecting the energy lost through plant respiration.}
Match List I with List II
List I} & List II}
A. Rose & I. Twisted aestivation
B. Pea & II. Perigynous flower
C. Cotton & III. Drupe
D. Mango & IV. Marginal placentation
Choose the correct answer from the options given below:
- A. Rose has Perigynous flowers (I), where the ovary is surrounded by the other floral parts.
- B. Pea has Marginal placentation (II), where ovules are attached to the margin of the ovary.
- C. Cotton has a Drupe fruit (III), which is a fleshy fruit with a single seed enclosed in a hard shell.
- D. Mango has Twisted aestivation (IV), where the arrangement of petals or sepals involves twisting.
Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{In plant anatomy, placentation and aestivation patterns help in identifying the type of flower and fruit.}
Match List I with List II
List-I (Types of Stamens) & List-II (Example)
A. Monoadelphous & I. Citrus
B. Diadelphous & II. Pea
C. Polyadelphous & III. Lily
D. Epiphyllous & IV. China-rose
- Monoadelphous stamens are found in China-rose (IV), where all stamens are fused into a single group.
- Diadelphous stamens are found in Pea (I), where the stamens are fused into two groups.
- Polyadelphous stamens are found in Citrus (II), where stamens are grouped into multiple bundles.
- Epiphyllous stamens are found in Lily (III), where the stamens arise from the leaf-like structure. Quick Tip: \textbf{Stamen arrangements such as monoadelphous and diadelphous help in identifying plant species and their pollination mechanisms.}
Which of the following are fused in somatic hybridization involving two varieties of plants?
- Protoplast fusion is a key technique in somatic hybridization, where protoplasts (plant cells without cell walls) from two different varieties are fused to create a hybrid plant.
- This fusion allows the combination of genetic material from both parent plants to form a hybrid.
Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{Somatic hybridization uses protoplast fusion to combine the genetic material of two different plant varieties.}
Match List I with List II List-I & List-II
A. Frederick Griffith & I. Genetic code
B. Francois Jacob \& Jacque Monod & II. Semi-conservative mode of DNA replication
C. Har Gobind Khorana & III. Transformation
D. Meselson \& Stahl & IV. Lac operon
- Frederick Griffith is related with the discovery of Transformation (III), where genetic material is transferred between bacteria.
- Francois Jacob and Jacque Monod are credited with the discovery of the Lac operon (IV), a key component of gene regulation in bacteria.
- Har Gobind Khorana helped in deciphering the Genetic code (I).
- Meselson and Stahl conducted the experiment proving the semi-conservative mode of DNA replication (II).
Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{Griffith's work on transformation and Meselson-Stahl's experiment on DNA replication were foundational in genetics.}
The DNA present in chloroplast is:
- Chloroplast DNA is circular and double-stranded, similar to the DNA found in prokaryotes.
- This circular structure is a remnant of the evolutionary origin of chloroplasts, which are thought to have evolved from cyanobacteria.
Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{Chloroplasts, like mitochondria, have circular DNA, which is a characteristic of prokaryotic organisms.}
Match List I with List II
List-I & List-II
A. Citric acid cycle & I. Cytoplasm
B. Glycolysis & II. Mitochondrial matrix
C. Electron transport system & III. Intermembrane space of mitochondria
D. Proton gradient & IV. Inner mitochondrial membrane
- The Citric acid cycle occurs in the mitochondrial matrix (I).
- Glycolysis takes place in the cytoplasm (II).
- The Electron transport system is located on the inner mitochondrial membrane (III).
- The Proton gradient is created in the intermembrane space of mitochondria (IV).
Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: \textbf{Cellular respiration occurs in different parts of the cell, with glycolysis in the cytoplasm and the citric acid cycle and electron transport in the mitochondria.}
Which of the following is not a natural/traditional contraceptive method?
- Periodic abstinence, lactational amenorrhea, and coitus interruptus are all traditional contraceptive methods.
- Vaults are a modern contraceptive method and do not fall under natural or traditional methods.
Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: \textbf{Natural contraceptive methods include periodic abstinence, lactational amenorrhea, and coitus interruptus, while vaults are modern contraceptive devices.}
Match List I with List II
List-I & List-II
A. Common cold & I. Plasmodium
B. Haemozoin & II. Typhoid
C. Widal test & III. Rhinoviruses
D. Allergy & IV. Dust mites
- Common cold is caused by Rhinoviruses (III).
- Haemozoin is produced by Plasmodium (I), which is the causative agent of malaria.
- Widal test is used to diagnose Typhoid (II).
- Allergy can be triggered by Dust mites (IV).
Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{The Widal test is used for diagnosing typhoid, while haemozoin is linked to malaria caused by Plasmodium.}
Which of the following statements is incorrect?
- Bio-reactors are typically used for large-scale production of microbial cultures and industrial products, not small-scale cultures.
- They are equipped with systems to provide optimal conditions for growth, such as an agitator, oxygen delivery, and foam control. Quick Tip: \textbf{Bio-reactors are mainly used in large-scale production of microbial cultures and bioproducts, rather than for small-scale cultures.}
Which of the following are Autoimmune disorders?
A. Myasthenia gravis
B. Rheumatoid arthritis
C. Gout D. Muscular dystrophy
E. Systemic Lupus Erythematosus (SLE)
Choose the correct answer from the options given below:
- Myasthenia gravis, Rheumatoid arthritis, and Systemic Lupus Erythematosus (SLE)
are autoimmune disorders where the immune system attacks the body’s own tissues.
- Gout and Muscular dystrophy are not autoimmune disorders.
Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{Autoimmune disorders occur when the body's immune system mistakenly attacks its own tissues, as seen in myasthenia gravis, rheumatoid arthritis, and SLE.}
Match List I with List II
List-I & List-II
A. Down’s syndrome & I. 11th chromosome
B. Alpha-Thalassemia & II. ‘X’ chromosome
C. Beta-Thalassemia & III. 21st chromosome
D. Klinefelter’s syndrome & IV. 16th chromosome
Choose the correct answer from the options given below:
- Down’s syndrome is caused by an extra chromosome on the 21st chromosome (IV).
- Alpha-Thalassemia is related with the 16th chromosome (I).
- Beta-Thalassemia is related with the 11th chromosome (II).
- Klinefelter’s syndrome is caused by an extra X chromosome (III).
Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{Chromosomal disorders such as Down’s syndrome and Klinefelter’s syndrome are linked to specific chromosomal abnormalities.}
Match List I with List II
List-I (Type of IUD) & List-II (Example)
A. Non-medicated IUD & I. Multiload 375
B. Copper releasing IUD & III. Lippes loop
C. Hormone releasing IUD & IV. LNG-20
D. Implants & II. Progestogens
Choose the correct answer from the options given below:
- Non-medicated IUD: Example - Lippes loop (I)
- Copper releasing IUD: Example - Multiload 375 (III)
- Hormone releasing IUD: Example - LNG-20 (IV)
- Implants: Example - Progestogens (II)
Quick Tip: \textbf{IUDs can be either medicated with copper or hormones, or non-medicated to prevent pregnancy.}
Match List I with List II
List-I & List-II
A. Pleurobrachia & I. Mollusca
B. Radula & II. Ctenophora
C. Stomochord & III. Osteichthyes
D. Air bladder & IV. Hemichordata
Choose the correct answer from the options given below:
- Pleurobrachia belongs to Ctenophora (IV).
- Radula is a feature of Mollusca (II).
- Stomochord is found in Hemichordata (III).
- Air bladder is found in Osteichthyes (IV).
Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: \textbf{Radula is a characteristic of mollusks, while stomochord is found in hemichordates.}
Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?
- Oxyhaemoglobin formation occurs when oxygen binds to hemoglobin in the alveoli, which is facilitated by high partial pressure of oxygen (pO2) and lower hydrogen ion concentration (pH), which favors oxygen binding.
- Low pCO2 conditions lead to the release of oxygen from hemoglobin (Bohr effect). Quick Tip: \textbf{Oxyhaemoglobin formation is favored by high oxygen levels and a lower concentration of hydrogen ions in the alveoli.}
Match List I with List II
List-I & List-II
A. Cocaine & I. Effective sedative in surgery
B. Heroin & II. Cannabis sativa
C. Morphine & III. Erythroxylum
D. Marijuana & IV. Papaver somniferum
Choose the correct answer from the options given below:
- Cocaine is derived from Erythroxylum (II) and is used as a local anesthetic in surgeries.
- Heroin is derived from Papaver somniferum (I), the opium poppy.
- Morphine is derived from Papaver somniferum (III and is used as a potent painkiller.
- Marijuana is derived from Cannabis sativa (IV), a plant known for its psychoactive properties.
Quick Tip: \textbf{Cocaine is from Erythroxylum, heroin and morphine are from the poppy plant, and marijuana is from Cannabis sativa.}
Match List I with List II
List-I (Sub Phases of Prophase I) & List-II (Specific Characters)
A. Diakinesis & I. Synaptonemal complex formation
B. Pachytene & II. Completion of terminalisation of chiasmata
C. Zygotene & III. Chromosomes look like thin threads
D. Leptotene & IV. Appearance of recombination nodules
Choose the correct answer from the options given below:
- Diakinesis is characterized by the completion of terminalisation of chiasmata (II).
- Pachytene is related with the appearance of recombination nodules (IV).
- Zygotene involves the formation of the synaptonemal complex (I).
- Leptotene is characterized by chromosomes looking like thin threads (III).
Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{The different sub-phases of prophase I are distinguished by the processes of chromosome pairing and recombination.}
Match List I with List II
List-I & List-II
A. Fibrous joints & I. Adjacent vertebrae, limited movement
B. Cartilaginous joints & II. Humerus and Pectoral girdle, rotational movement
C. Hinge joints & III. Skull, don’t allow any movement
D. Ball and socket joints & IV. Knee, help in locomotion
Choose the correct answer from the options given below:
- Fibrous joints are found in the skull where they allow no movement (II).
- Cartilaginous joints are found between adjacent vertebrae and allow limited movement (III).
- Hinge joints are found in the knee, enabling movement for locomotion (I).
- Ball and socket joints are found at the humerus and pectoral girdle, allowing rotational movement (IV).
Quick Tip: \textbf{The different types of joints in the human body are classified based on their structure and the type of movement they allow.}
Which of the following is not a steroid hormone?
- Testosterone, Progesterone, and Cortisol are all steroid hormones derived from cholesterol.
- Glucagon, on the other hand, is a peptide hormone produced by the pancreas, not a steroid. Quick Tip: \textbf{Steroid hormones are derived from cholesterol, while peptide hormones like glucagon are made of amino acids.}
In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on
- In both male and female cockroaches, anal cerci are present on the 10th segment of the abdomen.
- These cerci are sensory structures that help in detecting changes in the environment. Quick Tip: \textbf{Anal cerci in cockroaches are sensory structures that help detect vibrations and air currents.}
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R:
Assertion A: FSH acts upon ovarian follicles in female and Leydig cells in male.
Reason R: Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being.
Choose the correct answer from the options given below:
- Assertion A is false: FSH (Follicle Stimulating Hormone) acts on ovarian follicles in females but on Sertoli cells, not Leydig cells, in males.
- Reason R is true: In females, growing ovarian follicles secrete estrogen, and in males, interstitial cells (Leydig cells) secrete androgens (testosterone).
Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: \textbf{FSH acts on Sertoli cells in males and ovarian follicles in females, with the secreted hormones differing in both genders.}
Match List I with List II
List-I (Pulmonary Volumes) & List-II (Corresponding Volumes)
A. Expiratory capacity & I. Expiratory reserve volume + Tidal volume + Inspiratory reserve volume
B. Functional residual capacity & II. Tidal volume + Expiratory reserve volume
C. Vital capacity & III. Tidal volume + Inspiratory reserve volume
D. Inspiratory capacity & IV. Expiratory reserve volume + Residual volume
Choose the correct answer from the options given below:
- Expiratory capacity is the sum of Tidal volume + Expiratory reserve volume (I).
- Functional residual capacity is the sum of Expiratory reserve volume + Residual volume (III).
- Vital capacity is the sum of Expiratory reserve volume + Tidal volume + Inspiratory reserve volume (II).
- Inspiratory capacity is the sum of Tidal volume + Inspiratory reserve volume (IV).
Quick Tip: \textbf{Pulmonary volumes are important for assessing lung function and can be measured using a spirometer.}
Three types of muscles are given as a, b and c. Identify the correct matching pair along with their location in human body:

- Skeletal muscles like the Triceps are attached to bones and enable voluntary movements.
- Smooth muscles like those in the Stomach are involuntary and help in digestion.
- Cardiac muscles are specialized muscles in the Heart that contract involuntarily to pump blood.
Quick Tip: \textbf{Skeletal muscles are under voluntary control, smooth muscles are involuntary, and cardiac muscles are specialized for heart function.}
Match List I with List II
List-I & List-II
A. Lipase & I. Peptide bond
B. Nuclease & II. Ester bond
C. Protease & III. Glycosidic bond
D. Amylase & IV. Phosphodiester bond
Choose the correct answer from the options given below:
- Lipase acts on ester bonds (II), which are found in lipids.
- Nuclease acts on phosphodiester bonds (IV) in nucleic acids.
- Protease breaks down peptide bonds (I) in proteins.
- Amylase acts on glycosidic bonds (III) in carbohydrates.
Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{Different enzymes are specific to breaking down bonds in various macromolecules such as lipids, proteins, and carbohydrates.}
The flippers of the Penguins and Dolphins are the example of the
- The flippers of Penguins and Dolphins are examples of (a) Smooth - Toes
(b) Skeletal – Legs
(c) Cardiac – Heart
evolution, where unrelated species evolve similar traits as a result of adapting to different environments or ecological niches.
- This evolution occurs despite the species being from different lineages. Quick Tip: \textbf{Convergent evolution occurs when unrelated species develop similar features due to similar environmental pressures.}
Following are the stages of cell division :
A. Gap 2 phase
B. Cytokinesis
C. Synthesis phase
D. Karyokinesis
E. Gap 1 phase
Choose the correct answer from the options given below:
- The correct sequence of stages is:
1. Gap 1 phase (E)
2. Cytokinesis (B)
3. Karyokinesis (D)
4. Gap 2 phase (A)
5. Synthesis phase (C)
Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{In cell division, the sequence typically follows Gap 1 → Synthesis → Gap 2 → Karyokinesis → Cytokinesis.}
Which one of the following factors will not affect the Hardy-Weinberg equilibrium?
- The Hardy-Weinberg equilibrium assumes no change in allele frequencies due to external factors.
- Factors like genetic drift, gene migration, and genetic recombination can disrupt this equilibrium.
- A constant gene pool implies no changes in allele frequencies, which is essential for maintaining the Hardy-Weinberg equilibrium.
Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: \textbf{The Hardy-Weinberg equilibrium is disrupted by genetic drift, gene migration, and recombination, but assumes a constant gene pool.}
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R:
Assertion A: FSH acts upon ovarian follicles in female and Leydig cells in male.
Reason R: Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being.
- Assertion A is true: FSH acts on ovarian follicles in females and Leydig cells in males.
- Reason R is true: The Leydig cells in males secrete androgens (testosterone), not interstitial cells. Growing ovarian follicles secrete estrogen in females.
Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{FSH acts on both ovarian follicles in females and Sertoli cells in males, with Leydig cells secreting testosterone in males.}
Match List I with List II
List-I & List-II
A. Typhoid & I. Fungus
B. Leishmaniasis & II. Nematode
C. Ringworm & III. Protozoa
D. Filariasis & IV. Bacteria
Choose the correct answer from the options given below:
- Typhoid is caused by Bacteria (III).
- Leishmaniasis is caused by Protozoa (I).
- Ringworm is caused by Fungus (IV).
- Filariasis is caused by a Nematode (II).
Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: \textbf{Infections like typhoid, leishmaniasis, and ringworm are caused by bacteria, protozoa, and fungi, respectively.}
Given below are some stages of human evolution. Arrange them in correct sequence. (Past to Recent)
A. Homo habilis
B. Homo sapiens
C. Homo neanderthalensis
D. Homo erectus
Choose the correct answer from the options given below:
The correct sequence of human evolution from past to recent is:
- Homo erectus (D)
- Homo habilis (A)
- Homo neanderthalensis (C)
- Homo sapiens (B)
Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: \textbf{Human evolution follows the sequence: D-A-C-B. }
Which of the following is not a component of Fallopian tube?
The Fallopian tube consists of the following parts:
- Isthmus
- Uterus fundus
- Ampulla
The (2) Infundibulum is part of the uterus, not the Fallopian tube. Quick Tip: \textbf{The uterine fundus is part of the uterus and not part of the Fallopian tube.}
Consider the following statements:
A. Annelids are true coelomates
B. Poriferans are pseudocoelomates
C. Aschelminthes are acoelomates
D. Platyhelminthes are pseudocoelomates
Choose the correct answer from the options given below:
- Annelids are true coelomates (A), meaning they possess a true coelom.
- Poriferans are not pseudocoelomates, and Aschelminthes and Platyhelminthes are pseudocoelomates either.
- Therefore, statement D is the only correct one. Quick Tip: \textbf{Annelids are true coelomates, meaning they possess a true coelom surrounded by mesoderm.}
Match List I with List II
List-I & List-II
A. Axoneme & I. Centriole
B. Cartwheel pattern & II. Cilia and flagella
C. Crista & III. Chromosome
D. Satellite & IV. Mitochondria
Choose the correct answer from the options given below:
- Axoneme is found in Cilia and flagella (II).
- Cartwheel pattern is related with Centriole (I).
- Crista is found in the Mitochondria (IV).
- Satellite is found near the Chromosome (III).
Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: \textbf{Axoneme is the structural part of cilia and flagella, while cristae are inner folds in the mitochondria.}
Match List I with List II
List I & List II
A. Pterophyllum & I. Hag fish
B. Myxine & II. Saw fish
C. Pristis & III. Angel fish
D. Exocoetus & IV. Flying fish
Choose the correct answer from the options given below:
- Pterophyllum is commonly known as Angel fish (III).
- Myxine is commonly known as Hag fish (II).
- Pristis is known as Saw fish (I).
- Exocoetus is commonly known as the Flying fish (IV). Quick Tip: \textbf{Fish species like Pristis (sawfish) and Exocoetus (flying fish) are known for their unique adaptations.}
Match List I with List II
List-I & List-II
A. Pons & I. Provides additional space for Neurons, regulates posture and balance.
B. Hypothalamus & II. Controls respiration and gastric secretions.
C. Medulla & III. Connects different regions of the brain.
D. Cerebellum & IV. Neuro secretory cells
Choose the correct answer from the options given below:
- Pons is responsible for connecting different regions of the brain (III).
- Hypothalamus contains neurosecretory cells (IV), involved in hormone production.
- Medulla controls respiration and gastric secretions (II).
- Cerebellum helps in regulating posture and balance (I).
Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{The pons, medulla, and cerebellum are part of the brainstem and cerebellum, involved in functions like posture, balance, and vital processes.}
The following diagram showing restriction sites in E. coli cloning vector pBR322. Find the role of ‘X’ and ‘Y’ genes :

- Gene ‘X’ controls the copy number of the linked DNA in plasmid cloning vectors.
- Gene ‘Y’ encodes a protein involved in plasmid replication.
Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: \textbf{Cloning vectors like pBR322 are used to replicate recombinant DNA in bacteria, with specific genes controlling replication and resistance.}
Given below are two statements :
Statement I : In the nephron, the descending limb of loop of Henle is impermeable to water and permeable to electrolytes.
Statement II : The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption.
Choose the correct answer from the options given below:
- Statement I is false: The descending limb of the loop of Henle is permeable to water, not electrolytes.
- Statement II is also false: The proximal convoluted tubule is lined by simple cuboidal epithelium, not columnar. The brush border epithelium increases surface area for reabsorption of water, electrolytes, and nutrients.
Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{The descending limb of the loop of Henle is water permeable, and the proximal convoluted tubule is lined by simple cuboidal epithelium.}
Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:
Assertion A : Breast-feeding during initial period of infant growth is recommended by doctors for bringing a healthy baby.
Reason R : Colostrum contains several antibodies absolutely essential to develop resistance for the new born baby.
Choose the correct answer from the options given below:
- Assertion A is true: Breast-feeding during the initial period of infant growth is recommended for ensuring a healthy baby.
- Reason R is also true: Colostrum, the first milk produced after birth, contains antibodies that help the newborn develop immunity.
- The reason given is the correct explanation of the assertion.
Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{Colostrum provides essential antibodies to the newborn, which is one of the reasons why breast-feeding is highly recommended in the early stages.}
Following are the stages of pathway for conduction of an action potential through the heart:
A. AV bundle
B. Purkinje fibres
C. AV node
D. Bundle branches
E. SA node
Choose the correct answer from the options given below:
The correct sequence of conduction in the heart is:
- AV bundle (A) initiates the action potential.
- SA node (E) transmits the impulse to the AV node (C).
- The impulse then moves down the Purkinje fibres (B).
- Finally, it reaches the Bundle branches (D) to stimulate the ventricles. Quick Tip: \textbf{The heart's conduction system follows this order: SA node → AV node → AV bundle → Bundle branches → Purkinje fibres.}
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’
- The RNA product is complementary to the given DNA template strand.
- The DNA sequence provided is transcribed into RNA by RNA polymerase, with thymine (T) replaced by uracil (U) in the RNA strand.
Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{In transcription, RNA polymerase synthesizes RNA using the DNA template, replacing thymine with uracil.}
Match List I with List II
List I & List II
A. –I antitrypsin & I. Cotton bollworm
B. Cry IAb & II. ADA deficiency
C. Cry IAc & III. Emphysema
D. Enzyme replacement therapy & IV. Corn borer
Choose the correct answer from the options given below:
- -I antitrypsin is related with Emphysema (III), a lung disease.
- Cry IAb is used to protect plants against Cotton bollworm (I).
- Cry IAc is used to protect plants against Corn borer (II).
- Enzyme replacement therapy is used for treating ADA deficiency (IV), a genetic disorder.
Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: \textbf{Cry proteins from *Bacillus thuringiensis* are used to control pests like cotton bollworm and corn borer.}
The “Ti plasmid” of Agrobacterium tumefaciens stands for
- The Ti plasmid (Tumor inducing plasmid) of Agrobacterium tumefaciens is responsible for causing crown gall disease in plants by inducing tumor formation.
Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: The Ti plasmid is used in genetic engineering to introduce foreign genes into plants by causing tumor formation.
Match List I with List II
List-I & List-II
A. P wave & I. Heart muscles are electrically silent.
B. QRS complex & II. Depolarisation of ventricles.
C. T wave & III. Depolarisation of atria.
D. T-P gap & IV. Repolarisation of ventricles.
Choose the correct answer from the options given below:
- P wave corresponds to the depolarisation of the atria (II).
- QRS complex represents the depolarisation of the ventricles (III).
- T wave corresponds to the repolarisation of the ventricles (I).
- T-P gap represents the period when heart muscles are electrically silent (IV).
Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: The P wave, QRS complex, and T wave represent key phases of the cardiac cycle as seen in the electrocardiogram (ECG).
Given below are two statements:
Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely.
Statement II: According to Gause's principle, during competition, the inferior will be eliminated. This may be true if resources are limiting.
Choose the correct answer from the options given below:
- Statement I is correct: Gause's competitive exclusion principle suggests that two species competing for the same, limiting resource cannot coexist indefinitely, not that they cannot compete for different resources.
- Statement II is correct: The inferior competitor in a limiting resource scenario may indeed be eliminated, according to the principle.
Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Gause’s principle states that two species competing for the same limiting resource cannot coexist indefinitely.
Given below are two statements:
Statement I: Mitochondria and chloroplasts both double membranes bound organelles.
Statement II: Inner membrane of mitochondria is relatively less permeable, as compared to chloroplast.
Choose the correct answer from the options given below:
- Statement I is correct: Both mitochondria and chloroplasts have a double membrane structure.
- Statement II is correct: The inner membrane of mitochondria is highly impermeable, while the inner membrane of chloroplasts is permeable for the transport of ions and metabolites.
Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Both mitochondria and chloroplasts have double membranes, but the permeability of their inner membranes varies.
Choose the correct statement given below regarding juxta medullary nephron.
- Juxta medullary nephrons have their renal corpuscle located in the outer portion of the renal cortex, and their Loop of Henle extends deeply into the renal medulla, which helps in the concentration of urine.
- Cortical nephrons are more numerous than juxta medullary nephrons. Quick Tip: Juxta medullary nephrons play a crucial role in urine concentration due to their deep loops of Henle.
Match List I with List II
List-I & List-II
A. Exophthalmic goiter & I. Excess secretion of cortisol, moon face \& hyperglycemia.
B. Acromegaly & II. Hypo-secretion of thyroid hormone and stunted growth.
C. Cushing’s syndrome & III. Hyper secretion of thyroid hormone \& protruding eyeballs.
D. Cretinism & IV. Excessive secretion of growth hormone.
Choose the correct answer from the options given below:
- Exophthalmic goiter is caused by hyper secretion of thyroid hormone and protruding eyeballs (I).
- Acromegaly is caused by excessive secretion of growth hormone (III).
- Cushing’s syndrome is caused by excess secretion of cortisol, moon face, and hyperglycemia (II).
- Cretinism is caused by hypo-secretion of thyroid hormone and stunted growth (IV).
Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Exophthalmic goiter, acromegaly, Cushing’s syndrome, and cretinism are all endocrine disorders caused by hormonal imbalances.
Match List I with List II
List-I & List-II
A. Unicellular glandular epithelium & I. Salivary glands
B. Compound epithelium & II. Pancreas
C. Multicellular glandular epithelium & III. Goblet cells of alimentary canal
D. Endocrine glandular epithelium & IV. Moist surface of buccal cavity
Choose the correct answer from the options given below:
- Unicellular glandular epithelium is represented by Goblet cells of the alimentary canal (II).
- Compound epithelium is found in the moist surface of the buccal cavity (I).
- Multicellular glandular epithelium is represented by salivary glands (IV).
- Endocrine glandular epithelium is found in the pancreas (III).
Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Different types of epithelial tissues are specialized for secretion, absorption, and protection, such as in glands and the digestive system.
Match List I with List II
List I & List II
A. RNA polymerase III & I. snRNPs
B. Termination of transcription & II. Promotor
C. Splicing of Exons & III. Rho factor
D. TATA box & IV. SnRNAs, tRNA
Choose the correct answer from the options given below:
- RNA polymerase III synthesizes SnRNAs and tRNA (III).
- Termination of transcription is related with the Rho factor (IV).
- Splicing of Exons is catalyzed by snRNPs (I).
- The TATA box is part of the Promotor region (II).
Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: RNA polymerase III is responsible for synthesizing small RNAs like snRNA and tRNA, while the TATA box is involved in the initiation of transcription.
Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.
- FSH (Follicle Stimulating Hormone) is essential for the regulation of Sertoli cells, which support the development of sperm cells.
- Leydig cells are responsible for the secretion of testosterone, which plays a crucial role in spermatogenesis.
- Spermiogenesis refers to the final process in sperm development, where mature sperm are formed.
Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: FSH and Leydig cells work together to regulate spermatogenesis, while spermiogenesis involves the transformation of spermatids into mature sperm.
Regarding catalytic cycle of an enzyme action, select the correct sequential steps:
A. Substrate enzyme complex formation.
B. Free enzyme ready to bind with another substrate.
C. Release of products.
D. Chemical bonds of the substrate broken.
E. Substrate binding to active site.
Choose the correct answer from the options given below:
The correct sequence of steps in the catalytic cycle of enzyme action is:
1. Free enzyme ready to bind with another substrate (B)
2. Substrate enzyme complex formation (A)
3. Release of products (C)
4. Chemical bonds of the substrate broken (D)
5. Substrate binding to active site (E)
Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: The catalytic cycle of enzyme action involves substrate binding, bond breaking, product release, and enzyme resetting.
The following are the statements about non-chordates:
A. Pharynx is perforated by gill slits.
B. Notochord is absent.
C. Central nervous system is dorsal.
D. Heart is dorsal if present.
E. Post anal tail is absent.
Choose the correct answer from the options given below:
- Non-chordates lack a notochord (B), and the heart is dorsal if present (D).
- Non-chordates may also lack a post-anal tail (E).
- Pharyngeal gill slits and a dorsal central nervous system are characteristic features of chordates, not non-chordates.
Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Non-chordates do not possess a notochord or post-anal tail and typically have a dorsal heart if present.
Match List I with List II related to digestive system of cockroach.
List I & List II
A. Structures for storing of food & I. Gizzard
B. Ring: 6-8 blind tubules at junction of foregut and midgut. & II. Gastric Caeca
C. Ring: 100-150 yellow filaments at junction of midgut and hindgut. & III. Malpighian tubules
D. Structures for grinding the food. & IV. Crop
Choose the correct answer from the options given below:
- The Crop (A) is used for storing food (IV).
- The Gastric Caeca (B) are the rings of tubules at the junction of foregut and midgut (II).
- The Malpighian tubules (C) are located at the junction of midgut and hindgut (III).
- The Gizzard (D) is responsible for grinding the food (I).
Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: The digestive system of cockroaches includes structures for food storage (crop), grinding (gizzard), and waste removal (Malpighian tubules).
Given below are two statements:
Statement I: The cerebral hemispheres are connected by nerve tract known as corpus callosum.
Statement II: The brain stem consists of the medulla oblongata, pons and cerebrum.
Choose the correct answer from the options given below:
- Statement I is correct because:
The corpus callosum is the structure connecting the two cerebral hemispheres.
- Statement II is incorrect because:
The brain stem consists of the medulla oblongata, pons, and midbrain, not the cerebrum.
Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: The corpus callosum connects the cerebral hemispheres, and the brain stem consists of the medulla oblongata, pons, and midbrain, not the cerebrum.
Match List I with List II
List I & List II
A. Mesozoic Era & I. Lower invertebrates
B. Proterozoic Era & II. Fish \& Amphibia
C. Cenozoic Era & III. Birds \& Reptiles
D. Paleozoic Era & IV. Mammals
Choose the correct answer from the options given below:
- The Mesozoic Era is related with birds and reptiles (III).
- The Proterozoic Era is related with lower invertebrates (I).
- The Cenozoic Era is related with mammals (IV).
- The Paleozoic Era is related with fish and amphibians (II).
Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: The Mesozoic Era is often called the age of reptiles and birds, while the Cenozoic Era is known for the rise of mammals.
As per ABO blood grouping system, the blood group of father is B+, mother is A+ and child is O+. Their respective genotype can be:
- The father has blood group B+, and his genotype can be IB IB or IB i.
- The mother has blood group A+, and her genotype can be IA IA or IA i.
- The child has blood group O+, and the genotype must be ii.
Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: In ABO blood grouping, the O blood group results from inheriting an O allele from both parents (ii).
Given below are two statements:
Statement I: Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced.
Statement II: Both bone marrow and thymus provide micro environments for the development and maturation of T-lymphocytes.
Choose the correct answer from the options given below:
- Statement I is incorrect because:
Bone marrow is not the primary site for the production of all blood cells, including lymphocytes.
- Statement II is correct because:
Both bone marrow and thymus are crucial in the development and maturation of T-lymphocytes.
Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Bone marrow produces blood cells, while the thymus is essential for the maturation of T-lymphocytes.
*The article might have information for the previous academic years, please refer the official website of the exam.