Step 1: Formula for time period of a magnetic needle in a uniform field.
The time period is given by: \[ T = 2\pi \sqrt{\frac{I}{MB}} \]

Step 2: Rearrange to find magnetic moment. \[ M = \frac{I}{B\left(\frac{T}{2\pi}\right)^2} \]

Step 3: Substitute given values. \[ M = \frac{9.8 \times 10^{-6}}{0.049 \cdot \left(\frac{5}{20 \cdot 2\pi}\right)^2} = 1280\pi^2 \]

Conclusion: The correct value of \( x \) is \( \mathbf{(3)} \, 1280\pi^2 \). Quick Tip: For oscillating systems in magnetic fields, always relate the time period to the moment of inertia and magnetic moment.

Step 1: Analyze statement A.

The current-voltage (I-V) characteristics of a solar cell lie in the IV quadrant because the cell generates power.


Step 2: Analyze statement B.

The reverse bias current in a pn junction diode is due to minority charge carriers, making statement B correct.
Quick Tip: Always recall that solar cells generate power, and reverse bias current in diodes originates from minority carriers.

Step 1: Identify amplitude.

The amplitude is the coefficient of sine, which is \( 5 \, m \).


Step 2: Calculate time period.

The angular frequency \( \omega = \frac{\pi}{3} \). The time period \( T \) is given by: \[ T = \frac{2\pi}{\omega} = \frac{2\pi}{\frac{\pi}{3}} = 2 \, s \]


Conclusion: The correct option is \( \mathbf{(1)} \, 5 \, m, 2 \, s \). Quick Tip: Amplitude is the maximum displacement, and time period is calculated as \( T = \frac{2\pi}{\omega} \).

Step 1: Relate de Broglie wavelength and energy.


From \( \lambda = \frac{h}{\sqrt{2mE}} \), it follows that \( \frac{1}{\lambda^2} \propto E \).


Step 2: Interpret the graph.


A linear relationship between \( \frac{1}{\lambda^2} \) and \( E \) corresponds to Graph 1.


Conclusion: The correct option is (3).
Quick Tip: Always remember the proportional relationship between \( \frac{1}{\lambda^2} \) and energy in de Broglie’s equation.

Step : Use the formula for moment of inertia. \[ I = \frac{1}{12} M L^2 \]

Step 2: Solve for \( L \). \[ 2400 = \frac{1}{12} \cdot 400 \cdot L^2 \implies L = 8.5 \, cm \]

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Moment of inertia depends on mass distribution and the axis of rotation.

Step 1: Use the formula for elongation.
The elongation \( \Delta L \) is given by: \[ \Delta L = \frac{\sigma L}{Y} \]
where \( \sigma = 8 \times 10^8 \, N/m^2 \), \( L = 1 \, m \), and \( Y = 2 \times 10^{11} \, N/m^2 \).

Step 2: Substitute the values. \[ \Delta L = \frac{(8 \times 10^8) \times 1}{2 \times 10^{11}} = 4 \, mm. \]

Conclusion: The correct option is \( \mathbf{(2)} \, 4 \, mm \). Quick Tip: Elongation is directly proportional to the applied stress and inversely proportional to Young’s modulus.

Step 1: Analyze the sequence of emissions.

- First \( \alpha \)-decay reduces mass number by 4 and atomic number by 2.

- \( \beta^- \)-decay increases atomic number by 1 without changing the mass number.

- \( \beta^+ \)-decay decreases atomic number by 1 without changing the mass number.

- Second \( \alpha \)-decay reduces mass number by 4 and atomic number by 2.


Step 2: Calculate final values.
Starting with \( ^{290}_{82}X \):
\[ Mass number: 290 - 4 = 286, \quad Atomic number: 82 - 2 + 1 - 1 - 2 = 81. \]


Conclusion: The correct option is 286, 81 . Quick Tip: In nuclear reactions, track changes in mass and atomic numbers systematically through each decay.

Step 1: Use the formula for force due to surface tension. \[ F = 2T \times circumference \]

Step 2: Calculate the circumference. \[ Circumference = 2\pi r = 2\pi \times 4.5 \times 10^{-2} = 0.2826 \, m. \]

Step 3: Calculate the force. \[ F = 2 \times 0.07 \times 0.2826 = 0.0396 \, N = 19.8 \, mN. \]

Conclusion: The correct option is \( \mathbf{(4)} \, 19.8 \, mN \). Quick Tip: Force due to surface tension depends on the circumference of the contact line and the surface tension coefficient.

Step 1: Calculate resistance of one part. \[ R_{part} = \frac{100}{10} = 10 \, \Omega. \]

Step 2: Calculate resistance of the first 5 parts in series. \[ R_{series} = 5 \times 10 = 50 \, \Omega. \]

Step 3: Calculate resistance of the next 5 parts in parallel. \[ R_{parallel} = \frac{R_{part}}{5} = \frac{10}{5} = 2 \, \Omega. \]

Step 4: Calculate total resistance. \[ R_{total} = R_{series} + R_{parallel} = 50 + 2 = 52 \, \Omega. \]

Conclusion: The correct option is \( \mathbf{(1)} \, 52 \, \Omega \). Quick Tip: In combination circuits, calculate series and parallel resistances separately before summing them.

Step 1: Use the formula for instantaneous power. \[ P = F \cdot v, \quad v = \frac{dx}{dt}. \]

Step 2: Differentiate displacement to find velocity. \[ v = \frac{d}{dt}(2t - 1) = 2 \, m/s. \]

Step 3: Calculate power. \[ P = 5 \times 2 = 10 \, W. \]

Conclusion: The correct option is \( \mathbf{(4)} \, 10 \, W \). Quick Tip: Instantaneous power is the product of force and instantaneous velocity.

Step 1: Analyze the logic gate.

The truth table for the given logic gate matches the operation of an AND gate where the output \( Y \) is high only when both inputs are high.


Step 2: Confirm the truth table.

Check each possible input-output pair to verify the AND gate operation.


Conclusion: The correct logic gate is \( \mathbf{(3)} \) AND gate. Quick Tip: Remember that an AND gate gives a high output only when all inputs are high.

Step 1: Use the formula for magnetic field at the centre of a circular coil. \[ B = \frac{\mu_0 N I}{2r} \]
where \( N = 100 \), \( I = 7 \, A \), \( r = 0.1 \, m \), and \( \mu_0 = 4\pi \times 10^{-7} \, T m/A \).

Step 2: Substitute the values. \[ B = \frac{(4\pi \times 10^{-7}) \cdot 100 \cdot 7}{2 \cdot 0.1} = 4.4 \, mT. \]

Conclusion: The correct option is \( \mathbf{(2)} \, 4.4 \, mT \). Quick Tip: The magnetic field at the centre of a circular coil is directly proportional to the number of turns and current.

Step 1: Apply Brewster's Law.

At Brewster's angle, the reflected and refracted light are perpendicular.


Step 2: Understand polarisation.

The refracted light becomes partially polarised at this angle.


Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Brewster's angle is defined as the angle at which light is perfectly polarised upon reflection.

Step 1: Use the Rydberg formula to calculate wavelengths.

The transitions correspond to specific wavelengths in the hydrogen spectrum.


Step 2: Match the wavelengths.

The given transitions and wavelengths match as follows:

- \( n_2 = 3 \) to \( n_1 = 2 \): 656.3 nm (A-III)

- \( n_2 = 4 \) to \( n_1 = 2 \): 486.1 nm (B-IV)

- \( n_2 = 5 \) to \( n_1 = 2 \): 434.1 nm (C-II)

- \( n_2 = 6 \) to \( n_1 = 2 \): 410.2 nm (D-I).


Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: The Balmer series corresponds to transitions to \( n = 2 \) in the hydrogen spectrum.

Step 1: Apply conservation of momentum.
In a completely inelastic collision: \[ m v_1 + 0 = (m + m) v_2. \]

Step 2: Solve for the ratio. \[ v_2 = \frac{v_1}{2}, \quad so v_1 : v_2 = 2 : 1. \]

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: In inelastic collisions, kinetic energy is not conserved, but momentum is always conserved.

Step 1: Understand magnetic properties.

- Diamagnetic materials have \( \chi \leq 0 \).

- Ferromagnetic materials exhibit very high \( \chi \).

- Paramagnetic materials have small positive \( \chi \).

- Non-magnetic materials have \( \chi = 0 \).


Step 2: Match properties with materials.

From the definitions above, the matches are: \[ A-II, B-III, C-IV, D-I. \]


Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Magnetic susceptibility (\( \chi \)) helps determine the type of material: negative for diamagnetic, large positive for ferromagnetic, and small positive for paramagnetic.

Step 1: Apply the work formula for a thermodynamic process.

Work \( W \) along a path in a pressure-volume graph is given by the area under the curve.


Step 2: Evaluate the path bc.

For path bc, work is done on the system, leading to negative work. Given data indicates \( W = 0 \, J \).


Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: In a pressure-volume graph, work done on the system is negative, and work done by the system is positive.

Step 1: Recall the dimensional formula for solid angle.

Solid angle is dimensionless.


Step 2: Match with given options.

- Strain and angle are having dimensions.

- Strain and arc, angular speed and stress are dimensionless.


Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Solid angles are dimensionless, similar to other ratios of lengths like stress and angle.

Step 1: Use the formula for gravity. \[ g = \frac{GM}{R^2}. \]

Step 2: Substitute for mass and radius.
If mass is \( \frac{1}{10}M_E \) and diameter (hence radius) is \( \frac{1}{2}R_E \), \[ g = \frac{G \cdot \frac{1}{10}M_E}{\left(\frac{1}{2}R_E\right)^2} = \frac{G M_E}{10 \cdot \frac{1}{4}R_E^2} = \frac{2}{5} g_E. \]

Step 3: Calculate.
For \( g_E = 9.8 \, m/s^2 \), \[ g = \frac{2}{5} \cdot 9.8 = 3.92 \, m/s^2. \]

Conclusion: The correct options are \( \mathbf{(1)} \) and \( \mathbf{(3)} \). Quick Tip: Gravity depends on both mass and radius. Decreasing radius increases gravity significantly.

Step 1: Use the formula for vernier constant. \[ Vernier constant = 1 MSD - 1 VSD. \]

Step 2: Relate divisions. \[ 1 MSD = 0.1 \, mm, \quad 1 VSD = \frac{N}{N+1} \cdot 1 MSD. \]

Step 3: Simplify. \[ Vernier constant = \frac{1}{100N+1} \, cm. \]

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Vernier constant is the smallest measurement a vernier scale can make.

Step 1: Analyze the truth table.

The given truth table represents an XOR gate. The output is high when inputs are different.


Step 2: Write the Boolean expression.

The XOR expression is \( Y = A \overline{B} + \overline{A}B \).


Conclusion: The correct option is 2. Quick Tip: XOR gate output is high when inputs differ, represented by \( A \overline{B} + \overline{A}B \).

Step 1: Verify Assertion.

The potential \( V \) for a dipole is calculated using \( V = \frac{1}{4\pi \epsilon_0} \frac{P}{r^3} \). The given \( V = \pm 9 \times 10^3 \, V \) is correct.

Step 2: Verify Reason.

The formula in Reason \( R \) is incorrect because the correct formula does not have the factor 2 in the numerator.

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Verify each component of the formula to check correctness in assertion-reason questions.

Step 1: Recall transformer voltage ratio.

The voltage ratio \( V_S : V_P = \frac{N_S}{N_P} \).


Step 2: Substitute given values.
For \( N_P = N_S \), the ratio \( V_S : V_P = 2 : 1 \).


Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: For an ideal transformer, \( \frac{V_S}{V_P} = \frac{N_S}{N_P} \). Equal turns imply equal voltage ratio.

Step 1: Understand fringe formation.

In Young’s experiment with white light, fringes of different wavelengths overlap to form bright fringes.


Step 2: Central bright fringe.

The central fringe is white because all wavelengths constructively interfere at the centre.


Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Replacing a monochromatic source with white light introduces wavelength-dependent fringe patterns.

Step 1: Recall tension formula.
The tension in a string is proportional to the square of angular velocity, \( T \propto \omega^2 \).


Step 2: Substitute for new speed.
If \( \omega \to 2\omega \)
4T



Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Tension increases quadratically with angular velocity in circular motion.

Step 1: Analyze the forces acting on the blocks.

Since the surface is frictionless, block B does not exert any force on block A.


Step 2: Evaluate force exerted.

The force between the two blocks is zero as they do not interact under the given conditions.


Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: On a frictionless surface, the interaction force between blocks depends on the direction of applied forces.

Step 1: Use the terminal voltage formula. \[ V = \mathcal{E} - Ir, \quad I = \frac{\mathcal{E}}{R + r}. \]

Step 2: Calculate current \( I \). \[ I = \frac{10}{4 + 1} = 2 \, A. \]

Step 3: Find terminal voltage. \[ V = 10 - (2 \times 1) = 8 \, V. \]

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: The terminal voltage is reduced due to the internal resistance of the battery.

Step 1: Analyze the circuit.

Identify series and parallel combinations of capacitors.


Step 2: Calculate equivalent capacitance.

For the given circuit, the total capacitance simplifies to \( 2 \, \muF \).


Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: In combination circuits, calculate series and parallel capacitances step by step.

Step 1: Evaluate Statement I.

Atoms are electrically neutral due to equal numbers of protons and electrons.


Step 2: Evaluate Statement II.

Atoms are not inherently stable; they emit characteristic spectra only under certain conditions like excitation.


Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Neutrality of atoms arises from charge balance, but stability depends on external conditions.

Step 1: Use Lenz's Law.

The induced current opposes the motion of the magnet, determining the directions of currents in solenoids.


Step 2: Determine directions.

Current in solenoid-1 flows from B to A and in solenoid-2 from C to D.


Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Apply Lenz’s law to find the direction of induced currents in moving magnetic systems.

Step 1: Analyze each statement.

- A, B, c, D are true because they describe basic properties of photons.

- E is incorrect because \( \nu \) refers to frequency, not charge.


Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Remember that photons are neutral particles with energy proportional to their frequency.

Step 1: Analyze the motion of points P and Q.

Both points have identical linear motion and are equidistant from the axis.


Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: In a rolling object, the points equidistant from the center have equal speed.

Step 1: Apply Snell’s law at the point of incidence. \[ n = \frac{\sin i}{\sin r}. \]

Step 2: Substitute values.
Given \( i = 30^\circ \), \( r = 60^\circ \): \[ n = \frac{\sin 30}{\sin 60} = \frac{\frac{1}{2}}{\frac{\sqrt{5}}{2}} = \frac{\sqrt{5}}{2}. \]

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Snell’s law helps calculate the refractive index using angles of incidence and refraction.

Step 1: Identify forces acting in circular motion.

Centripetal force provides constant acceleration towards the center.


Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: In circular motion, acceleration remains constant in magnitude but changes in direction.

Step 1: Use formula for potential difference.

The potential difference depends on the charge distribution on the spherical shell.


Step 2: Evaluate potential.

Given charge and geometry yield is 0.

Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: In a spherical shell, potential is uniform inside and depends on radius outside.

Step 1: Understand displacement current.

The displacement current is equal in magnitude to the conduction current but flows in the opposite direction.


Step 2: Analyze the capacitor circuit.

In a capacitor circuit, displacement current balances conduction current to maintain continuity of current flow.


Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Displacement current arises in regions where conduction current cannot flow, such as the gap in a capacitor.

Step 1: Use the formula for thermal stress. \[ F = Y \cdot A \cdot \alpha \cdot \Delta T, \]
where \( Y = 0.5 \times 10^{11} \, N/m^2 \), \( \alpha = 10^{-5} \, C^{-1} \), \( \Delta T = 100C \), and \( A = 10^{-3} \, m^2 \).

Step 2: Substitute values. \[ F = (0.5 \times 10^{11}) \cdot (10^{-3}) \cdot (10^{-5}) \cdot 100 = 50 \times 10^3 \, N. \]

Conclusion: The correct option is (1). Quick Tip: Thermal stress depends on Young's modulus, temperature change, and material's thermal expansion coefficient.

Step 1: Analyze properties of electromagnetic waves.

- Electromagnetic waves are transverse and travel at the speed of light in free space.

- They originate from accelerating charges, not charges moving at uniform speed.


Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Electromagnetic waves are characterized by their transverse nature and speed determined by free space properties.

Step 1: Calculate total energy at altitude \( 2R \).
The potential energy is \( -\frac{GMm}{3R} \), and the kinetic energy is \( \frac{GMm}{6R} \).

Step 2: Find minimum energy required.
The total energy needed is \( \frac{5}{6} \frac{GMm}{R} \).

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: The energy needed depends on both potential and kinetic energy components at the desired orbit.

Step 1: Analyze power in series and parallel connections.

In series, power is proportional to \( \frac{1}{R} \), and in parallel, power is proportional to \( \frac{1}{R^2} \).


Step 2: Calculate power ratio.

The ratio \( P_{series} : P_{parallel} = 2 : 9 \).


Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: In series, the current through resistors is the same; in parallel, the voltage across resistors is the same.

Step 1: Use the formula for capacitive reactance. \[ X_c = \frac{1}{2\pi f C}, \]
where \( f = 50 \, Hz \), \( C = 10 \times 10^{-6} \, F \).

Step 2: Calculate capacitive reactance. \[ X_c = \frac{1}{2 \times 3.14 \times 50 \times 10 \times 10^{-6}} = 318.3 \, \Omega. \]

Step 3: Find the peak current. \[ I_{peak} = \frac{V_{peak}}{X_c}, \quad V_{peak} = \sqrt{2} \cdot V_{rms} = \sqrt{2} \cdot 210 = 297 \, V. \] \[ I_{peak} = \frac{297}{318.3} \approx 0.93\, A. \]

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Always calculate \( V_{peak} \) using \( V_{peak} = \sqrt{2} \cdot V_{rms} \) in AC circuits.

Step 1: Use the formula for time period.
The time period of a pendulum is given by: \[ T = 2\pi \sqrt{\frac{L}{g}}. \]

Step 2: Analyze the changes.
The length \( L \) is reduced to \( \frac{L}{2} \), but the mass does not affect the time period.

Step 3: Calculate the new time period. \[ T_{new} = 2\pi \sqrt{\frac{\frac{L}{2}}{g}} = \frac{1}{\sqrt{2}} \cdot T. \]

Conclusion: The new time period is \( \sqrt{2} \) times the original. The correct option is \( \mathbf{(1)} \). Quick Tip: The time period of a simple pendulum depends only on its length and acceleration due to gravity, not on its mass.

Step 1: Analyze forces for magnetic and non-magnetic materials.

- Magnetic sheets require a force to stay stationary near a pole.

- Conducting sheets experience forces due to induced currents when moved.


Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Conducting materials experience electromagnetic forces in motion near magnetic fields.

Step 1: Understanding the Bridge Balance Condition
For a Wheatstone bridge to be balanced, the ratio of resistances in both branches should satisfy:
\[ \frac{R_1}{R_2} = \frac{R_3}{R_4} \]

Step 2: Checking the Given Circuits
For Option (2):
\[ \frac{10}{15} = \frac{4}{6} \]

Since both ratios are equal, the bridge is balanced.

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: To achieve a balanced Wheatstone bridge, ensure that the ratio of resistances in one branch equals the ratio in the other branch.

Step 1: Analyze the effect of moving plates closer.

- As plates are moved closer, capacitance increases, but the energy stored decreases due to a reduction in the electric field strength.

- The ratio of charge to voltage remains constant, satisfying property D.


Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Capacitance changes inversely with plate separation, influencing charge and energy properties.

Step 1: Recall the effect of bending on magnetic moment.

Bending increases the effective magnetic moment by a factor dependent on geometry.


Step 2: Calculate new magnetic moment.

The new configuration doubles the magnetic moment.


Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Magnetic moment depends on length and orientation of the magnetic material.

Analyze the given velocity-time graph.

A constant slope in the velocity-time graph corresponds to constant acceleration.


Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: The slope of a velocity-time graph represents acceleration. Constant slope implies constant acceleration.

Step 1: Use the formula for magnifying power. \[ M = \frac{f_{objective}}{f_{eyepiece}}. \]

Step 2: Substitute the values. \[ M = \frac{140}{5} = 28. \]

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Magnifying power increases with the focal length of the objective and decreases with the focal length of the eyepiece.

Step 1: Use Charles’s law.
At constant pressure, \( V \propto T \).


Step 2: Analyze the graph.
Higher pressure corresponds to steeper slopes. From the graph, \( P_1 > P_2 > P_3 \).


Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: The slope of the T-V curve increases with pressure in isobaric processes.

Step 1: Analyze dimensions.
Force \( F \) has dimensions \( MLT^{-2} \).

Step 2: Check dimensions of \( \alpha \) and \( \beta \).
- \( \alpha \): \( MLT^{-4} \).
- \( \beta \): \( MLT^{-3} \).
- \( \alpha \beta t \): \( (MLT^{-4})(MLT^{-3})(T) = dimensionless. \)

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Use dimensional analysis to verify whether a given combination of quantities is dimensionless.

Step 1: Understanding spin-only magnetic moment

The spin-only magnetic moment is determined by the number of unpaired electrons in an ion. The formula is: \[ \mu_s = \sqrt{n(n+2)} \, BM \]
where \( n \) is the number of unpaired electrons.


Step 2: Evaluate each ion

- Ti\(^+\): Has the same number of unpaired electrons as Sc\(^3+\).

- Mn\(^2+\), Cr\(^2+\), Fe\(^2+\) have different numbers of unpaired electrons.


Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: The magnetic moment depends on the number of unpaired electrons. Use the formula \( \mu_s = \sqrt{n(n+2)} \) to compare ions.

Step 1: Determine the required Faraday per conversion

- A. 1 mol of H\(_2\)O to O\(_2\): Requires 2 electrons per H\(_2\)O, leading to 1F.

- B. MnO\(_4^-\) to Mn\(^{2+}\): Mn reduction requires 5 electrons, leading to 5F.

- C. Ca from CaCl\(_2\): 1.5 mol of Ca requires 3F.

- D. FeO to Fe\(_2\)O\(_3\): Conversion needs 5F.


Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: The number of Faradays required corresponds to the total number of electrons transferred in the redox reaction.

Step 1: Understanding Fehling’s solution components

Fehling’s solution consists of two separate solutions:

- Fehling’s solution A: Contains aqueous copper(II) sulphate.

- Fehling’s solution B: Contains alkaline sodium potassium tartrate.


Step 2: Identify the correct component

Since Fehling’s solution A contains aqueous copper sulphate, the correct answer is option (4).


Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Fehling’s solution is used to test for reducing sugars. Part A contains copper(II) sulphate, and Part B contains alkaline sodium potassium tartrate.

Step 1: Understanding the chemical reactions

- A. Friedel-Crafts acylation requires Cl/Anhydrous AlCl\(_3\) (I).

- B. Oxidation of benzyl alcohol requires CrO\(_3\) (II).

- C. Oxidation of benzyl side chain needs KMnO\(_4\)/KOH (III).

- D. Ozonolysis reaction follows (i) O\(_3\), (ii) Zn+H\(_2\)O (IV).


Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: For oxidation reactions, CrO\(_3\) is commonly used for mild oxidation, while KMnO\(_4\) is a stronger oxidizing agent.

Step 1: Understanding Lucas Reagent Reaction

Lucas reagent (\(HCl/ZnCl_2\)) is used to differentiate between primary, secondary, and tertiary alcohols.


Step 2: Reactivity Order

- Tertiary alcohols react instantly, forming a turbidity.

- Secondary alcohols react within a few minutes.

- Primary alcohols show no visible reaction at room temperature.


Step 3: Identify the Alcohol Type
- (1) CH\(_3\) – C – CH\(_3\) – OH is a tertiary alcohol, reacting instantly.

- Other options are primary/secondary alcohols and react slower.


Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Lucas reagent is used to classify alcohols based on their reactivity. Tertiary alcohols react immediately, while primary alcohols do not react.

Step 1: Understanding intramolecular hydrogen bonding

Intramolecular hydrogen bonding occurs within a molecule when a hydrogen atom forms a bond with an electronegative atom within the same molecule.


Step 2: Analyze the options

- (1) and (2): No intramolecular hydrogen bonding is possible due to the lack of a suitable structure.

- (3) HF: Hydrogen bonding in HF is intermolecular, not intramolecular.

- (4): The structure has –OH and –NO\(_2\) groups positioned such that hydrogen bonding occurs within the molecule.


Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Intramolecular hydrogen bonding stabilizes the molecule by forming bonds within itself, typically between –OH and other groups like –NO\(_2\).

Step 1: Analyze each compound's geometry

- A. NH\(_3\): The geometry is trigonal pyramidal due to the lone pair on nitrogen (I).

- B. BrF\(_5\): The geometry is square pyramidal, with one lone pair on bromine (IV).

- C. XeF\(_4\): The geometry is square planar due to two lone pairs on xenon (II).

- D. SF\(_6\): The geometry is octahedral with no lone pairs on sulfur (III).


Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: To determine molecular geometry, consider the number of lone pairs and bonded atoms using VSEPR theory.

Step 1: Analyze the statements

- Statement 1: The boiling point order is actually \( n-pentane > isopentane > neopentane \), which is correct in most cases,

- Statement 2: This explains the effect of branching accurately, hence it is correct.


Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Branching decreases boiling point due to reduced surface area for intermolecular interactions.

Step 1: Understanding entropy

Entropy increases when a system moves towards disorder or randomness.


Step 2: Analyze the options

- (1): Evaporation increases randomness, hence entropy increases.

- (2): Lowering the temperature of a solid decreases entropy.

- (3): Entropy change depends on gaseous and liquid products; here it is ambiguous.

- (4): Dissociation into atoms increases entropy, but less than (1).


Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Phase transitions from solid to liquid to gas increase entropy.

Step 1: Reaction of NaOH and HCl \[ NaOH + HCl → NaCl + H\(_2\)O \]


Step 2: Calculate moles of reactants
- Moles of HCl: \( 0.025 \, L \times 0.75 \, M = 0.01875 \, mol \)
- Moles of NaOH in 1 g: \( \frac{1}{40} = 0.025 \, mol \).


Step 3: Compare moles and find limiting reactant
- HCl is the limiting reactant and reacts completely with NaOH.


Conclusion: The mass of NaOH left is \( \mathbf{250} \, mg \). Quick Tip: Always determine the limiting reactant to calculate unreacted quantities.

Step 1: Analyze the bonding in each molecule

- A. Benzene: Resonance gives \( \pi\)-bonds and \( \sigma\)-bonds, classified as (I).

- B. Ethene: Double bond has one \(\pi\)-bond and one \(\sigma\)-bond (II).

- C. Acetylene: Triple bond has two \(\pi\)-bonds and one \(\sigma\)-bond (IV).

- D. Ethane: Single bond with no \(\pi\)-bonds, only three \(\sigma\)-bonds (III).


Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Analyze bonding types (single, double, triple bonds) to determine the number of \(\pi\)- and \(\sigma\)-bonds.

Step 1: Analyze the statements

- Statement 1: The given order is correct. Due to increasing molecular mass, boiling points generally increase, but H\(_2\)O has the highest due to strong hydrogen bonding.

- Statement 2: This correctly explains why H\(_2\)O has a higher boiling point than expected.


Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Hydrogen bonding significantly affects boiling points. The stronger the hydrogen bonding, the higher the boiling point.

Identifying types of isomerism

- A: Linkage isomerism (NO\(_2^-\) can bond through N or O) (III).

- B: Ionization isomerism (SO\(_4\) and Cl exchange) (II).

- C: Coordination isomerism (exchange between ligands) (I).

- D: Solvate isomerism (water ligand variations) (IV).


Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Different ligands and ion-exchange processes lead to different types of isomerism in coordination compounds.

Step 1: Use Avogadro’s law
- 1 mole of He = 4 g contains \( 6.022 \times 10^{23} \) atoms.
- Calculate the number of moles in 2.27108 g: \[ \frac{2.27108}{4} = 0.5678 moles \]
- Number of He atoms: \[ 0.5678 \times 6.022 \times 10^{23} = 4 \]

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: To determine the number of atoms, use Avogadro’s number and the molar mass of the element.

Step 1: Understanding the oxidation process

- Cyclohexanol (an alcohol) is oxidized to cyclohexanone (a ketone).

- Pyridinium chlorochromate (PCC) selectively oxidizes alcohols to ketones without further oxidation to carboxylic acids.


Step 2: Analyzing the other options

- BH\(_3\): Used for hydroboration, not oxidation.

- H\(_2\)O\(_2\) / OH\(^-\): Used for oxidation but gives different products.

- H\(_2\) + Pd: Used for hydrogenation, not oxidation.


Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: PCC is a selective oxidizing agent that converts alcohols to aldehydes or ketones without over-oxidation.

Step 1: Evaluate stability of carbocations

The stability of a carbocation is influenced by:

- Hyperconjugation

- Resonance

- Inductive effects


Step 2: Analyze the options

- (1): No resonance or significant stabilization.

- (2): Limited hyperconjugation effects.

- (3): Stabilized by resonance.

- (4): Most stable due to resonance with benzene ring.


Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Carbocation stability increases with resonance and hyperconjugation effects. Benzyl and allyl carbocations are highly stable.

Step 1: Understanding electronegativity trends
Electronegativity increases across a period and decreases down a group in the periodic table.


Step 2: Analyze the elements

- Fluorine (F) is the least electronegative.

- Oxygen (O) follows fluorine.

- Nitrogen (N) is less electronegative than O and F.

- Carbon (C) and silicon (Si) are more electronegative than N.


Conclusion: The correct order is \( \mathbf{(4)} \). Quick Tip: Electronegativity increases from left to right across a period and decreases down a group.

Step 1: Analyze Arrhenius equation
The Arrhenius equation is given as: \[ \ln k = -\frac{E_a}{R} \cdot \frac{1}{T} + \ln A \]
This represents a straight line with a negative slope.


Step 2: Analyze the options

- (1): Linear with a negative slope is consistent with the equation.

- Other options: Do not align with the mathematical form of the Arrhenius equation.


Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: The slope of an ln \( k \) vs \( \frac{1}{T} \) graph is proportional to the activation energy \( E_a \).

Step 1: Understand oxidation states in Group 16

- Oxygen (O): Commonly shows -2 oxidation state.

- Sulfur (S), Selenium (Se): Also exhibit -2 oxidation states.

- Tellurium (Te): Rarely shows -2 oxidation state due to its larger size and metallic character.


Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: The tendency to exhibit negative oxidation states decreases down a group due to increasing metallic character.

Step 1: Analyze ionization enthalpy trends

Ionization enthalpy increases across a period due to increasing nuclear charge and decreases down a group due to increasing atomic size.


Step 2: Analyze the elements

- Lithium (Li): Lowest ionization enthalpy due to its larger size.

- Boron (B) and Beryllium (Be): Boron is lower due to p-orbital shielding.

- Carbon (C) and Nitrogen (N): C has a lower ionization enthalpy than N due to half-filled stability in N.


Conclusion: The correct order is \( \mathbf{(1)} \). Quick Tip: Ionization enthalpy increases across a period and decreases down a group. Stability of half-filled orbitals also affects the trend.

Step 1: Analyze Statement 1

Aniline does not undergo Friedel-Crafts alkylation reaction because the amino group (-NH\(_2\)) gets protonated in the acidic medium, deactivating the benzene ring.


Step 2: Analyze Statement 2

Aniline cannot be prepared through Gabriel synthesis because Gabriel synthesis is specific to preparing primary aliphatic amines and not aromatic amines.


Conclusion: Both statements are true. The correct option is \( \mathbf{(4)} \). Quick Tip: Aromatic amines cannot be prepared by Gabriel synthesis and are deactivated for Friedel-Crafts reactions.

Step 1: Analyze Statement 1
Both complexes are octahedral due to their coordination number being 6. This statement is true.


Step 2: Analyze Statement 2

- [Co(NH\(_3\))\(_6\)]\(^{3+}\) is diamagnetic because NH\(_3\) is a strong field ligand, causing pairing of electrons.

- [CoF\(_6\)]\(^{3-}\) is paramagnetic because F\(^-\) is a weak field ligand, which does not pair all electrons.


The statement about magnetic behavior is correct, but the classification is reversed.


Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Magnetic behavior depends on the ligand field strength: strong field ligands pair electrons, while weak field ligands do not.

Step 1: Understand the concept of half-filled stability

The d\(^5\) configuration corresponds to a half-filled stable subshell. Transition from d\(^5\) to d\(^4\) results in loss of stability and a more positive \( E^\circ \) value.


Step 2: Analyze the options

Only Mn\(^4+\)/Mn\(^5+\) involves this change in configuration.


Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Half-filled and fully filled d-orbitals are exceptionally stable, influencing redox potentials.

Step 1: Analyze each quantum number

- \( n \) (principal quantum number):

Determines the size of the orbital (IV).

- \( l \) (azimuthal quantum number):

Determines the shape of the orbital (III).

- \( m \) (magnetic quantum number):

Determines the orientation of the orbital (II).

- \( s \) (spin quantum number): Determines the orientation of the electron’s spin (I).


Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Quantum numbers provide specific information: \( n \) (size), \( l \) (shape), \( m \) (orientation), \( s \) (spin).

Step 1: Calculate Q (Reaction Quotient) \[ Q = \frac{[C]}{[A]^2[B]} = \frac{2 \times 10^{-3}}{(2 \times 10^{-3})^2 \cdot (2 \times 10^{-3})} = 125 \]

Step 2: Compare Q with K\(_c\)
Given \( K_c = 4 \times 10^3 \), \( Q < K_c \), so the reaction proceeds in the forward direction.

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Compare Q and K\(_c\) to determine the direction of the reaction. If \( Q < K\), reaction proceeds forward; if \( Q > K\), reaction proceeds backward.

Step 1: Match the processes with their conditions

- Isobaric process: Constant pressure (III).

- Isothermal process: Constant temperature (II).

- Isochoric process: Constant volume (IV).

- Adiabatic process: No heat exchange (I).


Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Remember: Isobaric (pressure), Isothermal (temperature), Isochoric (volume), and Adiabatic (no heat exchange).

Step 1: Relation between K\(_p\) and K\(_c\) \[ K_p = K_c (RT)^{\Delta n} \]
Where \( \Delta n = \) change in moles of gas.

Step 2: Analyze the reactions
- For \( H_2 + Cl_2 \to 2HCl \), \( \Delta n = 0 \), so \( K_p = K_c \).
- For other options, \( K_p \neq K_c \).

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: When \( \Delta n = 0 \) (no change in gas moles), \( K_p = K_c \). For \( \Delta n \neq 0 \), \( K_p \neq K_c \).

Step 1: Analyze reactions of glucose
- Glucose reacts with Fehling’s solution, NH\(_2\)OH, and NaHSO\(_3\) to form respective products.

- It does not reduce Tollen’s reagent due to its cyclic structure in equilibrium.


Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Tollen’s reagent is reduced by free aldehyde groups, but glucose in cyclic form does not readily reduce it.

Understanding sublimation
Sublimation is the direct transition from solid to gas without passing through the liquid phase. It is used to purify substances like camphor, iodine, etc.


Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Sublimation is ideal for purifying substances that sublimate without decomposition.

Step 1: Identify redox reactions

Redox reactions involve transfer of electrons, i.e., oxidation and reduction.


Step 2: Analyze the reactions

- Reaction (4) is not a redox reaction as no oxidation or reduction occurs.


Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: A redox reaction involves changes in oxidation states of the elements involved.

Step 1: Understanding Henry’s Law

Henry’s law states that the solubility of a gas in a liquid is inversely proportional to its Henry’s law constant (K\(_H\)).


Step 2: Compare solubility

- Higher K\(_H\) value means lower solubility.


- Given \( K_H \) values, the correct solubility order is A > C > B.


Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Gases with lower Henry’s constant are more soluble in water.

Step 1: Arrhenius equation \[ k = A e^{-\frac{E_a}{RT}} \]
By measuring the rate constant at different temperatures, activation energy can be calculated.

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: The Arrhenius equation relates activation energy with temperature and rate constant.

Step 1: Energy of an electron in hydrogen-like species \[ E_n = - \frac{13.6Z^2}{n^2} eV \]
For Be\(^{3+}\), \( Z = 4 \).

Step 2: Calculate energy
For \( n = 2 \), \[ E = -x \times \left( \frac{4^2}{2^2} \right) = -4x \]

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: The energy of an electron in hydrogen-like atoms is proportional to \( \frac{Z^2}{n^2} \).

Step 1: Understanding S\(_N1\) Mechanism

S\(_N1\) reactions proceed faster in tertiary carbocations due to greater stability.


Step 2: Compare the structures

- Compound (3): Forms the most stable tertiary carbocation, leading to the fastest reaction.


Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: S\(_N1\) reactions are favored by stable carbocations and polar protic solvents.

Step 1: Analyze molecular formula and structure

- C\(_6\)H\(_{14}\) is an alkane.

- 2,3-dimethylbutane contains two tertiary carbons, making it the correct answer.


Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Tertiary carbons are bonded to three other carbon atoms. Identify them to determine the structure.

Step 1: Understanding qualitative group separation

Cations are divided into groups based on their precipitation reactions with specific reagents.


Step 2: Arranging the given cations
- Ba\(^{2+}\) (Group 0)
- Ag\(^+\) (Group I)
- Ca\(^{2+}\) (Group II)
- Cu\(^{2+}\) (Group VI)

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Cations are grouped in qualitative analysis based on their precipitation behavior with specific reagents.

Identify reaction products

- First reaction: Alcohol reacts with PCl\(_3\) to form POCl\(_3\) as A.

- Second reaction: Alcohol reacts with PCl\(_5\), producing HPO\(_3\) as B.


Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Phosphorus chlorides react with alcohols to form organic halides and phosphorus oxyacids.

Understanding Fe\(^{2+}\) hydrolysis

- Fe\(^{2+}\) ions in aqueous solutions tend to hydrolyze, leading to oxidation to Fe\(^{3+}\).

- Sulphuric acid prevents oxidation by maintaining a low pH.


Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Sulphuric acid is commonly used to prevent oxidation of Fe\(^{2+}\) in solution.

Step 1: Use the van’t Hoff equation \[ \Pi = cRT \]
where \( R = 0.0831 \) L bar mol\(^{-1}\) K\(^{-1}\).

Step 2: Calculate temperature \[ T = \frac{25.73}{0.0831} = 310 K = 37^\circ C \]

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Osmotic pressure is directly proportional to concentration and temperature.

Step 1: Use the formula for work done in isothermal expansion \[ W = - nRT \ln \frac{P_2}{P_1} \]

Step 2: Substituting values \[ W = - (1)(2.0)(298) \ln \frac{10}{20} \]
\[ = - (2.0 \times 298) (-0.693) = 140 calories \]

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: For isothermal expansion, use \( W = - nRT \ln \frac{P_2}{P_1} \) to calculate work done.

Understanding diamagnetism in lanthanides

- Diamagnetic species have all electrons paired.

- Gd\(^3+\) and Eu\(^3+\) have fully filled f-orbitals, making them diamagnetic.


Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Lanthanide ions with fully filled or empty f-orbitals are diamagnetic.

Step 1: Understanding dipole moments
- NH\(_3\) has a higher dipole moment than NF\(_3\) due to the strong lone pair-bond moment interaction.


Step 2: Analyze the options

- (3) and (4): True, but not relevant to dipole moment.

- (2): Incorrect as NH\(_3\) has a higher dipole moment than NF\(_3\).


Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: The dipole moment depends on lone pair interactions and bond polarities.

Step 1: Use Faraday's law \[ m = \frac{ZIt}{F} \]
where \( Z = \frac{Molar mass}{nF} \).

Step 2: Substituting values \[ m = \frac{63 \times 9.6487 \times 100}{2 \times 96487} = 0.315 g \]

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Faraday's law states that mass deposited is directly proportional to charge passed.

Step 1: Understanding the reaction pathway

- NBS, h\(\nu\): Bromination of propane at the allylic position.

- NaCN, DMSO: Cyanide substitution forming nitrile.

- H\(_3\)O\(^+\): Hydrolysis to carboxylic acid.

- SOCl\(_2\): Conversion to acid chloride.

- NH\(_3\): Formation of butylamine.


Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: NBS selectively brominates allylic positions under radical conditions.

Step 1: Use the formula for degree of dissociation \[ \alpha = \frac{dissociated moles}{initial moles} \]

Step 2: Calculation \[ \alpha = \frac{0.04}{0.1} = 0.4 \]

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Degree of dissociation measures how much reactant converts into products at equilibrium.

Step 1: Identify reaction steps

- Step 1: The hydroxyl (-OH) group undergoes bromination using PbBr\(_3\) to form a bromide intermediate (A).

- Step 2: Treatment with alcoholic KOH leads to elimination, forming an alkene (B).


Step 2: Analyze product formation
- The correct structures match option (1), where A is a brominated compound, and B is an alkene.


Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Alcohols react with PbBr\(_3\) to form alkyl bromides, which undergo elimination in the presence of strong bases like alc. KOH.

Step 1: Use Arrhenius equation in logarithmic form \[ \log \left( \frac{k_2}{k_1} \right) = \frac{E_a}{2.303 R} \left( \frac{T_2 - T_1}{T_1 T_2} \right) \]

Step 2: Substituting values \[ 0.6021 = \frac{E_a}{2.303 \times 8.314} \left( \frac{30}{(273+27)(273+57)} \right) \]

Solving for \( E_a \), \[ E_a = 38.0 kJ/mol \]

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: The Arrhenius equation relates activation energy with reaction rate at different temperatures.

Step 1: Understanding homoleptic and heteroleptic complexes

- Homoleptic complex: Contains only one type of ligand.

- Heteroleptic complex: Contains more than one type of ligand.


Step 2: Analyze given complexes
- \([Co(NH_3)_6]^{3+}\) contains only NH\(_3\), so it is homoleptic (Statement 1 is true).

- \([Co(NH_3)_4Cl_2]^+\) contains NH\(_3\) and Cl\(^-\), so it is heteroleptic (Statement 2 should be true, but incorrectly stated).


Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Homoleptic complexes have one ligand type, while heteroleptic complexes have multiple ligand types.

Step 1: Understanding reaction mechanism

- MCPBA (meta-chloroperoxybenzoic acid) is used for epoxidation of alkenes.


Step 2: Identify major product
- The alkene undergoes epoxidation to form an oxirane ring at the double bond.

- The correct structure matches option (4).


Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: MCPBA selectively forms epoxides from alkenes via peroxyacid oxidation.

Step 1: Convert mass percentages into moles \[ Moles of A = \frac{32}{64} = 0.5, \quad Moles of B = \frac{20}{40} = 0.5, \quad Moles of C = \frac{48}{32} = 1.5 \]

Step 2: Normalize mole ratio
Dividing by the smallest value (0.5): \[ A : B : C = 1 : 2 : 1 \]

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: To find empirical formula, divide mass percentages by atomic masses and normalize mole ratios.

Understanding restriction enzymes

- Hind II is a restriction endonuclease that cuts DNA at specific sequences.

- The recognition sequence for Hind II is exactly 6 base pairs long.


Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Restriction enzymes recognize specific palindromic sequences to cut DNA at precise locations.

Step 1: Understanding plant tissues

- Parenchyma is a living tissue that plays a role in storage, photosynthesis, and healing.

- Collenchyma is also a living tissue and provides mechanical support, so Statement I is incorrect.


Step 2: Gymnosperms vs Angiosperms

- Gymnosperms do have tracheids but lack xylem vessels, which are a characteristic of angiosperms.


Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Parenchyma and collenchyma are both living tissues, whereas sclerenchyma is dead.

Step 1: Understanding Bt Toxin

- The cry IAc gene in Bacillus thuringiensis produces a protein that targets specific insect groups.

- Statement I is correct as the toxin is group-specific.


Step 2: Activation of Bt toxin

- The protoxin is activated in alkaline pH, not acidic conditions.

- Statement II is false due to this incorrect explanation.


Conclusion: The correct option is \( \mathbf{(2) \). Quick Tip: Bt toxins become active in an insect’s alkaline gut, leading to cell lysis and death.

Step 1: Understanding Mendel's Law of Dominance

- Mendel's Law of Dominance states that one allele is dominant over another, leading to its expression in F\(_1\) generation.


Step 2: Analyzing statements

- A, C, D, and E relate to Mendelian principles of dominance and inheritance.

- B also applies because both alleles segregate in the F\(_2\) generation.


Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Mendel's laws explain how traits are inherited through dominant and recessive alleles.

Step 1: Understanding cell wall thickening

- Components with thin outer walls and thickened inner walls are typically xylem vessels or tracheids, which provide structural support.

- Component C exhibits this characteristic.


Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Xylem vessels have secondary thickening to support water conduction and mechanical strength.

Identify the organization responsible for endangered species list

- The International Union for Conservation of Nature (IUCN) publishes the Red List, classifying species based on extinction risk.


Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: IUCN Red List categorizes species based on their conservation status, from Least Concern to Extinct.

Understanding lactose metabolism in bacteria

- Lactose permease (lacY gene product) is responsible for transporting lactose into bacterial cells.

- Beta-galactosidase (lacZ gene product) hydrolyzes lactose into glucose and galactose.


Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Permease allows lactose to enter bacterial cells, while beta-galactosidase breaks it down for metabolism.

Step 1: Identifying fungal classification criteria

- Fungi are classified based on:

- Mode of spore formation

- Morphology of mycelium

- Reproductive structures


Step 2: Fruiting bodies are not a primary classification criterion

- The fruiting body is a visible reproductive structure, but fungal classification is based on other features.


Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Fungal classification is based on reproduction, spore formation, and mycelium structure, not fruiting bodies.

Understanding enzyme inhibition

- Malonate structurally resembles succinate and competes for the active site of Succinic dehydrogenase, blocking its function.

- This is an example of competitive inhibition.


Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Competitive inhibitors bind to the enzyme’s active site, preventing substrate binding without altering enzyme structure.

Step 1: Matching the components to their functions

- Nucleolus is the site for active ribosomal RNA synthesis.

- Centriole has organization like the cartwheel.

- Leucoplasts are for storing nutrients.

- Golgi apparatus is the site of formation of glycolipid.


Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Each cell organelle has a unique function, such as protein synthesis, storage, or transport.

Identifying the causes of biodiversity loss

- Over-exploitation depletes natural populations.

- Co-extinction occurs when one species' extinction affects others.

- Mutation is generally not a direct cause of biodiversity loss.

- Habitat loss and fragmentation reduce available living space.


Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Biodiversity loss is primarily due to habitat destruction, over-exploitation, pollution, and climate change.

Understanding meiotic stages

- Leptotene stage: Chromosomes begin condensing but are not clearly visible.

- Diplotene stage: Chiasmata formation occurs, but the synaptonemal complex does not dissolve completely.


Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Meiosis involves prophase I sub-stages: leptotene, zygotene, pachytene, diplotene, and diakinesis.

Understanding Dedifferentiation

- Dedifferentiation is the process where mature cells regain their ability to divide and form meristematic tissue.

- Interfascicular cambium forms from fully developed parenchyma cells, making this an example of dedifferentiation.


Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Dedifferentiation allows mature cells to regain meristematic activity and contribute to secondary growth.

Analyzing species richness in tropical regions

- Higher species richness is due to stable climate, long evolutionary history, and more available resources.

- A, C, D, and E contribute to high biodiversity, but B is incorrect as tropical environments are less seasonal.


Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Stable environments and high solar energy availability contribute to the high biodiversity in tropical regions.

Understanding spindle fiber attachment

- During prophase, chromatin condenses into visible chromosomes.

- Spindle fibers begin attaching to the kinetochores on chromosomes.


Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Spindle fibers attach to kinetochores in prophase and align chromosomes at the metaphase plate in metaphase.

Matching the terms with their definitions

- Allele: Alternative forms of a gene.

- Back cross: Cross of F1 progeny with homozygous recessive parent.

- Test cross: Cross of F1 progeny with any of the parents.

- Ploidy: Number of chromosome sets in a plant.


Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Genetic crosses help determine inheritance patterns, including dominance, segregation, and recombination.

Identifying Lecithin

- Lecithin is a naturally occurring substance found in plant and animal tissues.

- It is classified under carbohydrates due to its role in biological membranes.


Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Lecithin is commonly used as an emulsifier in food and plays a role in lipid metabolism.

Understanding logistic growth

- The logistic growth equation models population growth with environmental limits.

- K represents population density, regulating population size due to resource constraints.


Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Logistic growth considers environmental resistance, unlike exponential growth which assumes unlimited resources.

Matching microbes with their products

- Clostridium butylicum produces butyric acid.

- Saccharomyces cerevisiae is involved in ethanol production.

- Trichoderma polysporum produces streptokinase.

- Streptococcus sp. produces Cyclosporin-A.


Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Microorganisms play a vital role in industrial production of antibiotics, enzymes, and biofuels.

Understanding plant cell potential

- Differentiation refers to cell specialization where an unspecialized cell becomes a functional plant tissue.

- This process enables entire plants to develop from single cells under appropriate conditions.


Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Plant cells retain developmental plasticity, allowing regeneration and tissue culture propagation.

Understanding pollination in aquatic plants

- Vallisneria pollination occurs via water, but its flowers are not colourful and do not produce nectar.

- Water lily is not pollinated by water, confirming Statement B is correct.

- Hydrophilous plants have protective mechanisms for pollen, validating Statement C.

- Long, ribbon-like pollen grains aid in floating, confirming Statement D.


Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Aquatic plants have specialized adaptations for pollination, including water-resistant pollen and specific structures.

Understanding the Calvin cycle energy requirements

- The Calvin cycle requires 3 ATP and 2 NADPH per CO\(_2\) molecule fixed.

- ATP provides energy, while NADPH provides reducing power for carbon fixation.


Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: The Calvin cycle operates in three phases: carboxylation, reduction, and regeneration, requiring ATP and NADPH.

Understanding enzyme cofactors

- Carboxypeptidase is a metalloenzyme that requires a cofactor for activity.

- Niacin (Vitamin B3) serves as a coenzyme in oxidation-reduction reactions.


Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Cofactors assist enzymes in catalysis, including vitamins (coenzymes) and metal ions.

Understanding conservation methods

- Ex-situ conservation refers to protecting species outside their natural habitat (e.g., botanical gardens, zoos).

- In-situ conservation protects species within their natural habitat (e.g., national parks).


Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Ex-situ conservation methods include gene banks, zoos, and botanical gardens for protecting endangered species.

Understanding transcription unit structure

- A transcription unit consists of three key regions:

- Promoter: Initiates transcription.

- Structural gene: Encodes the functional RNA/protein.

- Terminator: Signals the end of transcription.


Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: The transcription process is regulated by specific sequences like promoters, operators, and terminators.

Understanding foreign DNA integration

- DNA introduced into an alien organism may:

- Replicate independently if it has an origin of replication.

- Integrate into the host genome under specific conditions.


Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Gene transfer techniques, like recombinant DNA technology, allow foreign genes to be expressed in host organisms.

Understanding seed germination

- During seed germination:

- Radicle (C) develops into the root.

- Plumule develops into the shoot.


Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: The radicle is the first part of the seedling to emerge and grow into the primary root.

Understanding actinomorphic vs. zygomorphic flowers

- Actinomorphic flowers are radially symmetrical, meaning they can be divided into two equal halves in any plane.

- Datura is a well-known example of an actinomorphic flower.


Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Actinomorphic flowers exhibit radial symmetry, while zygomorphic flowers have bilateral symmetry.

Understanding the role of auxin in selective weed control

- Auxins like 2,4-D selectively kill dicots (weeds) while not harming monocots (grasses).

- Auxin enhances cell division in grasses, promoting growth rather than destruction.


Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Selective herbicides like 2,4-D are auxin analogs that kill dicots but allow monocots to grow.

Identifying fungal classifications

- Rhizopus is known as bread mould.

- Ustilago is a smut fungus that affects crops.

- Puccinia causes rust diseases in plants.

- Agaricus includes edible mushrooms.


Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Fungi are classified based on their reproductive structures and modes of infection.

Understanding incomplete dominance in Snapdragon

- Snapdragon exhibits incomplete dominance.

- Crossing a red (RR) and pink (Rr) flowered plant results in:

- \( 50% \) Pink (Rr)

- \( 50% \) Red (RR)


Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Incomplete dominance results in a blended phenotype rather than strict Mendelian dominance.

Understanding flower symmetry types

- Perigynous flowers have floral parts attached around the ovary (not superior or inferior).

- Both (a) and (b) are perigynous, indicating an intermediate floral arrangement.


Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Floral structures help in plant identification and reproductive adaptations.

Understanding the requirements for the Calvin Cycle

- The dark reaction (Calvin cycle) does not require light but depends on:

- CO\(_2\) for carbon fixation.

- ATP and NADPH produced during the light reaction.

- Chlorophyll is indirectly involved as it captures light in the earlier phase.


Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: The Calvin cycle occurs in the stroma of chloroplasts, using ATP and NADPH from the light reaction to fix carbon.

Understanding a test cross

- A test cross is used to determine the genotype of an organism displaying a dominant phenotype.

- The organism with black seeds (BB or Bb) is crossed with a homozygous recessive (bb) to check for segregation.

- If all offspring are black (BB case), the plant is homozygous dominant.

- If both black and white seeds appear, the plant is heterozygous (Bb).


Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: A test cross helps determine whether a dominant trait is homozygous or heterozygous by crossing with a recessive genotype.

Understanding bulliform cell function

- Bulliform cells are large, specialized epidermal cells in monocots (like grasses).


- During water stress, these cells lose turgidity, causing leaf curling to reduce transpiration.


Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Bulliform cells in monocots help in water conservation by reducing leaf surface exposure during drought.

Step 1: Analyzing Statement I
- In C\(_3\) plants, RuBisCO exhibits dual affinity for both O\(_2\) and CO\(_2\).
- Binding to O\(_2\) decreases CO\(_2\) fixation, a phenomenon known as photorespiration.


Step 2: Analyzing Statement II
- In C\(_4\) plants, photorespiration is minimized due to the spatial separation of carbon fixation in mesophyll and bundle sheath cells.

- However, mesophyll cells do not exhibit significant photorespiration either.


Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: C\(_4\) plants use PEP carboxylase to fix CO\(_2\) initially, reducing photorespiration and increasing efficiency.

Understanding the traits of water pollinated flowers

- Water pollinated flowers often have pollen grains with mucilaginous coverings to protect them from wetting.

- Stamens are well-adapted for water transport.


Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Water-pollinated plants like Vallisneria have specific adaptations to ensure successful reproduction in aquatic environments.

Matching plants with their characteristics

- Rose has a perigynous flower.

- Pea exhibits marginal placentation.

- Cotton has twisted aestivation in its petals.

- Mango is a drupe fruit.


Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Understanding floral structures and placentation types helps in identifying plant families and species.

Understanding chloroplast DNA

- Chloroplast DNA is typically circular and double stranded, resembling bacterial DNA.

- However, certain unique cases exhibit linear, single stranded DNA, which can be seen in specific plant types.


Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Chloroplast DNA is inherited maternally and encodes genes essential for photosynthesis and other chloroplast functions.

Understanding DNA replication in E. coli

- DNA replication in E. coli is catalyzed by DNA-dependent DNA polymerase, which adds nucleotides in the 5' → 3' direction.

- RNA polymerase also follows the 5' → 3' direction, ensuring correct transcription.


Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: DNA polymerase requires a primer to initiate replication and works only in the 5' → 3' direction.

Understanding somatic hybridization

- Somatic hybridization involves the fusion of protoplasts from two different plant varieties.

- These protoplasts are then cultured to regenerate into hybrid plants with traits from both parents.


Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Somatic hybridization is used for crop improvement by combining desirable traits from two plants.

Analyzing steps in the TCA cycle

- The step Isocitrate → α-ketoglutaric acid involves oxidation and the reduction of NAD to NADH.

- Succinyl-CoA → Succinic acid does not involve substrate oxidation; instead, it generates GTP via substrate-level phosphorylation.


Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: The TCA cycle is essential for energy production, producing NADH and FADH\(_2\) for oxidative phosphorylation.

Matching terms with their functions

- GLUT-4: Enables glucose transport into cells.

- Insulin: A hormone regulating blood sugar levels.

- Trypsin: An enzyme involved in protein digestion.

- Collagen: An intercellular ground substance providing structural support.


Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Membrane proteins like GLUT-4 play a crucial role in nutrient transport and cellular communication.

Understanding the role of gibberellins in plant growth

- Gibberellins stimulate stem elongation, promoting cell division and elongation.

- Spraying sugarcane with gibberellins increases stem length and enhances yield.


Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Gibberellins are used in agriculture to promote growth, delay senescence, and improve crop yield.

Matching scientists with their discoveries

- Frederick Griffith: Discovered transformation in bacteria.

- Francois Jacob: Proposed the lac operon model for gene regulation.

- Har Gobind Khorana: Contributed to understanding the genetic code.

- Meselson and Stahl: Demonstrated the semi-conservative replication of DNA.


Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Understanding historical experiments helps clarify the mechanisms of genetic inheritance and regulation.

Matching individuals with their contributions

- Robert May estimated global species diversity at around 7 million.

- Alexander von Humboldt is known for the species-area relationship.

- Paul Ehrlich proposed the Rivet popper hypothesis.

- David Tilman conducted long-term ecosystem experiments using outdoor plots.


Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Ecosystem studies help understand biodiversity and its role in ecosystem functioning and stability.

Identifying characteristics of Phaeophyceae

- Members of Phaeophyceae (brown algae) exhibit:

- Asexual reproduction through biflagellate zoospores.

- Stored carbohydrates as mannitol or laminarin.

- Vegetative cells covered with a gelatinous coating of algin.

- Major pigments include chlorophyll a, c, carotenoids, and xanthophylls.

Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Phaeophyceae are predominantly marine algae known for their ecological and commercial importance.

Identifying locations of metabolic pathways

- Citric acid cycle occurs in the mitochondrial matrix.

- Glycolysis occurs in the cytoplasm.
- Electron transport system occurs along the inner mitochondrial membrane.

- Proton gradient forms in the intermembrane space of mitochondria.


Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: The electron transport system utilizes a proton gradient to drive ATP synthesis via oxidative phosphorylation.

Understanding energy flow in an ecosystem

- Energy transfer between trophic levels is highly inefficient, typically around 10 percent.

- If the NPP of the first trophic level is \( 100x \), the GPP at the third trophic level would be \( \frac{x}{10} \).


Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Only about 10 percent of the energy is transferred between trophic levels, with most energy lost as heat.

Understanding types of stamens and examples

- Monoadelphous: Stamens are united into one bundle, seen in China-rose (Hibiscus).

- Diadelphous: Stamens are arranged in two bundles, characteristic of Pea.

- Polyadelphous: Stamens are united into multiple bundles, as seen in Citrus.

- Epiphyllous: Stamens are attached to the petals (perianth), observed in Lily.


Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: The arrangement of stamens provides key identification traits for plant species and families.

Understanding joint types and examples

- Fibrous joints: Found in the skull, do not allow movement.

- Cartilaginous joints: Found between adjacent vertebrae, allowing limited movement.

- Hinge joints: Found in the knee, enabling forward and backward movement.

- Ball and socket joints: Found in the shoulder (humerus and pectoral girdle) allowing rotational movement.


Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Different types of joints provide varying degrees of movement and are adapted to specific functions.

Step 1: Matching diseases and their causes/tests
- Common cold: Caused by Rhinoviruses.
- Haemozoin: A by-product of Plasmodium metabolism during malaria.
- Widal test: Used for diagnosing Typhoid.
- Allergy: Triggered by Dust mites or other allergens.

Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Understanding disease causative agents helps in effective diagnosis and treatment strategies.

Step 1: Matching genetic disorders and chromosomes
- Down’s syndrome: Trisomy of the 21st chromosome.
- α-Thalassemia: Related to mutations in the 16th chromosome.
- β-Thalassemia: Related to mutations in the 11th chromosome.
- Klinefelter’s syndrome: Presence of an extra X chromosome.

Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Chromosomal mutations lead to various genetic disorders, which can be identified through karyotyping and genetic analysis.

Step 1: Understanding FSH and its role
- FSH stimulates ovarian follicles in females but acts on Sertoli cells, not Leydig cells, in males.
- Estrogen is secreted by growing follicles, while Leydig cells produce androgens.

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Hormones like FSH and LH play critical roles in reproductive processes in both males and females.

Step 1: Understanding the Ti plasmid
- The Ti plasmid in Agrobacterium tumefaciens enables the bacterium to transfer genes into plants, causing tumors (crown gall disease).

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: The Ti plasmid is a key tool in genetic engineering for transferring desired genes into plants.

Step 1: Analyze the properties of nephron components
- Descending limb of the loop of Henle: Permeable to water and impermeable to electrolytes.
- Proximal convoluted tubule: Lined with simple cuboidal epithelium, not columnar.

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: The loop of Henle plays a critical role in concentrating urine by reabsorbing water in the descending limb and ions in the ascending limb.

Step 1: Understanding the sub-phases of prophase I
- Diakinesis: Terminalisation of chiasmata occurs.
- Pachytene: Recombination nodules appear.
- Zygotene: Synaptonemal complex forms.
- Leptotene: Chromosomes appear as thin threads.

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: The sub-phases of prophase I are key to genetic diversity through recombination and chromosome pairing.

Step 1: Understanding contraceptive methods and their examples
- Non-medicated IUD: Example - Lippes loop.
- Copper releasing IUD: Example - Multiload 375.
- Hormone releasing IUD: Example - LNG-20.
- Implants: Contain Progestogens.

Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Intrauterine devices (IUDs) are highly effective long-term contraceptive methods with varying mechanisms of action.

Step 1: Identifying the nature of the hormones
- Testosterone, Progesterone, and Cortisol are steroid hormones derived from cholesterol.
- Glucagon is a peptide hormone, not a steroid.

Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Steroid hormones are lipid-soluble and derived from cholesterol, while peptide hormones are water-soluble.

Step 1: Understand the sequence of evolution
- Homo habilis: The earliest member of the genus Homo.
- Homo erectus: An intermediate species known for upright posture and tool use.
- Homo neanderthalensis: Close relative of modern humans, adapted to cold climates.
- Homo sapiens: Modern humans, representing the most advanced stage of evolution.

Conclusion: The correct sequence is \( \mathbf{A-D-C-B} \). Quick Tip: Human evolution is marked by a gradual increase in brain size, bipedalism, and tool usage.

Step 1: Matching enzymes to their specific bond action
- Lipase: Breaks down ester bonds in fats.
- Nuclease: Hydrolyzes phosphodiester bonds in nucleic acids.
- Protease: Breaks peptide bonds in proteins.
- Amylase: Hydrolyzes glycosidic bonds in carbohydrates.

Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Enzymes are highly specific to the type of bond they act upon, enabling precise biochemical reactions.

Step 1: Analyze the statements
- Statement I: True; hymen integrity is not a definitive indicator of virginity as it can be torn during physical activities.
- Statement II: False; the hymen can be ruptured by non-sexual activities such as sports.

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Virginity cannot be determined through hymen examination; cultural myths should not dictate scientific understanding.

Step 1: Matching applications and examples
- \(\alpha\)–I antitrypsin: Used in treating emphysema.
- Cry IAb: Active against corn borer.
- Cry IAc: Effective against cotton bollworm.
- Enzyme replacement therapy: Used for ADA deficiency.

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Biotechnological advancements like Bt toxins and enzyme replacement therapy have revolutionized medicine and agriculture.

Step 1: Understanding muscle types and their locations
- Skeletal muscle: Found in voluntary muscles like triceps and biceps.
- Smooth muscle: Found in involuntary structures like the stomach.
- Cardiac muscle: Found only in the heart.

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Muscles are classified based on their control (voluntary or involuntary) and structure (striated or smooth).

Step 1: Match diseases to their causative agents
- Typhoid: Caused by bacteria (Salmonella typhi).
- Leishmaniasis: Caused by protozoa (Leishmania species).
- Ringworm: Caused by fungus (dermatophytes).
- Filariasis: Caused by nematodes (Wuchereria bancrofti).

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Identify diseases by their causative agents: bacteria, protozoa, fungi, or nematodes.

Step 1: Match structures to their corresponding locations
- Axoneme: Found in cilia and flagella.
- Cartwheel pattern: Observed in centriole structure.
- Crista: Folds in the mitochondria.
- Satellite: Present on specific regions of chromosomes.

Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Organelles and their specific structures play distinct roles in cellular functions.

Step 1: Understand the anatomy of cockroach segments.
The anal cerci are jointed filamentous appendages located on the 11th abdominal segment of both male and female cockroaches.

Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: The anal cerci in cockroaches are sensory organs used for detecting vibrations and changes in the environment.

Step 1: Match the examples to the respective groups.
- Pleurobrachia belongs to Ctenophora.
- Radula is a structure found in Mollusca.
- Stomochord is a characteristic of Hemichordata.
- Air bladder is present in Osteichthyes for buoyancy.

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Matching biological structures and organisms with their respective groups helps in better understanding taxonomy.

Step 1: Understand the conduction pathway.
- SA node generates the impulse.
- Impulse travels to the AV node, then to the AV bundle.
- From the AV bundle, the signal propagates to the Bundle branches and then to the Purkinje fibres.

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: The heart’s conduction system ensures a coordinated contraction for effective pumping of blood.

Step 1: Understand convergent evolution.
- Penguins and dolphins have evolved similar flipper structures for swimming, despite being from different evolutionary lineages.
- This represents convergent evolution, where organisms evolve similar traits due to similar environmental pressures.

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Convergent evolution leads to analogous structures, while divergent evolution leads to homologous structures.

Step 1: Transcription process
- The RNA sequence is complementary to the DNA template.
- RNA polymerase synthesizes RNA in the 5’ to 3’ direction using the DNA strand.

Conclusion: The correct RNA transcript is \( \mathbf{5’AUGUACCGUUUAUAGGUAAGU3’} \). Quick Tip: Transcription involves synthesis of RNA from DNA, where thymine (T) is replaced with uracil (U).

Step 1: Analyze the statement and the explanation provided.
- Breast-feeding provides essential nutrition and strengthens immunity.
- Colostrum contains immunoglobulins, but in this context, the explanation doesn't align directly with the assertion.

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Breastfeeding is critical for infant immunity due to the presence of colostrum rich in antibodies.

Step 1: Understand the conditions for oxyhaemoglobin formation.
- High \( pO_2 \) in alveoli promotes oxygen binding to haemoglobin.
- Low \( H^+ \) concentration (alkaline pH) and low \( pCO_2 \) favour oxyhaemoglobin formation.

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Oxyhaemoglobin forms in the lungs where \( pO_2 \) is high, \( pCO_2 \) is low, and the environment is alkaline.

Step 1: Verify the coelom types in the groups mentioned.
- Annelids are true coelomates.
- Poriferans are neither coelomates nor pseudocoelomates.
- Aschelminthes (nematodes) are pseudocoelomates, not acoelomates.
- Platyhelminthes are acoelomates, not pseudocoelomates.

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Know the coelom types: coelomates, pseudocoelomates, and acoelomates for different animal phyla.

Step 1: Understand the sequence of cell division stages.
- Gap 1 phase (G1): Initial growth phase.
- Synthesis phase (S): DNA replication occurs.
- Gap 2 phase (G2): Preparation for mitosis.
- Karyokinesis: Division of nucleus.
- Cytokinesis: Division of cytoplasm.

Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Cell division includes interphase (G1, S, G2) followed by mitotic phase (karyokinesis and cytokinesis).

Step 1: Analyze the role of bio-reactors.
- Bio-reactors are used for large-scale production, not small-scale cultures.
- They include features like agitators, oxygen delivery, and foam control systems.

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Bio-reactors are specialized vessels for large-scale microbial or cell culture processes.

Step 1: Match each brain part to its specific function.
- Pons: Connects different regions of the brain.
- Hypothalamus: Contains neurosecretory cells.
- Medulla: Regulates respiration and gastric secretions.
- Cerebellum: Helps in posture and balance.

Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Know the functions of brain regions like the cerebellum, pons, and hypothalamus for clarity in matching questions.

Step 1: Identify natural contraceptive methods.
- Natural methods: Periodic abstinence, lactational amenorrhea, and coitus interruptus.
- Vaults: Artificial contraceptive devices.

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Differentiate between natural and artificial contraceptive methods for clarity in solving such questions.

Step 1: Evaluate factors affecting Hardy-Weinberg equilibrium.
- Genetic drift, gene migration, and recombination disrupt equilibrium.
- A constant gene pool does not affect the equilibrium.

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: The Hardy-Weinberg equilibrium assumes no mutations, no selection, random mating, and constant gene pool.

Step 1: Match the fish to its type.
- Pterophyllum: Angel fish.
- Myxine: Hag fish.
- Pristis: Saw fish.
- Exocoetus: Flying fish.

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Memorize the examples of different types of fishes for easier matching in taxonomy.

Step 1: Understand the structure of the Fallopian tube.
- Components: Infundibulum, ampulla, isthmus, and fimbriae.
- Uterine fundus is part of the uterus, not the Fallopian tube.

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: The Fallopian tube connects the ovary to the uterus and has distinct parts: infundibulum, ampulla, and isthmus.

Step 1: Identify the sources of each drug.
- Cocaine is derived from Erythroxylum.
- Heroin is derived from Papaver somniferum (opium poppy).
- Morphine acts as an effective sedative in surgery.
- Marijuana is derived from Cannabis sativa.

Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Learn the botanical sources and effects of commonly abused substances for matching questions.

Step 1: Understand the function of genes in pBR322.
- Gene X: Involved in replication of plasmid DNA.
- Gene Y: Responsible for providing resistance to antibiotics, aiding in selection.

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Understand the structure and functional genes of vectors like pBR322 for recombinant DNA technology.

Step 1: Identify the autoimmune disorders from the list.
- A (Myasthenia gravis): Autoimmune disorder affecting muscles.
- B (Rheumatoid arthritis): Autoimmune disorder causing joint inflammation.
- E (Systemic Lupus Erythematosus): Autoimmune disorder affecting multiple organs.

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Autoimmune disorders involve the immune system attacking the body’s own tissues. Learn examples for NEET.

Step 1: Match each respiratory parameter with its correct formula.
- Expiratory capacity: Tidal volume + Expiratory reserve volume.
- Functional residual capacity: Expiratory reserve volume + Residual volume.
- Vital capacity: Sum of tidal volume, expiratory reserve volume, and inspiratory reserve volume.
- Inspiratory capacity: Tidal volume + Inspiratory reserve volume.

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Understand key respiratory volumes and capacities along with their formulas for matching questions.

Step 1: Analyze the components of ECG.
- P wave: Represents depolarisation of atria.
- QRS complex: Represents depolarisation of ventricles.
- T wave: Represents repolarisation of ventricles.
- T-P gap: Indicates electrical silence of heart muscles.

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Learn the components of ECG and their physiological implications for matching questions.

Step 1: Analyze the statements.
- Statement I: The corpus callosum is the nerve tract connecting cerebral hemispheres—correct.
- Statement II: The brainstem includes the medulla oblongata, pons, and midbrain—not the cerebrum—incorrect.

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: The brainstem excludes the cerebrum; learn the components carefully.

Step 1: Analyze the structure and membranes of organelles.
- Statement I: Both mitochondria and chloroplasts are double membrane-bound—correct.
- Statement II: The inner membrane of mitochondria is more permeable than that of chloroplast—incorrect.

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Focus on the structural differences between mitochondria and chloroplasts for conceptual clarity.

Step 1: Identify the hormones and cell types involved in spermatogenesis.
- ICSH: Acts on Leydig cells.
- Leydig cells: Produce testosterone.
- Sertoli cells: Provide nourishment during spermatogenesis.
- Spermiogenesis: Transformation of spermatids to spermatozoa.

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Understand hormonal regulation and cellular roles in spermatogenesis for accuracy.

Step 1: Analyze the roles of bone marrow and thymus.
- Statement I: Bone marrow produces all blood cells, including lymphocytes—correct.
- Statement II: Bone marrow and thymus provide microenvironments for T-lymphocyte maturation—correct.

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Bone marrow and thymus are key lymphoid organs; know their roles in immunity.

Step 1: Analyze the genotypes of the parents.
For the child to have the \( O^+ \) blood group (\( ii \)), both parents must carry at least one \( i \) allele. Possible genotypes for the parents include \( I^Bi \) and \( I^Ai \).

Step 2: Eliminate incorrect options based on genotypes.
- Option B includes \( I^BI^B, I^AI^A, \) which are not valid for the \( O^+ \) child.
- Options D and E correctly represent \( I^Ai \) and \( I^Bi \), which can produce \( ii \).

Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: When solving ABO blood group inheritance problems, remember that \( O \) blood group requires two \( i \) alleles (homozygous recessive).

Step 1: Analyze Gause's principle.
The principle states that two species competing for the same resources cannot coexist indefinitely—this invalidates the statements as written.

Conclusion: The correct option is \( \mathbf{(1)} \). Quick Tip: Gause's principle applies only to species competing for the same resources in a limiting environment.

Step 1: Match the correct eras with their characteristics.
- Mesozoic Era is known for birds and reptiles.
- Proterozoic Era had lower invertebrates.
- Cenozoic Era marked the dominance of mammals.
- Paleozoic Era saw fish and amphibians.

Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Remember the major life forms associated with geological eras for matching questions.

Step 1: Match the components to their functions.
- RNA polymerase III synthesizes SnRNAs and tRNAs.
- Termination of transcription often involves the Rho factor.
- Splicing of exons is facilitated by snRNPs.
- TATA box serves as a promoter region in transcription.

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Understand the roles of transcription machinery for matching questions.

Step 1: Understand the enzyme action sequence.
The correct order of events in the catalytic cycle is:
1. Substrate binds to the active site of the enzyme (E).
2. Substrate-enzyme complex is formed (A).
3. Chemical bonds of the substrate are broken (D).
4. Products are released from the enzyme (C).
5. Free enzyme is ready for another substrate (B).

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: The enzyme catalytic cycle always begins with substrate binding and ends with the release of products.

Step 1: Match the epithelial types with their characteristics.
- Unicellular glandular epithelium corresponds to goblet cells (A-III).
- Compound epithelium is found on moist surfaces like the buccal cavity (B-IV).
- Multicellular glandular epithelium includes salivary glands (C-I).
- Endocrine glandular epithelium is seen in the pancreas (D-II).

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Epithelial tissues are classified based on their structure and function, aiding in identification.

Step 1: Match the disorders to their characteristics.
- Exophthalmic goiter is characterized by hyperthyroidism and protruding eyeballs (A-III).
- Acromegaly results from excessive growth hormone secretion (B-IV).
- Cushing’s syndrome is caused by excessive cortisol secretion (C-I).
- Cretinism occurs due to hypothyroidism, leading to stunted growth (D-II).

Conclusion: The correct option is \( \mathbf{(3)} \). Quick Tip: Recognize hormonal disorders by their distinct symptoms and related glands.

Step 1: Analyze the structural features of juxta medullary nephrons.
- The Loop of Henle in juxta medullary nephrons extends deep into the renal medulla, facilitating concentrated urine formation.
- Renal corpuscles are located in the renal cortex, not the medulla.
- Juxta medullary nephrons are fewer in number compared to cortical nephrons.

Conclusion: The correct option is \( \mathbf{(2)} \). Quick Tip: Juxta medullary nephrons play a crucial role in water conservation by creating a concentrated urine.

Step 1: Understand the digestive structures of a cockroach.
- Food is stored in the crop (A-IV).
- Gastric caeca are 6-8 blind tubules found at the junction of the foregut and midgut (B-II).
- Malpighian tubules are excretory structures at the midgut-hindgut junction (C-III).
- Food is ground in the gizzard (D-I).

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: In cockroach anatomy, the crop stores food, while the gizzard grinds it for digestion.

Analyze the characteristics of non-chordates.

- Non-chordates lack a notochord and have a ventral central nervous system.

- Pharyngeal gill slits and a dorsal central nervous system are found in chordates, not non-chordates.

- Therefore, A (Pharynx perforated by gill slits) and C (Dorsal central nervous system) are characteristic of chordates.

Conclusion: The correct option is \( \mathbf{(4)} \). Quick Tip: Differentiate chordates and non-chordates based on their key anatomical features, such as the presence of a notochord and CNS orientation.