Step 1: Understanding Lenz’s Law


Lenz’s law states that the induced current opposes the change in flux. When a magnet moves towards a solenoid, an induced current is generated to oppose the approaching magnetic field.


Step 2: Determining Current in Solenoid-1


- The North pole of the magnet is moving away from solenoid-1.

- To oppose this, solenoid-1 induces a current that tries to retain the North pole near it.

- This means the left end of solenoid-1 should act as a North pole, implying current flows from A to B (AB).


Step 3: Determining Current in Solenoid-2


- The North pole of the magnet is approaching solenoid-2.

- To oppose this, solenoid-2 induces a current that tries to repel the North pole.

- This means the left end of solenoid-2 should act as a North pole, implying current flows from D to C (DC).



% Conclusion
Thus, the correct answer is (B) AB and DC. Quick Tip: According to Lenz’s Law, an induced current will always flow in a direction that opposes the change in magnetic flux causing it.

Step 1: Effect of Alpha Decay (\( \alpha \))

Alpha decay reduces:
- Mass number by 4.
- Atomic number by 2.
\[ ^{290}_{82}X \xrightarrow{\alpha} ^{286}_{80}Y \]

Step 2: Effect of Positron Emission (\( e^+ \))

Positron emission decreases the atomic number by 1:
\[ ^{286}_{80}Y \xrightarrow{e^+} ^{286}_{79}Z \]

Step 3: Effect of Beta Minus Decay (\( \beta^- \))

Beta minus decay increases the atomic number by 1:
\[ ^{286}_{79}Z \xrightarrow{\beta^-} ^{286}_{80}P \]

Step 4: Effect of Electron Capture (\( e^- \))

Electron capture decreases the atomic number by 1:
\[ ^{286}_{80}P \xrightarrow{e^-} ^{286}_{81}Q \]


% Conclusion
Thus, the correct answer is (A) \( 286, 81 \). Quick Tip: - Alpha decay: \( A \to A-4, Z \to Z-2 \)
- Positron emission: \( Z \to Z-1 \)
- Beta decay: \( Z \to Z+1 \)
- Electron capture: \( Z \to Z-1 \)

Step 1: Understanding the Vernier Constant

The Vernier constant (VC) is given by: \[ VC = Least Count = Value of 1 Main Scale Division - Value of 1 Vernier Scale Division \]

Since:

- \( 1 \) Main Scale Division (MSD) \( = 0.1 \) mm \( = 0.01 \) cm.

- \( N \) MSDs match with \( (N+1) \) Vernier Scale Divisions.


Thus, the value of one Vernier scale division is:

\[ \frac{N \times 0.01}{N+1} cm \]


Step 2: Calculating Vernier Constant

\[ VC = 0.01 - \frac{N \times 0.01}{N+1} \]

Factorizing:

\[ VC = \frac{0.01(N+1) - 0.01N}{N+1} \]
\[ VC = \frac{0.01}{N+1} \]

Since \( 0.01 = \frac{1}{100} \), we get:

\[ VC = \frac{1}{100(N+1)} \]


% Conclusion
Thus, the correct answer is (C) \( \frac{1}{100(N+1)} \). Quick Tip: The Vernier constant (VC) is calculated as: \[ VC = Value of 1 MSD - Value of 1 Vernier Scale Division \] Use this formula to derive the least count for any vernier caliper.

Step 1: Understanding Potential in a Spherical Shell

For a thin conducting spherical shell, the potential at any point inside and on the surface is the same and is given by:
\[ V = \frac{1}{4\pi\varepsilon_0} \frac{q}{R} \]

Step 2: Finding the Potential Difference

Since both \( C \) and \( P \) are inside or on the surface, the potential at both points is equal. Thus:
\[ V_C = V_P \]

The potential difference is:
\[ V_C - V_P = 0 \]


% Conclusion
Thus, the correct answer is (A) Zero. Quick Tip: For a charged spherical shell, the potential inside the shell is constant and equal to the potential at the surface. So, potential difference inside the shell is always zero.

Step 1: Understanding Transformer Voltage Ratio

The voltage ratio in an ideal transformer is given by:
\[ \frac{V_S}{V_P} = \frac{N_S}{N_P} \]

Given \( \frac{N_P}{N_S} = \frac{1}{2} \), we take the reciprocal:
\[ \frac{N_S}{N_P} = 2 \]

Step 2: Calculating Voltage Ratio
\[ V_S : V_P = 2:1 \]


% Conclusion
Thus, the correct answer is (C) \( 2:1 \). Quick Tip: For an ideal transformer, the voltage ratio is: \[ \frac{V_S}{V_P} = \frac{N_S}{N_P} \] where \( N_P \) and \( N_S \) are the number of turns in the primary and secondary coils.

Step 1: Identifying the Logic Gates Used

The given circuit consists of:
- A NAND gate receiving inputs \( A \) and \( B \).
- A NOT gate inverting the output of the NAND gate.
- The final gate is an OR gate, which processes the inverted NAND output and an additional input.

Step 2: Deriving the Boolean Expression

1. The NAND gate outputs:

\[ NAND output = \overline{A \cdot B} \]

2. The NOT gate inverts this output:

\[ NOT output = A \cdot B \]

3. The OR gate takes this as one input and another signal. However, analyzing the circuit, it simplifies to:

\[ Y = A \cdot B \]


% Conclusion
Thus, the given circuit functions as an AND gate, making the correct answer (A) AND gate. Quick Tip: To analyze logic gate circuits, break them into individual gates, write their Boolean expressions, and simplify step by step.

Step 1: Moment of Inertia of a Rod

The moment of inertia of a thin rod about its midpoint is:
\[ I = \frac{1}{12} M L^2 \]

Given \( I = 2400 \) cm² and mass \( M = 400 \) g = \( 0.4 \) kg.

Step 2: Solving for \( L \)
\[ 2400 = \frac{400}{12} \times L^2 \]
\[ L^2 = \frac{2400 \times 12}{400} \]
\[ L^2 = 72 \]
\[ L = \sqrt{72} \approx 8.5 cm \]


% Conclusion
Thus, the correct answer is (B) 8.5 cm. Quick Tip: For a thin rod, moment of inertia about its midpoint is given by: \[ I = \frac{1}{12} M L^2 \] where \( M \) is mass and \( L \) is length.

Step 1: Understanding the Effect of White Light


In Young’s double-slit experiment, if white light is used instead of monochromatic light, all wavelengths interfere simultaneously.


Step 2: Central Fringe Characteristics


- The central fringe remains white because all wavelengths constructively interfere at the center.

- The fringes away from the center become coloured, as different wavelengths have different fringe positions due to varying interference conditions.


Step 3: Evaluating Given Options


- Option A is incorrect because fringe width varies for different wavelengths.

- Option B is incorrect because interference still occurs.

- Option C is incorrect because the central fringe is bright white, not dark.



% Conclusion
Thus, the correct answer is (D) There will be a central bright white fringe surrounded by a few coloured fringes. Quick Tip: In Young’s double-slit experiment, when white light is used: - The central fringe is white due to constructive interference. - The side fringes are coloured because different wavelengths interfere at different positions.

Step 1: Understanding the Dimensions of Solid Angle

Solid angle (\(\Omega\)) is a dimensionless quantity, meaning its dimensions are: \[ [\Omega] = M^0L^0T^0 \]

Step 2: Checking the Given Quantities


- Strain: Defined as the ratio of two similar physical quantities (change in length/original length). It is dimensionless.

- Angle: Defined as the arc length to radius ratio, which is also dimensionless.

- Stress: Defined as force per unit area. It has dimensions \([ML^{-1}T^{-2}]\) and is not dimensionless.

- Arc: Has dimensions of length and is not dimensionless.


% Conclusion
Thus, the correct answer is (B) strain and angle. Quick Tip: Any dimensionless quantity (like strain and angle) has the same dimensions as solid angle (\(\Omega\)).

Step 1: Understanding Magnetic Oscillations

The time period \(T\) of a magnetic needle oscillating in a uniform magnetic field is given by:
\[ T = 2\pi \sqrt{\frac{I}{MB}} \]

where:
- \( I \) is the moment of inertia,
- \( M \) is the magnetic moment,
- \( B \) is the magnetic field.

Step 2: Finding the Magnetic Moment

Given that the needle completes 20 oscillations in 5 seconds:
\[ T = \frac{5}{20} = 0.25 sec \]

Squaring both sides:
\[ T^2 = 4\pi^2 \frac{I}{MB} \]

Rearrange for \( M \):
\[ M = \frac{4\pi^2 I}{B T^2} \]

Substituting values:
\[ M = \frac{4\pi^2 (9.8 \times 10^{-6})}{(0.049)(0.25^2)} \]

Simplifying:
\[ M = 1280\pi^2 \times 10^{-5} \, Am^2 \]

Thus, \( x = 1280\pi^2 \). Quick Tip: For magnetic oscillation problems, remember the equation \( T = 2\pi \sqrt{\frac{I}{MB}} \) and rearrange it to solve for the required quantity.

Step 1: Applying Momentum Conservation

In a completely inelastic collision, both bodies stick together after the collision. The momentum before and after the collision must be equal:
\[ m v_1 + m(0) = (m + m) v_2 \]

Step 2: Solving for \( v_2 \)
\[ m v_1 = 2m v_2 \]
\[ v_2 = \frac{v_1}{2} \]

Step 3: Finding the Ratio
\[ v_1 : v_2 = 2:1 \]


% Conclusion
Thus, the correct answer is (C) \( 2:1 \). Quick Tip: For a completely inelastic collision, the final velocity is given by: \[ v_2 = \frac{m_1 v_1 + m_2 v_2}{m_1 + m_2} \] where \( m_1 = m_2 \), simplifies to \( v_2 = \frac{v_1}{2} \).

Step 1: Find the Acceleration of the System

The total mass of the system is:
\[ M_{total} = m_A + m_B = 2 + 3 = 5 kg \]

Using Newton’s Second Law:
\[ a = \frac{F}{M_{total}} = \frac{10}{5} = 2 m/s^2 \]

Step 2: Force Exerted by Block \( A \) on Block \( B \)

Since block \( B \) moves with acceleration \( a \), the force exerted on \( B \) is:
\[ F_B = m_B a = 3 \times 2 = 6 N \]


% Conclusion
Thus, the correct answer is (D) \( 6 \) N. Quick Tip: For a system of blocks, find the total acceleration first and then use \( F = ma \) to determine the internal forces.

Step 1: Identifying the Logic Expression from the Truth Table

From the given truth table:


- When \( B = 0 \), \( Y = 1 \).

- When \( B = 1 \), \( Y = 0 \).


This directly matches the NOT gate output:
\[ Y = \overline{B} \]


% Conclusion
Thus, the correct answer is (D) \( \overline{B} \). Quick Tip: For Boolean expression derivation, analyze the truth table row-wise and identify patterns that match basic logic gates.

Step 1: Tension in Circular Motion

The tension in the string provides the required centripetal force:
\[ T = m\omega^2 r \]

Step 2: Effect of Doubling Speed

If the speed is increased to \( 2\omega \), the new tension becomes:
\[ T' = m(2\omega)^2 r \]
\[ T' = 4 m\omega^2 r = 4T \]


% Conclusion
Thus, the correct answer is (C) \( 4T \). Quick Tip: Tension in circular motion is proportional to \( \omega^2 \), so when speed doubles, the tension becomes four times.

Step 1: Formula for Acceleration Due to Gravity

The acceleration due to gravity on a planet is given by:
\[ g = \frac{GM}{R^2} \]

where:
- \( M \) is the planet’s mass,
- \( R \) is the planet’s radius,
- \( G \) is the gravitational constant.

Step 2: Expressing Planet’s Mass and Radius in Terms of Earth’s Values

- Given that the mass of the planet is \( \frac{1}{10} \)th that of Earth:

\[ M' = \frac{M}{10} \]

- The diameter is half that of Earth, so the radius is:

\[ R' = \frac{R}{2} \]

Step 3: Finding Gravity on the New Planet

Since \( g' \) is proportional to \( \frac{M}{R^2} \), we substitute the new values:
\[ g' = \frac{G \times (M/10)}{(R/2)^2} \]
\[ g' = \frac{(GM/10)}{R^2/4} \]
\[ g' = \frac{GM}{R^2} \times \frac{4}{10} \]
\[ g' = g \times \frac{4}{10} \]
\[ g' = 9.8 \times 0.4 = 3.92 m/s^2 \]


% Conclusion
Thus, the correct answer is (A) 3.92 m/s\(^2\). Quick Tip: The acceleration due to gravity is proportional to \( \frac{M}{R^2} \). If the mass changes to \( \frac{M}{10} \) and the radius changes to \( \frac{R}{2} \), then: \[ g' = g \times \frac{4}{10} = 3.92 m/s^2. \]

Step 1: Analyzing Statement I

Atoms contain equal numbers of protons (positive charge) and electrons (negative charge), making them electrically neutral.

Thus, Statement I is correct.

Step 2: Analyzing Statement II

Atoms of each element emit characteristic spectra, but not all atoms are stable. Many elements contain radioactive isotopes, which are unstable and decay over time.

Thus, Statement II is incorrect.


% Conclusion
Thus, the correct answer is (D) Statement I is correct but Statement II is incorrect. Quick Tip: - Neutral atoms contain equal numbers of protons and electrons. - Not all atoms are stable; some elements have radioactive isotopes that undergo decay.

Step 1: Using Young’s Modulus Formula

The elongation \( \Delta L \) in a wire under stress is given by:
\[ \Delta L = \frac{\sigma L}{Y} \]

where:
- \( \sigma \) = Stress = \( 8 \times 10^8 \) N/m\(^2\),
- \( L = 1 \) m,
- \( Y = 2 \times 10^{11} \) N/m\(^2\).

Step 2: Substituting Values
\[ \Delta L = \frac{(8 \times 10^8) \times 1}{2 \times 10^{11}} \]
\[ \Delta L = \frac{8 \times 10^8}{2 \times 10^{11}} \]
\[ \Delta L = 4 \times 10^{-3} m = 4 mm \]


% Conclusion
Thus, the correct answer is (B) \( 4 \) mm. Quick Tip: To find elongation in a wire under stress, use: \[ \Delta L = \frac{\sigma L}{Y} \] where \( \sigma \) is stress, \( L \) is length, and \( Y \) is Young’s modulus.

Step 1: Understanding Terminal Voltage

The terminal voltage (\( V \)) of a battery is given by:
\[ V = E - I r \]

where:
- \( E = 10 \) V (emf of the battery),
- \( r = 1 \Omega \) (internal resistance),
- \( R = 4 \Omega \) (external resistance).

Step 2: Finding the Current

Using Ohm's law, the current in the circuit is:
\[ I = \frac{E}{R + r} = \frac{10}{4 + 1} = \frac{10}{5} = 2 A \]

Step 3: Calculating Terminal Voltage
\[ V = 10 - (2 \times 1) \]
\[ V = 10 - 2 = 8 V \]


% Conclusion
Thus, the correct answer is (D) 8 V. Quick Tip: For a battery with internal resistance, terminal voltage is given by: \[ V = E - I r \] Always consider the total resistance in the circuit when calculating the current.

Step 1: Work Done in an Isobaric Process

The work done by the gas in a thermodynamic process is given by:
\[ W = P \Delta V \]

where:
- \( P \) is pressure,
- \( \Delta V \) is the change in volume.

Step 2: Identifying Path \( bc \)

From the given PV diagram, the path \( bc \) is a horizontal line, meaning:
\[ P = constant \]

Since volume remains constant along \( bc \), we have:
\[ \Delta V = 0 \]

Step 3: Calculating Work Done

Since work done depends on volume change:
\[ W = P \times 0 = 0 \]


% Conclusion
Thus, the correct answer is (B) Zero. Quick Tip: For an isochoric process (constant volume), no work is done because: \[ W = P \Delta V = 0 \]

Step 1: Understanding I-V Characteristics of a Solar Cell

The I-V characteristics of a solar cell lie in the IV quadrant, because a solar cell acts as a power generator, supplying power to an external circuit.

Step 2: Reverse Bias in a \( pn \) Junction Diode

In a reverse biased \( pn \) junction diode, the current is due to minority charge carriers, not majority carriers. The reverse current is very small (in microamperes) and remains almost constant.


% Conclusion
Thus, the correct answer is option (B). Quick Tip: - The solar cell operates in the IV quadrant because it supplies power. - In a reverse biased diode, current flows due to minority carriers, not majority carriers.

Step 1: Understanding Magnetic Susceptibility


Magnetic susceptibility (\(\chi\)) determines a material's response to an external magnetic field:

- Diamagnetic materials have negative susceptibility (\(0 > \chi \geq -1\)).

- Ferromagnetic materials have very high susceptibility (\(\chi \gg 1\)).

- Paramagnetic materials have small positive susceptibility (\(0 < \chi < \varepsilon\)).

- Non-magnetic materials have \(\chi = 0\).



% Conclusion
Thus, the correct matching is:
\[ \begin{aligned} A &\to II
B &\to III
C &\to IV
D &\to I \end{aligned} \] Quick Tip: Diamagnetic substances are repelled by a magnetic field, paramagnetic substances are weakly attracted, and ferromagnetic substances retain magnetization even after the external field is removed.

Step 1: Understanding Hydrogen Spectral Lines


The spectral lines of hydrogen correspond to electron transitions between energy levels. The Balmer series involves transitions to \( n_1 = 2 \) from higher energy levels (\( n_2 = 3, 4, 5, 6, \) etc.).


Step 2: Identifying Wavelengths


From standard hydrogen spectral data:


- \( n_2 = 3 \to n_1 = 2 \) corresponds to \( \lambda = 656.3 \) nm.

- \( n_2 = 4 \to n_1 = 2 \) corresponds to \( \lambda = 486.1 \) nm.

- \( n_2 = 5 \to n_1 = 2 \) corresponds to \( \lambda = 434.1 \) nm.

- \( n_2 = 6 \to n_1 = 2 \) corresponds to \( \lambda = 410.2 \) nm.



% Conclusion
Thus, the correct matching is:
\[ \begin{aligned} A &\to III \quad (656.3 nm)
B &\to IV \quad (486.1 nm)
C &\to II \quad (434.1 nm)
D &\to I \quad (410.2 nm) \end{aligned} \] Quick Tip: The Balmer series of the hydrogen spectrum consists of transitions to \( n_1 = 2 \). The longest wavelength (red) corresponds to \( n_2 = 3 \), while the shortest wavelength (violet) corresponds to \( n_2 = 6 \).

Step 1: Finding Velocity

Given displacement:
\[ x = 2t - 1 \]

Velocity is the derivative of displacement:
\[ v = \frac{dx}{dt} = 2 \]

Step 2: Instantaneous Power Formula

Instantaneous power is given by:
\[ P = F \cdot v \]

Substituting given values:
\[ P = 5 \times 2 = 10 W \]


% Conclusion
Thus, the correct answer is (B) 10 W. Quick Tip: The formula for instantaneous power is: \[ P = F \cdot v \] where \( F \) is force and \( v \) is instantaneous velocity.

Step 1: Identify Series and Parallel Combinations

- The two \( 2 \,\mu F \) capacitors in series give:
\[ C_{series} = \frac{2 \times 2}{2 + 2} = 1 \,\mu F \]

- The resulting \( 1 \,\mu F \) capacitor is in parallel with another \( 2 \,\mu F \), so:
\[ C_{parallel} = 1 + 1 = 2 \,\mu F \]


% Conclusion
Thus, the correct answer is (B) \( 2 \,\mu F \). Quick Tip: For series capacitors: \[ \frac{1}{C_{eq}} = \frac{1}{C_1} + \frac{1}{C_2} \] For parallel capacitors: \[ C_{eq} = C_1 + C_2 \]

Step 1: Resistance of Each Part

The total resistance of the wire is 100 \(\Omega\). Since it is divided into 10 equal parts, each part has a resistance:
\[ R_{part} = \frac{100}{10} = 10 \Omega \]

Step 2: First 5 Parts in Series
\[ R_{series} = 10 + 10 + 10 + 10 + 10 = 50 \Omega \]

Step 3: Next 5 Parts in Parallel
\[ \frac{1}{R_{parallel}} = \frac{1}{10} + \frac{1}{10} + \frac{1}{10} + \frac{1}{10} + \frac{1}{10} = \frac{5}{10} = \frac{1}{2} \]
\[ R_{parallel} = 2 \Omega \]

Step 4: Final Combination in Series
\[ R_{final} = R_{series} + R_{parallel} = 50 + 2 = 52 \Omega \]


% Conclusion
Thus, the correct answer is (C) \( 52 \Omega \). Quick Tip: For series connection, total resistance is the sum of individual resistances: \( R_{eq} = R_1 + R_2 + \dots \) For parallel connection, use the formula: \( \frac{1}{R_{eq}} = \frac{1}{R_1} + \frac{1}{R_2} + \dots \)

Step 1: Formula for Potential at an Axial Point

The correct formula for the potential due to an electric dipole at an axial point is:
\[ V = \frac{KpCos \theta}{r^2} \]

at axis (\theta = 0^\circ \text{ or 180^\circ)


Substituting:
\[ V = \pm \left( 9 \times 10^9 \right) \times \frac{4 \times 10^{-6}{(2)^2} \]
\[ V = \pm 9 \times 10^9 \times \frac{4 \times 10^{-6}}{4} \]
\[ V = \pm 9 \times 10^9 \times 10^{-6} \]
\[ V = \pm 9 \times 10^3 \]
\[ V = \pm 9 \times 10^3 V \]

Since the assertion matches this value, A is true.

Step 2: Checking the Given Reason R

The provided reason states:
\[ V = \frac{2P}{4\pi\varepsilon_0 r^2} \]

which is incorrect because the correct expression is:
\[ V = \frac{1}{4\pi\varepsilon_0} \frac{2P}{r^2} \]


% Conclusion
Thus, the correct answer is (D) A is true but R is false. Quick Tip: For a dipole, the potential at an axial point is: \[ V = \frac{1}{4\pi\varepsilon_0} \frac{2P}{r^2} \] and at an equatorial point, it is zero.

Step 1: Evaluating the Given Statements

- Statement A (Energy of a photon):
The energy of a photon is given by Planck's equation:

\[ E = h\nu \]

Correct

- Statement B (Velocity of a photon):
In vacuum, photons always travel at the speed of light:

\[ v = c \]

Correct

- Statement C (Momentum of a photon):
The momentum of a photon is given by:

\[ p = \frac{E}{c} = \frac{h\nu}{c} \]

Correct

- Statement D (Photon-electron collision conservation laws):
In Compton scattering and photoelectric effect, both energy and momentum are conserved.

Correct

- Statement E (Photon has charge):
Photons are neutral and have zero charge.

Incorrect


% Conclusion
Thus, the correct answer is (C) A, B, C and D only. Quick Tip: - A photon has energy (\( E = h\nu \)), momentum (\( p = h\nu/c \)), and always travels at speed \( c \) in vacuum. - Photons are neutral (have no charge). - In photon-electron interactions, both energy and momentum are conserved.

Step 1: Formula for Magnetic Field at the Centre of a Circular Coil

The magnetic field at the centre of a circular coil with \( N \) turns is given by:
\[ B = \frac{\mu_0 N I}{2R} \]

where:
- \( \mu_0 = 4\pi \times 10^{-7} \) Tm/A (permeability of free space),
- \( N = 100 \) turns,
- \( I = 7 \) A,
- \( R = 10 \) cm = \( 0.1 \) m.

Step 2: Substituting Values
\[ B = \frac{(4\pi \times 10^{-7}) \times 100 \times 7}{2 \times 0.1} \]
\[ B = \frac{(4\pi \times 10^{-7} \times 700)}{0.2} \]
\[ B = \frac{8.8 \times 10^{-4}}{0.2} \]
\[ B = 4.4 \times 10^{-3} T = 4.4 mT \]


% Conclusion
Thus, the correct answer is (D) \( 4.4 \) mT. Quick Tip: For a circular coil, the magnetic field at the centre is given by: \[ B = \frac{\mu_0 N I}{2R} \] where \( N \) is the number of turns and \( R \) is the radius of the coil.

Step 1: Surface Tension and Excess Force Formula

The excess force required to detach a thin circular disc from the surface of water is given by:
\[ F = T \times 2\pi R \]

where:

- \( T = 0.07 \) N/m (surface tension),

- \( R = 4.5 \) cm \( = \frac{4.5}{100} \) m.


Step 2: Substituting Values
\[ F = \frac{7}{100} \times 2 \times 3.14 \times \frac{4.5}{100} \]
\[ F = \frac{7 \times 2 \times 3.14 \times 4.5}{100 \times 100} \]
\[ F = \frac{197.82}{10000} \]
\[ F = 19.8 \times 10^{-3} N \]
\[ F = 19.8 mN \]


% Conclusion
Thus, the correct answer is (B) 19.8 mN. Quick Tip: For problems involving surface tension, use: \[ F = T \times 2\pi R \] where \( T \) is the surface tension and \( R \) is the radius of contact.

Step 1: Understanding Brewster's Angle

When unpolarised light strikes a surface at Brewster's angle, the reflected light becomes completely polarised, whereas the refracted light remains partially polarised.

Step 2: Brewster’s Law

Brewster’s angle (\(\theta_B\)) is given by:
\[ \tan \theta_B = \frac{n_2}{n_1} \]

where \( n_1 \) and \( n_2 \) are the refractive indices of the two media.


% Conclusion
Thus, the correct answer is option (A). Quick Tip: Brewster’s law states that reflected light at Brewster’s angle is completely polarised in a plane perpendicular to the incident light.

Step 1: Understanding de Broglie Wavelength

The de Broglie wavelength is given by:
\[ \lambda = \frac{h}{p} \]

Since kinetic energy \( E \) is related to momentum \( p \) by:
\[ p = \sqrt{2mE} \]

Substituting this in the de Broglie equation:
\[ \lambda = \frac{h}{\sqrt{2mE}} \]

Squaring both sides:
\[ \frac{1}{\lambda^2} \propto E \]


% Conclusion
Thus, the correct graph is (A), a straight line showing direct proportionality. Quick Tip: For a free particle, \( \frac{1}{\lambda^2} \) is directly proportional to kinetic energy \( E \), giving a linear relationship.

Step 1: Understanding Rolling Motion

In pure rolling motion, a wheel moves forward without slipping. The velocity of a point on the wheel depends on:
\[ v_{point} = v_{cm} + v_{rotation} \]

where \( v_{cm} \) is the center of mass velocity, and \( v_{rotation} \) is the rotational velocity.

Step 2: Velocity at Different Points

- Lowest point (\( Q \)):
Since it is in contact with the ground, its velocity is:

\[ v_Q = v_{cm} - v_{rotation} = 0 \]

- Highest point (\( P \)):
The speed here is double the center of mass velocity:

\[ v_P = v_{cm} + v_{rotation} = 2v \]


% Conclusion
Thus, the correct answer is (C) Point \( P \) moves faster than point \( Q \). Quick Tip: For rolling motion:
- The lowest point has zero velocity (relative to ground).
- The highest point has twice the velocity of the center of mass.

Step 1: Identifying Amplitude

The general equation of SHM is:
\[ x = A \sin(\omega t + \phi) \]

Comparing with:
\[ x = 5 \sin \left( \pi t + \frac{\pi}{3} \right) \]

we see that amplitude \( A = 5 \) m.

Step 2: Finding the Time Period

The angular frequency \( \omega \) is:
\[ \omega = \pi rad/s \]

Time period \( T \) is given by:
\[ T = \frac{2\pi}{\omega} = \frac{2\pi}{\pi} = 2 s \]


% Conclusion
Thus, the correct answer is (C) \( 5 \) m, \( 2 \) s. Quick Tip: For SHM, use: \[ T = \frac{2\pi}{\omega} \] where \( \omega \) is the angular frequency.

Understanding Circular Motion


- A particle moving in a circular path at uniform speed has a constant magnitude of velocity, but the direction of velocity keeps changing.

- Since velocity is a vector, changing direction means the velocity is not constant.

- The acceleration also changes because the centripetal acceleration depends on velocity direction.



% Conclusion
Thus, the correct answer is option (A) Varying velocity and varying acceleration. Quick Tip: In uniform circular motion, speed remains constant, but velocity and acceleration keep changing due to the continuous change in direction.

Step 1: Defining the Angles

From the prism geometry, we have:
\[ r_1 + c = A \]

Since \( A = 90^\circ \), this gives:
\[ r_1 = 90^\circ - c \]

Step 2: Applying Snell’s Law at Point \( P \)

Using Snell's law at the first surface:
\[ n_1 \sin i = n_2 \sin r_1 \]

For air (\( n_1 = 1 \)) and prism (\( n_2 = \mu \)):
\[ \sin 30^\circ = \mu \sin r_1 \]
\[ \frac{1}{2} = \mu \sin (90^\circ - c) \]

Since \( \sin (90^\circ - c) = \cos c \), we substitute:
\[ \frac{1}{2} = \mu \times \frac{\sqrt{\mu^2 - 1}}{\mu} \]


Step 3: Solving for \( \mu \)

Rearrange:
\[ \frac{1}{2} = \sqrt{\mu^2 - 1} \]

Squaring both sides:
\[ \frac{1}{4} = \mu^2 - 1 \]
\[ \mu^2 = \frac{5}{4} \]
\[ \mu = \frac{\sqrt{5}}{2} \]


% Conclusion
Thus, the correct answer is option (C) \( \frac{\sqrt{5}}{2} \). Quick Tip: For light traveling through a prism, use Snell’s law at the point of incidence and check for total internal reflection conditions if needed.

Step 1: Energy Required to Launch a Satellite

The energy required is given by:
\[ E = U_{initial} - U_{final} \]

where the initial potential energy at Earth's surface is:
\[ U_i = - \frac{GmM}{R} \]

and the final potential energy at altitude \( 2R \) (i.e., total radius \( 6R \)) is:
\[ U_f = - \frac{GmM}{6R} \]

Step 2: Finding Total Energy Needed
\[ E = \frac{1}{2} m v^2 + (U_f - U_i) \]

\[ E = \frac{GmM}{R} - \frac{GmM}{6R} \]
\[ E = \frac{5GmM}{6R} \]


% Conclusion
Thus, the correct answer is (B) \( \frac{5GmM}{6R} \). Quick Tip: The total energy for launching a satellite depends on gravitational potential energy and orbital velocity energy.

- Electromagnetic waves are generated by accelerating charges, not by charges moving uniformly.

- They are transverse waves.

- Their energy densities are equal.



% Conclusion
Thus, the correct answer is (A) They originate from charges moving with uniform speed. Quick Tip: Electromagnetic waves originate from accelerating charges, not from uniform motion.

To check if a term is dimensionless, we verify its units.

- Force unit: \( [F] = MLT^{-2} \).
- Since \( F = \alpha t + \beta t \), both terms must have the same dimension.

Step 2: Finding the Dimensionless Ratio
\[ \frac{\alpha t}{\beta} \]

has no dimensions, making it the correct answer.


% Conclusion
Thus, the correct answer is (C) \( \frac{\alpha t}{\beta} \). Quick Tip: For a term to be dimensionless, the numerator and denominator must have identical units.

Step 1: Time Period of a Simple Pendulum

The time period of a simple pendulum is given by:
\[ T = 2\pi \sqrt{\frac{L}{g}} \]

where:
- \( L \) is the length of the pendulum,
- \( g \) is acceleration due to gravity.

Step 2: Effect of Changing Mass and Length

- The time period is independent of mass.
- Given that the length is halved:

\[ L' = \frac{L}{2} \]

\[ T' = 2\pi \sqrt{\frac{L'}{g}} = 2\pi \sqrt{\frac{L/2}{g}} \]

\[ T' = 2\pi \times \frac{1}{\sqrt{2}} \sqrt{\frac{L}{g}} \]

\[ T' = \frac{T}{\sqrt{2}} \]

Step 3: Finding \( x \)

Since the new time period is given as:
\[ T' = \frac{x}{2} T \]

Comparing:
\[ \frac{x}{2} = \frac{1}{\sqrt{2}} \]

Solving for \( x \):
\[ x = \sqrt{2} \]


% Conclusion
Thus, the correct answer is (C) \( \sqrt{2} \). Quick Tip: The time period of a simple pendulum is: \[ T = 2\pi \sqrt{\frac{L}{g}} \] - It is independent of mass.
- If the length is halved, the new time period is: \[ T' = \frac{T}{\sqrt{2}} \]

Step 1: Formula for Thermal Stress


The force developed due to thermal expansion when expansion is restricted is:

\[ F = Y A \alpha \Delta T \]

where:

- \( Y = 0.5 \times 10^{11} \) N/m\(^2\) (Young’s modulus),

- \( A = 10^{-3} \) m\(^2\) (cross-sectional area),

- \( \alpha = 10^{-5} \) °C\(^{-1}\) (coefficient of linear expansion),

- \( \Delta T = 100 \) °C.


Step 2: Substituting Values

\[ F = (0.5 \times 10^{11}) \times (10^{-3}) \times (10^{-5}) \times (100) \]
\[ F = 50 \times 10^3 N \]


% Conclusion
Thus, the correct answer is (C) \( 50 \times 10^3 \) N. Quick Tip: For thermal stress, use: \[ F = Y A \alpha \Delta T \] when expansion is restricted.

Step 1: Reactance of a Capacitor

The capacitive reactance is:
\[ X_C = \frac{1}{\omega C} = \frac{1}{2\pi f C} \]

where:
- \( f = 50 \) Hz,
- \( C = 10 \) \(\mu\)F = \( 10 \times 10^{-6} \) F,
- \( \pi = 3.14 \).

Step 2: Substituting Values
\[ X_C = \frac{1}{2 \times 3.14 \times 50 \times 10 \times 10^{-6}} \]
\[ X_C = \frac{1}{3.14 \times 10^{-2}} \]
\[ X_C \approx 3.18 \, \Omega \]

Step 3: Finding the RMS Current
\[ I_{rms} = \frac{V_{rms}}{X_C} = \frac{210}{3.18} \approx 66 A \]

Step 4: Finding Peak Current
\[ I_{peak} = I_{rms} \times \sqrt{2} \]
\[ I_{peak} = 0.66 \times 1.414 \]
\[ I_{peak} \approx 0.93 A \]


% Conclusion
Thus, the correct answer is (C) \( 0.93 \) A. Quick Tip: For a capacitor in AC circuits, the peak current is: \[ I_{peak} = \frac{V_{rms}}{X_C} \times \sqrt{2} \] where \( X_C = \frac{1}{2\pi f C} \).

Step 1: Formula for Magnifying Power of a Telescope

For a telescope focused at infinity, the magnifying power is given by:
\[ M = \frac{f_o}{f_e} \]

where:
- \( f_o = 140 \) cm (focal length of objective),
- \( f_e = 5.0 \) cm (focal length of eyepiece).

Step 2: Substituting Values
\[ M = \frac{140}{5} = 28 \]


% Conclusion
Thus, the correct answer is (C) 28. Quick Tip: For a telescope at infinity, use: \[ M = \frac{f_o}{f_e} \] where \( f_o \) is the objective focal length and \( f_e \) is the eyepiece focal length.

According to Charles’s Law:
\[ V \propto T \quad (for constant pressure) \]

Higher pressure curves are steeper.


% Conclusion
Thus, the correct answer is (A) \( P_1 > P_2 > P_3 \). Quick Tip: For an ideal gas, higher pressure means steeper \( T-V \) curves.

Step 1: Understanding the Effect of Bending on Magnetic Moment

Magnetic moment is a vector quantity, and when bent, its effective magnetic moment is given by:
\[ M' = M \cos \frac{\theta}{2} \]

where angle between the vectors would be \( \theta = 120^\circ \).

Step 2: Substituting Values
\[ M' = M \cos \frac{120^\circ}{2} = M \cos 60^\circ \]
\[ M' = M \times \frac{1}{2} = \frac{M}{2} \]


% Conclusion
Thus, the correct answer is (C) \( \frac{M}{2} \). Quick Tip: For a bent magnetic material, the new magnetic moment is: \[ M' = M \cos \frac{\theta}{2} \]

Step 1: Understanding Velocity-Time Graph

- The velocity graph shows uniform acceleration, followed by constant velocity, then uniform deceleration.

Step 2: Identifying the Correct Acceleration-Time Graph

- The acceleration graph should have positive acceleration, then zero acceleration, then negative acceleration, which matches Option 4.


% Conclusion
Thus, the correct answer is (D) Option 4. Quick Tip: The slope of a velocity-time graph gives the acceleration-time graph.

- Displacement current exists in the gap of a capacitor.

- Maxwell’s equation ensures \( I_{displacement} = I_{conduction} \).

- The displacement current flows in same direction.



% Conclusion
Thus, the correct answer is (C) Displacement current of magnitude equal to \( I \) flows in the same direction as \( I \). Quick Tip: Displacement current in a capacitor equals conduction current in the circuit.

- Magnetic sheets are attracted and held by strong poles.

- Conducting sheets experience eddy current forces, pushing them away.

- Non-magnetic, non-conducting sheets do not experience significant force.



% Conclusion
Thus, the correct answer is (C) A and C only. Quick Tip: Eddy currents cause repulsion in moving conductors near magnets.

Step 1: Power in Series and Parallel Connection

- For series connection, power is given by:

\[ P_{series} = \frac{V^2}{R_{eq}} \]

where \( R_{eq} = R_A + R_B \).

- For parallel connection, power is given by:

\[ P_{parallel} = \frac{V^2}{R_A} + \frac{V^2}{R_B} \]

Step 2: Finding Ratio of Powers

By solving,
\[ \frac{P_{series}}{P_{parallel}} = \frac{2}{9} \]


% Conclusion
Thus, the correct answer is (C) \( 2:9 \). Quick Tip: For resistances in series, the total resistance is: \[ R_{eq} = R_1 + R_2 \] For resistances in parallel, the power is maximized.

Step 1: Wheatstone Bridge Condition

For a bridge to be balanced, the condition:
\[ \frac{R_1}{R_2} = \frac{R_3}{R_4} \]

must hold.

Step 2: Analyzing the Given Circuits

By applying the Wheatstone bridge balance condition, circuit 2 satisfies the condition.


% Conclusion
Thus, the correct answer is (B) Circuit 2. Quick Tip: A balanced Wheatstone bridge satisfies: \[ \frac{R_1}{R_2} = \frac{R_3}{R_4} \]

Step 1: Understanding Capacitance in a Parallel Plate Capacitor


Capacitance is given by:

\[ C = \frac{\varepsilon_0 A}{d} \]

where \( d \) is the plate separation. If \( d \) decreases:
\[ C \uparrow (Capacitance Increases) \]

Step 2: Charge and Energy Effects


Since the capacitor is connected to a battery (constant voltage \( V \)):


- Charge \( Q = CV \) increases because \( C \) increases.

- Energy stored \( U = \frac{1}{2} C V^2 \) also increases.


Step 3: Evaluating Statements


- A (Charge increases) Correct

- B (Energy decreases) Incorrect (Energy increases)

- C (Capacitance increases) Correct

- D (Charge-to-voltage ratio remains the same) Incorrect

- E (Product of charge and voltage increases) Correct



% Conclusion
Thus, the correct answer is (C) A, C and E only. Quick Tip: For a capacitor connected to a battery, decreasing plate separation:
- Increases capacitance \( C \).
- Increases charge \( Q \).
- Increases stored energy.

Step 1: Expression for Equilibrium Constant
The reaction is: \[ 2A \rightleftharpoons B + C \]
The equilibrium constant expression is: \[ K_C = \frac{[B][C]}{[A]^2} \]

Step 2: Substituting Given Values \[ Q_C = \frac{(2 \times 10^{-3}) (2 \times 10^{-3})}{(2 \times 10^{-3})^2} = 1 \]

Step 3: Comparing \( Q_C \) and \( K_C \)
Since \( Q_C > K_C \), the reaction tends to shift backward to reach equilibrium.


Thus, the correct answer is (4). Quick Tip: If \( Q_C > K_C \), the reaction shifts backward. If \( Q_C < K_C \), it shifts forward.

Step 1: Understanding the Molecular Formula and Structural Requirements


- The molecular formula is ``C\(_6\)H\(_{14}\)", which corresponds to an alkane.

- The compound has ``two tertiary carbons", meaning two carbon atoms are connected to three other carbon atoms.


Step 2: Evaluating the Given Options

1. ``n-Hexane":
- It has no tertiary carbon. Incorrect.

2. ``2-Methylpentane":
- It has only one tertiary carbon. Incorrect.

3. ``2,2-Dimethylbutane":
- It has one tertiary carbon at position 2. Incorrect.

4. ``2,3-Dimethylbutane":
- It has ``two tertiary carbons" at positions 2 and 3. ``Correct Answer".


Conclusion:
The correct IUPAC name for the given molecular formula with two tertiary carbons is 2,3-dimethylbutane. Quick Tip: - Primary Carbon (1°): Attached to only one other carbon. - Secondary Carbon (2°): Attached to two other carbons. - Tertiary Carbon (3°): Attached to three other carbons. - Quaternary Carbon (4°): Attached to four other carbons.

- Boiling point depends on surface area and intermolecular forces.

- n-Pentane (linear) has a higher boiling point than isopentane and neopentane due to greater surface area.

- Increased branching (as in neopentane) results in lower boiling point due to a more spherical shape reducing van der Waals interactions.



Thus, the correct answer is (2). Quick Tip: More branching leads to lower boiling points due to decreased surface area and weaker intermolecular forces.

- The energy formula for hydrogen-like atoms is:

\[ E_n = -\frac{13.6Z^2}{n^2} eV \]
- For He\(^+\) (Z = 2, n = 1), energy is \(-x\) J.

- For Be\(^{3+}\) (Z = 4, n = 2), solving the equation gives \(-x\) J.


Thus, the correct answer is (2). Quick Tip: Energy of an electron in a hydrogen-like atom depends on \( Z^2 \) and \( \frac{1}{n^2} \).

- Oxygen (O), Selenium (Se), and Tellurium (Te) commonly exhibit the \(-2\) oxidation state in compounds.

- However, Polonium (Po) is more metallic and prefers oxidation states of \(+2\) and \(+4\) rather than \(-2\).


Thus, the correct answer is (1). Quick Tip: Elements with higher metallic character tend to avoid negative oxidation states.

Step 1: Understanding the types of isomerism

- Linkage isomerism occurs when a ligand can coordinate to the metal center through different atoms. In \([Co(NH_3)_5(NO_2)]Cl_2\), the NO\(_2\) ligand can bind through either nitrogen or oxygen. Hence, A-II.


- Ionization isomerism arises when exchangeable anions are involved. In \([Co(NH_3)_5(SO_4)]Br\), the sulfate and bromide ions can interchange, leading to ionization isomerism. Hence, B-III.


- Coordination isomerism occurs when there is an exchange of ligands between cationic and anionic complexes. In \([Co(NH_3)_6][Cr(CN)_6]\), the metal centers can switch ligands, leading to coordination isomerism. Hence, C-IV.


- Solvate isomerism (hydrate isomerism) involves the replacement of water molecules inside or outside the coordination sphere. In \([Co(H_2O)_6]Cl_3\), water molecules participate in solvate isomerism. Hence, D-I.

Thus, the correct matching is:


A-II, B-III, C-IV, D-I Quick Tip: - \textbf{Linkage isomerism:} Same ligand but different donor atom. - \textbf{Ionization isomerism:} Exchange of counter ions between coordination complexes. - \textbf{Coordination isomerism:} Ligands interchange between cationic and anionic complexes. - \textbf{Solvate isomerism:} Involves water molecules inside or outside the coordination sphere.

- Glucose is a reducing sugar with an aldehyde (-CHO) group and can undergo oxidation and addition reactions.

- Schiff’s reagent (B) does not react because glucose exists in cyclic hemiacetal form, preventing a direct test for aldehydes.

- Sodium bisulfite (\( NaHSO_3 \)) (E) does not form a stable addition compound with glucose, making it unreactive.

- However, glucose reacts with Tollen’s reagent, HCN, and hydroxylamine to form respective products.



Thus, the correct answer is (4). Quick Tip: Glucose reacts with Tollens' reagent and HCN but not with Schiff’s reagent or \( NaHSO_3 \).

Step 1: Analyzing Statement I

- Aniline \((C_6H_5NH_2)\) contains an amino group \((-NH_2)\), which is highly activating and strongly deactivates the benzene ring toward electrophilic substitution reactions.

- Due to this, aniline does not undergo Friedel-Crafts alkylation because the \(-NH_2\) group forms a complex with the Lewis acid catalyst (AlCl\(_3\)), preventing the reaction.

- Hence, Statement I is correct.


Step 2: Analyzing Statement II

- Gabriel synthesis is used to prepare primary amines but is ineffective for aryl amines like aniline.

- This is because the aryl group does not undergo nucleophilic substitution easily.

- Hence, aniline cannot be prepared via Gabriel synthesis, making Statement II also correct.


Thus, the correct answer is (2). Quick Tip: Aromatic amines like aniline do not undergo Gabriel synthesis and Friedel-Crafts alkylation due to their electronic effects.

Step 1: Understanding the Boiling Point Trend in Group 16 Hydrides

- Normally, the boiling point of hydrides increases down the group due to increasing molecular mass and stronger Van der Waals forces.
- However, H\(_2\)O has an anomalously high boiling point due to extensive hydrogen bonding, which makes it deviate from the expected trend.

Step 2: Verifying the Statements

- Statement I is correct as the boiling point order observed experimentally is:
\[ H_2O > H_2Te > H_2Se > H_2S \]
due to hydrogen bonding in water, while the rest follow the trend dictated by molecular mass and intermolecular forces.

- Statement II is also correct because water's boiling point should be lower based on molecular mass alone, but hydrogen bonding causes it to be significantly higher than expected.

Conclusion:
Both statements are true, so the correct answer is option (2). Quick Tip: - Boiling Point Trend in Group 16 Hydrides - Regular trend: Boiling point increases down the group due to increased molecular mass and stronger dispersion forces. - Anomalous behavior of H\(_2\)O: Due to hydrogen bonding, its boiling point is significantly higher than expected.

- Fehling’s solution consists of two parts:

- Solution A: Aqueous copper(II) sulfate.

- Solution B: Alkaline sodium potassium tartrate (Rochelle’s salt).


Thus, the correct answer is (2). Quick Tip: Fehling’s test detects reducing sugars by reducing Cu\(^{2+}\) to Cu\(_2\)O (red precipitate).

- Lucas reagent (ZnCl\(_2\)/HCl) distinguishes alcohols based on carbocation stability.

- Tertiary alcohols react instantly forming a cloudy solution due to stable tertiary carbocations.

- Primary alcohols react very slowly, while secondary alcohols take longer.


Thus, the correct answer is (1). Quick Tip: Tertiary alcohols react instantly with Lucas reagent, forming a turbidity due to stable carbocation formation.

Carbocations are stabilized by inductive effects, resonance, and hyperconjugation. The most stable carbocation is the one where the positive charge is most effectively delocalized.

In option (1), the carbocation is a simple methyl cation, but it is already the most stable because of its relatively smaller size and lack of steric strain. The methyl cation is stabilized by inductive effects but does not experience additional destabilizing factors such as hyperconjugation.

Options (2), (3), and (4) represent carbocations that are relatively less stable because the positive charge is not as well stabilized by resonance or hyperconjugation. As the number of alkyl groups attached increases, the stability of the carbocation increases slightly, but still, the methyl cation is the most stable overall.

Thus, the correct answer is option (1). Quick Tip: The stability of carbocations increases with the number of alkyl groups attached to the positively charged carbon, as these groups donate electron density via inductive and hyperconjugation effects.

Step 1: Determining the Shapes of Compounds

- NH\(_3\) (Ammonia): The central nitrogen has one lone pair and three bonded pairs, giving it a Trigonal Pyramidal geometry.

- Hence, A matches with (I).

- BrF\(_5\) (Bromine Pentafluoride): It has five bonded fluorine atoms and one lone pair, resulting in a Square Pyramidal shape.

- Hence, B matches with (IV).

- XeF\(_4\) (Xenon Tetrafluoride): Xenon forms four bonds with fluorine and has two lone pairs, leading to a Square Planar geometry.

- Hence, C matches with (II).

- SF\(_6\) (Sulfur Hexafluoride): Sulfur forms six bonds with fluorine and has no lone pairs, leading to an Octahedral shape.

- Hence, D matches with (III).



Thus, the correct answer is (2) A-I, B-IV, C-II, D-III. Quick Tip: Molecular geometry is determined by the number of bonded atoms and lone pairs on the central atom. Use VSEPR theory to predict shapes.

Step 1: Understanding Ionization Enthalpy

- Ionization enthalpy is the energy required to remove an electron from an atom in the gaseous state.

- It increases across a period due to increasing nuclear charge.

- It decreases down a group due to increasing atomic size and shielding effect.


Step 2: Comparing Ionization Enthalpies

- Lithium (Li) has the lowest ionization enthalpy because it is an alkali metal.

- Boron (B) has a lower ionization enthalpy than Beryllium (Be) because Be has a completely filled 2s orbital, making it more stable.

- Carbon (C) has a higher ionization enthalpy than B and Be due to increased nuclear charge.

- Nitrogen (N) has the highest ionization enthalpy due to its half-filled p-orbital stability.


Step 3: Arranging in Increasing Order
\[ Li < B < Be < C < N \]


Thus, the correct answer is (3). Quick Tip: Ionization enthalpy increases across a period due to increasing nuclear charge. Exceptions: Be \(>\) B (due to stable 2s orbital), N \(>\) O (due to stable half-filled 2p orbital).

- [Co(NH\(_3\))\(_6\)]\(^3+\): NH\(_3\) is a strong field ligand, causing low-spin, making it diamagnetic.

- [CoF\(_6\)]\(^3-\): F\(^-\) is a weak field ligand, causing high-spin, making it paramagnetic.


Thus, the correct answer is (2). Quick Tip: Strong field ligands form low-spin complexes (diamagnetic), while weak field ligands form high-spin complexes (paramagnetic).

Step 1: Writing the Reaction Equation

The neutralization reaction between sodium hydroxide (NaOH) and hydrochloric acid (HCl) is:
\[ NaOH + HCl \rightarrow NaCl + H_2O \]

Step 2: Calculating the Moles of NaOH Present

- Molar mass of NaOH = \(23 + 16 + 1 = 40\) g/mol.
- Given mass of NaOH = 1 g.
- Moles of NaOH:
\[ \frac{1}{40} = 0.025 moles. \]

Step 3: Calculating the Moles of HCl Present

- Volume of HCl solution = 25 mL = 0.025 L.
- Molarity of HCl solution = 0.75 M.
- Moles of HCl:
\[ 0.75 \times 0.025 = 0.01875 moles. \]

Step 4: Determining the Leftover NaOH

Since the reaction occurs in a 1:1 molar ratio, the amount of NaOH that reacts with 0.01875 moles of HCl is 0.01875 moles.

Remaining moles of NaOH:
\[ 0.025 - 0.01875 = 0.00625 moles. \]

Mass of remaining NaOH:
\[ 0.00625 \times 40 = 0.25 g = 250 mg. \]

Conclusion: The correct answer is:
\[ Option (3) \] Quick Tip: - Neutralization reactions follow a 1:1 molar ratio between strong acids and strong bases. - Always use molarity and volume to determine moles of acid/base before solving.

- Henry’s law states:

\[ C = \frac{P}{K_H} \]
where \( C \) is gas solubility, \( P \) is partial pressure, and \( K_H \) is Henry’s law constant.

- Lower \( K_H \) means higher solubility.

- \( K_H \) values: B (lowest) \(>\) C \(>\) A (highest), so solubility follows B \(>\) C \(>\) A.


Thus, the correct answer is (3). Quick Tip: Solubility of a gas is inversely proportional to Henry’s law constant (\( K_H \)).

- The reaction involves two steps:

1. Hydroboration-oxidation using \( BH_3 \) and \( H_2O_2/OH^- \) converts cyclohexene into cyclohexanol (anti-Markovnikov addition).

2. Oxidation of cyclohexanol using PCC (Pyridinium Chlorochromate) selectively converts it to cyclohexanal.

- PCC is preferred as it does not overoxidize the aldehyde to a carboxylic acid.

- Other methods like acidic hydration (options 1 \& 2) follow Markovnikov addition and would not yield the desired alcohol.

- KMnO\(_4\) (option 4) would further oxidize to a carboxylic acid, making it incorrect.



Thus, the correct answer is (3). Quick Tip: Hydroboration-oxidation follows anti-Markovnikov addition, and PCC selectively oxidizes alcohols to aldehydes.

Step 1: Understanding Magnetic Moment Formula

The spin-only magnetic moment (\(\mu_s\)) is given by:
\[ \mu_s = \sqrt{n(n+2)} \, BM \]

where \( n \) is the number of unpaired electrons.


Step 2: Determining Unpaired Electrons

- Ti\(^{3+}\) (Z = 22, electronic configuration: [Ar] 3d\(^1\))
- Number of unpaired electrons: ``1"
- \(\mu_s = \sqrt{1(1+2)} = \sqrt{3} \, BM\)


- Cr\(^{2+}\) (Z = 24, electronic configuration: [Ar] 3d\(^4\))
- Number of unpaired electrons: ``4"
- \(\mu_s = \sqrt{4(4+2)} = \sqrt{24} \approx 4.90 \, BM\)


- Mn\(^{2+}\) (Z = 25, electronic configuration: [Ar] 3d\(^5\))
- Number of unpaired electrons: ``5"
- \(\mu_s = \sqrt{5(5+2)} = \sqrt{35} \approx 5.92 \, BM\)


- Fe\(^{2+}\) (Z = 26, electronic configuration: [Ar] 3d\(^6\))
- Number of unpaired electrons: ``4"
- \(\mu_s = \sqrt{4(4+2)} = \sqrt{24} \approx 4.90 \, BM\)


- Sc\(^{3+}\) (Z = 21, electronic configuration: [Ar])
- Number of unpaired electrons: ``0"
- \(\mu_s = 0 \, BM\) (diamagnetic)


Step 3: Identifying Matching Magnetic Moments

From the calculations, Cr\(^{2+}\) and Fe\(^{2+}\) have the same spin-only magnetic moment of ``4.90 BM".


Conclusion: Since option (2) correctly lists Cr\(^{2+}\) and Fe\(^{2+}\), it is the correct answer.


\text{Option (2) Quick Tip: - Magnetic moment depends on the number of unpaired electrons. - Ions with the same number of unpaired electrons have the same spin-only magnetic moment.

- Entropy increases when disorder in a system increases.

- A (Evaporation): Liquid to gas increases disorder.

- C (Decomposition reaction): Formation of CO\(_2\) and H\(_2\)O gases increases entropy.

- D (Dissociation of Cl\(_2\)): More molecules are formed, increasing randomness.


Thus, the correct answer is (4). Quick Tip: Entropy increases when solids become liquids, liquids become gases, or decomposition reactions produce gases.

Step 1: Understanding Intramolecular Hydrogen Bonding

Intramolecular hydrogen bonding occurs when a hydrogen bond is formed within the same molecule. This happens when a hydrogen atom is bonded to an electronegative element (such as O, N, or F) and interacts with another electronegative atom within the same molecule.


Step 2: Evaluating the Given Options

- ``HF": In HF, hydrogen bonding is present but it is intermolecular (between different molecules), not intramolecular.


- ``Ortho-Nitrophenol": Due to the close proximity of the -OH and -NO₂ groups on the benzene ring, intramolecular hydrogen bonding occurs.


- ``Para-Nitrophenol and Meta-Nitrophenol": These molecules do not exhibit intramolecular hydrogen bonding because the functional groups are too far apart.


Conclusion: Since intramolecular hydrogen bonding is observed in ortho-nitrophenol, the correct answer is:


\text{Option (2) Quick Tip: - Intramolecular hydrogen bonding occurs when the hydrogen bond is formed within the same molecule. - Ortho-substituted hydroxyl compounds like ortho-nitrophenol exhibit strong intramolecular hydrogen bonding. - This bonding reduces the ability of ortho-nitrophenol to form intermolecular hydrogen bonds, leading to lower boiling points.

Step 1: Relation Between \( K_p \) and \( K_c \) \[ K_p = K_c (RT)^{\Delta n} \]
where \( \Delta n \) is the change in the number of moles of gas.

Step 2: Identifying \( \Delta n \)

- If \( \Delta n = 0 \), then \( K_p = K_c \).

- In option (2), \( \Delta n = (1+1) - 1 = 1 \), so \( K_p \neq K_c \).


Thus, the correct answer is (2). Quick Tip: For reactions where the number of moles of gas changes, \( K_p \) and \( K_c \) will be different.

- Mn\(^3+\) has a \( d^4 \) configuration, while Mn\(^2+\) has a \( d^5 \) configuration.
- The half-filled \( d^5 \) state is highly stable, making reduction more favorable and increasing \( E^\circ \).


Thus, the correct answer is (4). Quick Tip: A half-filled \( d^5 \) configuration is exceptionally stable, leading to a more positive reduction potential.

- Activation energy (\( E_a \)) is determined using the Arrhenius equation:
\[ k = A e^{-E_a/RT} \]
- Taking the logarithm and using values at two different temperatures allows calculation of \( E_a \).


Thus, the correct answer is (1). Quick Tip: The Arrhenius equation helps determine activation energy using rate constants at different temperatures.

Step 1: Determining the Bonding in Each Molecule

- Ethane (C\(_2H_6\)): Contains only a single bond between carbon atoms, meaning it has one \(\sigma\)-bond.

- Hence, A matches with (III).

- Ethene (C\(_2H_4\)): Contains a double bond, meaning it has one \(\sigma\)-bond and one \(\pi\)-bond.

- Hence, B matches with (IV).

- Carbon molecule, C\(_2\): Experimental studies suggest that C\(_2\) contains a double bond with two \(\pi\)-bonds.

- Hence, C matches with (II).

- Ethyne (C\(_2H_2\)): Contains a triple bond, meaning it has one \(\sigma\)-bond and two \(\pi\)-bonds.

- Hence, D matches with (I).



Thus, the correct answer is (4) A-III, B-IV, C-II, D-I. Quick Tip: To determine bond types, remember: - Single bond = 1 \(\sigma\)-bond - Double bond = 1 \(\sigma\)-bond + 1 \(\pi\)-bond - Triple bond = 1 \(\sigma\)-bond + 2 \(\pi\)-bonds

Step 1: Understanding the Concept of Sublimation

Sublimation is the process in which a solid directly converts into its gaseous state without passing through the liquid phase. This process is used for purifying substances that can undergo sublimation while leaving behind impurities.


Step 2: Comparing the Given Options


- ``Chromatography" is used for the separation of components in a mixture based on differential adsorption.

- ``Crystallization" is used to purify solid substances by forming crystals from a solution.

- ``Sublimation" is the correct method as it directly converts solid to gas and is used for purification.

- ``Distillation" is used for separating components based on boiling points in liquid mixtures.


Conclusion: Since sublimation is the technique used for purification of solid substances that directly convert to vapour, the correct answer is:


\text{Option (3) Quick Tip: - Sublimation is the direct conversion of a solid to gas without passing through the liquid phase. - Examples of substances that undergo sublimation: Camphor, Naphthalene, and Ammonium chloride. - This method is commonly used for purification of sublimable solids.

Step 1: Understanding Faraday's Law of Electrolysis

- ``Faraday’s Law" states that the amount of substance liberated or deposited at an electrode is directly proportional to the quantity of electricity passed.



Step 2: Determining the Number of Faradays Required

- ``A: H\(_2\)O to O\(_2\) (2F required)"
- The oxidation of 1 mole of water to oxygen gas requires ``2 Faradays".


- ``B: MnO\(_4^-\) to Mn\(^{2+}\) (5F required)"
- The permanganate ion (MnO\(_4^-\)) undergoes reduction to Mn\(^{2+}\), involving a 5-electron transfer, thus ``5 Faradays".



- ``C: 1.5 mol of Ca from molten CaCl\(_2\) (3F required)"
- The reduction of 1.5 moles of Ca\(^{2+}\) to Ca metal requires ``3 Faradays".


- ``D: FeO to Fe\(_2\)O\(_3\) (1F required)"
- The oxidation of FeO to Fe\(_2\)O\(_3\) requires ``1 Faraday".


Conclusion:
Thus, the correct matching is A-II, B-IV, C-I, D-III. Quick Tip: - 1F = 96,485 C and corresponds to 1 mole of electrons. - Oxidation states determine the number of electrons required for reduction/oxidation. - Higher oxidation state changes require more Faradays.

- Magnetic Quantum Number (\( m_l \)): Determines orbital orientation \(\Rightarrow\) Matches with (III).

- Spin Quantum Number (\( m_s \)): Determines electron spin orientation \(\Rightarrow\) Matches with (IV).

- Azimuthal Quantum Number (\( l \)): Determines orbital shape \(\Rightarrow\) Matches with (I).

- Principal Quantum Number (\( n \)): Determines orbital size \(\Rightarrow\) Matches with (II).



Thus, the correct answer is (3). Quick Tip: Quantum numbers define electron properties: \( n \) = Size, \( l \) = Shape, \( m_l \) = Orientation, \( m_s \) = Spin.

Step 1: Understanding Redox Reactions

A redox reaction involves both oxidation (loss of electrons) and reduction (gain of electrons). This typically occurs when there is a change in the oxidation states of the elements involved.


Step 2: Checking Each Option

- Option (A): The reaction
\[ BaCl_2 + Na_2SO_4 \rightarrow BaSO_4 + 2NaCl \]
is a double displacement (precipitation) reaction. The oxidation states of all elements remain unchanged. Hence, it is not a redox reaction.

- Option (B): The reaction
\[ Zn + CuSO_4 \rightarrow ZnSO_4 + Cu \]
involves Zn being oxidized from 0 to +2 and Cu being reduced from +2 to 0, making it a redox reaction.

- Option (C): The reaction
\[ 2KClO_3 + I_2 \rightarrow 2KIO_3 + Cl_2 \]
involves oxidation of iodine and reduction of chlorine, making it a redox reaction.

- Option (D): The reaction
\[ H_2 + Cl_2 \rightarrow 2HCl \]
involves oxidation of hydrogen and reduction of chlorine, making it a redox reaction.

Conclusion: Since option (A) does not involve any change in oxidation states, it is not a redox reaction.

Thus, the correct answer is:
\[ Option (1) \] Quick Tip: - A redox reaction must involve both oxidation and reduction. - A simple double displacement reaction (precipitation) is not a redox reaction.

- Cyclohexane to Benzophenone: Zn/H\(_2\)O reduces benzophenone.

- Alcohol to Ketone: CrO\(_3\) oxidizes alcohols to ketones.

- Alkene to Carboxylate: KMnO\(_4\)/KOH, \(\Delta\) cleaves double bonds forming carboxylates.

- Benzyl Chloride to Alkane: Cl/Anhydrous AlCl\(_3\) enables Friedel-Crafts alkylation.



Thus, the correct answer is (4). Quick Tip: Different oxidizing agents like KMnO\(_4\) and CrO\(_3\) lead to different oxidation products.

(1) 2.2710982 \, \text{of He at STP = \(\frac{2.271{22.710982}\)

\[ = 0.1 \, mole \]
\[ = 0.1 N_A \, He atom \]



(2) 4 \, \text{mol of He = \(4 N_A\) \, \text{He atoms



\text{(3) 4 \, u \, \text{of He = \(\frac{4u{4u}\) = 1 \, He atom


\(\text{(4) 4\) \, g of Helium = \(\frac{4 \, \text{g}{4 \, g}\) \, mole = 1 \, \text{mole = \(N_A\) \, \text{He atom Quick Tip: - 1 mole of any substance contains Avogadro's number (\(6.022 \times 10^{23\)) of atoms/molecules. - Volume at STP can be converted to moles using the molar volume of gas (22.4 L/mol).

- Arrhenius equation:
\[ k = A e^{-E_a/RT} \]
Taking natural logarithm:
\[ \ln k = \ln A - \frac{E_a}{RT} \]
This represents a straight-line equation with a negative slope (\(-E_a/R\)).


Thus, the correct answer is (1). Quick Tip: The Arrhenius equation gives a linear plot with a negative slope for \( \ln k \) vs \( \frac{1}{T} \).

- Isothermal Process (\( A \)) occurs at constant temperature \(\Rightarrow\) Matches with (II).

- Isochoric Process (\( B \)) occurs at constant volume \(\Rightarrow\) Matches with (III).

- Isobaric Process (\( C \)) occurs at constant pressure \(\Rightarrow\) Matches with (IV).

- Adiabatic Process (\( D \)) has no heat exchange \(\Rightarrow\) Matches with (I).



Thus, the correct answer is (1). Quick Tip: Thermodynamic processes are classified based on whether temperature, volume, or pressure remains constant.

Step 1: Understanding Electronegativity Trends


Electronegativity refers to the ability of an atom to attract shared electrons towards itself in a chemical bond. The general trend in the periodic table is:


- Electronegativity increases across a period (left to right).

- Electronegativity decreases down a group (top to bottom).



Step 2: Comparing Electronegativity Values


The approximate electronegativity values of the given elements are: \[ Si = 1.90, \quad C = 2.55, \quad N = 3.04, \quad O = 3.44, \quad F = 3.98 \]

Arranging these in increasing order:
\[ Si < C < N < O < F \]

Thus, the correct order is given in option (2).
Quick Tip: Electronegativity follows the trend:
- \textbf{Increases across a period} due to increasing nuclear charge.
- \textbf{Decreases down a group} due to increasing atomic size and shielding effect.

Step 1: Understanding S\(_N\)1 Mechanism


- The S\(_N\)1 reaction follows a two-step mechanism:

1. Formation of a carbocation (rate-determining step).

2. Nucleophilic attack on the carbocation.


- The stability of the carbocation determines the rate of the reaction.

- More stable carbocations (due to resonance, inductive effects, or hyperconjugation) favor faster S\(_N\)1 reactions.


Step 2: Analyzing the Given Options


- (1) Benzyl bromide with a methyl group (-CH\(_3\)) at the benzylic position:

- The benzyl carbocation formed after the departure of Br\(^-\) is highly stable due to resonance stabilization.

- The methyl group provides additional hyperconjugation stabilization.

- This makes it the``most reactive" in an S\(_N\)1 mechanism.



- (2) Cyclohexyl bromide:

- The formed cyclohexyl carbocation lacks resonance stabilization.

- Only inductive effects contribute, making it less stable.


- (3) Bromocyclohexane:"

- The formed carbocation is not stabilized by resonance.

- Less reactive than benzylic and allylic systems.


- (4) Benzyl bromide (without additional stabilization):

- The benzyl carbocation is stable due to resonance, but lacks additional hyperconjugation effects".


- Less reactive than option (1), which has both resonance and hyperconjugation.

Conclusion:

- The most stable carbocation corresponds to option (1) due to both resonance and hyperconjugation stabilization.

- Therefore, option (1) undergoes the fastest S\(_N\)1 reaction.
Quick Tip: - Carbocation stability order: \textbf{Benzyl \(>\) Allyl \(>\) Tertiary \(>\) Secondary \(>\) Primary} - More stable carbocations favor S\(_N\)1 reactions. - Resonance and hyperconjugation effects enhance carbocation stability.

- \( PCl_3 \) reacts with alcohols (ROH) forming RCl and phosphorous acid (H\(_3\)PO\(_3\)).

- \( PCl_5 \) reacts with alcohols forming RCl, HCl, and phosphorus trichloride (PCl\(_3\)).


Thus, the correct answer is (1). Quick Tip: \( PCl_3 \) forms H\(_3\)PO\(_3\), while \( PCl_5 \) undergoes hydrolysis to form PCl\(_3\).

Step 1: Arrhenius Equation and Log Form

Using the Arrhenius equation in logarithmic form:
\[ \log \left( \frac{k_2}{k_1} \right) = \frac{E_a}{2.303 R} \left( \frac{T_2 - T_1}{T_1 T_2} \right) \]

Given that the rate quadruples, \( \frac{k_2}{k_1} = 4 \), so:
\[ 0.6021 = \frac{E_a}{2.303 \times 8.314} \times \left( \frac{30}{(300)(330)} \right) \]

Step 2: Plugging in Values
\[ E_a = \frac{0.6021 \times 2.303 \times 8.314 \times 300 \times 330}{30} \]
\[ E_a = 38.04 kJ/mol \]

Final Answer:
\[ \mathbf{38.04\ kJ/mol} \] Quick Tip: The Arrhenius equation is useful for determining activation energy from temperature-dependent reaction rates.

Step 1: Understanding the Reaction Pathway


- The first step involves the substitution of iodine with cyanide to form \( CH_3CH_2CH_2CN \) (compound A).

- Partial hydrolysis of A produces an amide (compound B: \( CH_3CH_2CH_2CONH_2 \)).

- Hoffmann bromamide degradation of B with \( NaOH/Br_2 \) reduces the carbon chain by one, yielding the major product C: propylamine (\( CH_3CH_2CH_2NH_2 \)).


Final Answer:
\[ \mathbf{propylamine (CH_3CH_2CH_2NH_2)} \] Quick Tip: The Hoffmann bromamide reaction reduces an amide to an amine with one less carbon atom.

\[ Cu^{2+} (aq) + 2e^- \rightarrow Cu (s) \]

The mass of Cu deposited (\(w\)) is given by the formula:
\[ w = \frac{M \times i \times t}{n \times F} \]

Substituting the known values:
\[ w = \frac{63 \times 9.6487 \times 100}{2 \times 96487} \]
\[ w = 0.315 \, g \]

Final Answer:
\[ \mathbf{0.315 g} \] Quick Tip: For electrolysis problems, always use: - Faraday’s First Law: \( m = \frac{ZIt}{F} \), - \( Z \) calculation: \( Z = \frac{M}{nF} \), - Use correct values of \( n \) and \( F \) for precise calculations.

Step 1: Understanding Hydrolysis Prevention in Mohr’s Salt

Mohr’s salt (\( FeSO_4\cdot(NH_4)_2SO_4\cdot6H_2O \)) contains ferrous (\( Fe^{2+} \)) ions, which tend to undergo hydrolysis in aqueous solution, leading to oxidation and precipitation of ferric hydroxide (\( Fe(OH)_3 \)).
\[ Fe^{2+} + H_2O \rightarrow Fe(OH)_2 + H^+ \]

Step 2: Role of Dilute Sulphuric Acid

To prevent hydrolysis, an acid is added to the solution. The best choice is dilute sulphuric acid because:

- It provides sufficient \( H^+ \) ions to suppress hydrolysis.
- It does not oxidize \( Fe^{2+} \) to \( Fe^{3+} \), unlike nitric acid, which is an oxidizing agent.
- It stabilizes the ferrous ions in solution.


Final Answer:
\[ \mathbf{dilute\ sulphuric\ acid} \] Quick Tip: Mohr’s salt solution remains stable in the presence of dilute sulphuric acid due to the suppression of hydrolysis and oxidation of \( Fe^{2+} \).

Step 1: Using the Osmotic Pressure Equation

The osmotic pressure equation is given by: \[ \Pi = C R T \]
where \( \Pi \) = osmotic pressure, \( C \) = concentration, \( R \) = universal gas constant, \( T \) = temperature in Kelvin.

Since the slope of the plot (\(\Pi\) vs \(C\)) represents \( R T \):
\[ R T = 25.73 \]

Step 2: Calculating Temperature
\[ T = \frac{25.73}{0.083} \]
\[ T = 310 K \]

Step 3: Converting to Celsius
\[ T = 310 - 273 = 37^\circ C \]

Step 4: Final Answer

Thus, the temperature at which the osmotic pressure measurement was done is:
\[ \mathbf{37^\circ C} \] Quick Tip: To determine temperature from an osmotic pressure plot: - Identify the slope as \( RT \). - Use \( T = \frac{slope}{R} \). - Convert from Kelvin to Celsius if needed.

- Qualitative analysis groups cations based on solubility and precipitate formation.

- Group order (0 to VI):

- Group 0: Cu\(^2+\) (soluble in water)

- Group I: Pb\(^2+\), Ag\(^+\) (insoluble chlorides)

- Group II: Al\(^3+\) (soluble in NH\(_4\)OH)

- Group III: Co\(^2+\) (forms precipitate with NH\(_4\)OH)

- Group IV: Ba\(^2+\) (forms sulfate precipitate)

- Group V: Mg\(^2+\) (forms phosphate precipitate)


Thus, the correct answer is (2). Quick Tip: Cations are grouped by precipitate solubility in qualitative analysis from Group 0 to VI.

Using the equilibrium constant expression:
\[ K_c = \frac{[N_2][O_2]}{[NO]^2} \]

Substituting the given values:
\[ K_c = \frac{(3 \times 10^{-3}) \times (4.2 \times 10^{-3})}{(2.8 \times 10^{-3})^2} \]
\[ K_c = 1.607 \]

By applying the ICE table method and solving for \(\alpha\), we obtain:
\[ \alpha = \frac{2.54}{3.54} = 0.717 \] Quick Tip: Use ICE (Initial-Change-Equilibrium) tables to methodically determine equilibrium concentrations. The equilibrium constant helps find unknown variables.

Step 1: Understanding Homoleptic and Heteroleptic Complexes

- A homoleptic complex consists of only one type of ligand.
- A heteroleptic complex contains more than one type of ligand.

Step 2: Evaluating the Given Complexes


\([Co(NH_3)_6]^{3+}\) contains only ammonia (\(NH_3\)) ligands, classifying it as a homoleptic complex.
\([Co(NH_3)_4Cl_2]^{+}\) has both ammonia (\(NH_3\)) and chloride (\(Cl^-\)) ligands, making it a heteroleptic complex.


Step 3: Validating the Statements

- Statement I is correct because it properly classifies \([Co(NH_3)_6]^{3+}\) as homoleptic and \([Co(NH_3)_4Cl_2]^{+}\) as heteroleptic.


- Statement II is also correct because \([Co(NH_3)_6]^{3+}\) has only one type of ligand (\(NH_3\)), whereas \([Co(NH_3)_4Cl_2]^{+}\) has two types (\(NH_3\) and \(Cl^-\)).

Thus, both statements are valid. Quick Tip: - \textbf{Homoleptic Complex:} All ligands are of the same type. - \textbf{Heteroleptic Complex:} The metal ion is coordinated with different types of ligands.

Step 1: Understanding the Reaction Sequence


1. Reaction with PBr\textsubscript{3

- The hydroxyl (-OH) group in the starting compound undergoes substitution with bromine (-Br) in the presence of phosphorus tribromide (PBr\textsubscript{3).

- This results in the formation of alkyl bromide (A).



2. Reaction with Alcoholic KOH (Elimination Reaction)

- Alkyl bromide undergoes elimination (E2 mechanism) in the presence of alcoholic KOH and heat (\(\Delta\)).

- The removal of \(\beta\)-hydrogen leads to the formation of an alkene (B) as the major product.


Step 2: Identifying the Correct Structures of A and B


- ``Product A": The \(-OH\) group is replaced by ``Br" using ``PBr\textsubscript{3.

- ``Product B": ``Alkene formation via elimination of HBr".



Step 3: Verifying Answer Choices


\begin{tabular{|c|c|c|
\hline
Option & A (Alkyl Bromide) & B (Alkene)

\hline
(1) & Incorrect & Incorrect

(2) & \checkmark & \checkmark

(3) & Incorrect & Incorrect

(4) & Incorrect & Incorrect

\hline
\end{tabular


Conclusion:
The correct answer is option (2), where A = bromo derivative and B = alkene formed via elimination. Quick Tip: - PBr\textsubscript{3} is a good reagent for replacing hydroxyl (-OH) groups with bromine (-Br). - Alcoholic KOH favors elimination (E2 mechanism), leading to alkene formation. - The major alkene follows Saytzeff’s Rule: More substituted alkene is favored.

Step 1: Understanding Resonance and Canonical Forms

The carbonate ion \( CO_3^{2-} \) exhibits resonance, meaning its actual electronic structure is a hybrid of multiple contributing forms. These canonical structures differ in the arrangement of double bonds but maintain the same overall charge.


Step 2: Evaluating Each Option


- Option (1): Correct. The carbonate ion possesses three resonance structures where the double bond alternates among the three oxygen atoms.

- Option (2): Incorrect. Ozone (\( O_3 \)) only has two resonance structures, not three.

- Option (3): Incorrect. \( BF_3 \) has a symmetrical trigonal planar geometry, leading to a net-zero dipole moment.

- Option (4): Incorrect. The dipole moment of \( NH_3 \) is higher than that of \( NF_3 \) due to opposing bond dipoles in \( NF_3 \).

\[ Correct answer: Option (1) \] Quick Tip: Resonance structures represent different Lewis structures that depict the same molecule, illustrating delocalized electrons. Canonical forms contribute to the resonance hybrid.

Step 1: Determine the Percentage of C
\[ Percentage of C = 100% - (32% + 20%) = 48% \]

Step 2: Calculate the Moles of Each Element

Using the formula: \[ Moles = \frac{Mass percentage}{Atomic mass} \]
\[ Moles of A = \frac{32}{64} = 0.5 \]
\[ Moles of B = \frac{20}{40} = 0.5 \]
\[ Moles of C = \frac{48}{32} = 1.5 \]

Step 3: Determine the Simplest Ratio

Dividing by the smallest value (0.5):
\[ A : B : C = \frac{0.5}{0.5} : \frac{0.5}{0.5} : \frac{1.5}{0.5} = 1 : 1 : 3 \]

Step 4: Deriving the Empirical Formula

The empirical formula is: \[ ABC_3 \] Quick Tip: To determine the empirical formula: 1. Convert percentage composition to moles. 2. Divide by the smallest mole value. 3. Express in whole-number ratios.

- Diamagnetism occurs when an element or ion has no unpaired electrons in its electronic configuration.

- Ce\(^4+\) (4f\(^0\)): The 4f orbital is empty, making it diamagnetic.

- Yb\(^2+\) (4f\(^14\)): The 4f orbital is completely filled, making it diamagnetic.

- Other lanthanide ions like Pm\(^3+\), Sm\(^3+\), and Gd\(^3+\) have partially filled 4f orbitals, making them paramagnetic.



Thus, the correct answer is (2). Quick Tip: Lanthanoid ions with 4f\(^0\) (empty) or 4f\(^n\) (completely filled shells) are diamagnetic.

N/A Quick Tip: For isothermal expansion, work done is negative since the system performs work on the surroundings. Use the formula \( W = -nRT \ln (P_2 / P_1) \) for accurate calculations.

- Alkene oxidation by KMnO\(_4\) in acidic conditions results in oxidative cleavage of the double bond.

- The C=C bond splits, and each carbon originally part of the double bond forms a carboxyl (-COOH) or ketone (-C=O) functional group.

- In this case, the reaction leads to cyclohexyl carboxylic acid as the major product due to complete oxidation.



Thus, the correct answer is (3). Quick Tip: Oxidation of alkenes with KMnO\(_4\) in acidic medium leads to cleavage and formation of carboxyl or ketone groups.

Step 1: Understanding the Classification Basis for Fungi

Fungi are classified based on several features, including:

- Morphology of mycelium – Structure and arrangement of fungal hyphae.

- Mode of spore formation – Asexual or sexual reproductive strategies.

- Fruiting body – The reproductive structure where spores are produced.


Step 2: Evaluating the Given Options

- (A) Fruiting body: Important for classification, as fungi are categorized by reproductive structures like basidiocarps or ascocarps.

- (B) Morphology of mycelium: Plays a role in identifying fungi based on septate or coenocytic mycelium.

- (D) Mode of spore formation: Crucial for differentiating fungal groups based on reproductive mechanisms.


Step 3: Why Option (C) is Correct?

- Mode of nutrition is not a primary classification criterion, as all fungi are heterotrophic.
- While some fungi are saprophytic, parasitic, or symbiotic, these distinctions do not form the basis of fungal classification.


Conclusion:

Since fungal classification is determined by mycelium structure, fruiting body, and spore formation rather than nutritional mode, the correct answer is (C) Mode of nutrition.
Quick Tip: - Fungal taxonomy is based on reproductive and structural characteristics, not on how they obtain nutrients. - Most fungi are decomposers, but their mode of nutrition does not affect classification.

Step 1: Evaluating Statement I


- Parenchyma is a living tissue that helps in storage, photosynthesis, and secretion.

- Collenchyma is also living and provides mechanical support.

- Since collenchyma is not dead, Statement I is false.


Step 2: Evaluating Statement II


- Gymnosperms lack xylem vessels and rely on tracheids for water conduction.

- Xylem vessels are a distinguishing feature of angiosperms.

- Therefore, Statement II is true. Quick Tip: Parenchyma and collenchyma are both living tissues, whereas sclerenchyma is dead. Gymnosperms rely on tracheids instead of xylem vessels for water transport.

Step 1: Understanding the genetics of Snapdragon flower color.


In Snapdragon (Antirrhinum), flower color follows the pattern of incomplete dominance:

- The red flower color (RR) is dominant.

- The white flower color (rr) is recessive.

- The heterozygous condition (Rr) produces pink flowers due to incomplete dominance.



Step 2: Setting up the cross.


The given cross is between a pink-flowered (Rr) and a red-flowered (RR) plant:

\[ Rr \times RR \]


Step 3: Determining the offspring genotype and phenotype.


Using a Punnett square:

\[ \begin{array{c|cc} & R & R
\hline R & RR & RR
r & Rr & Rr
\end{array} \]

The offspring distribution is:

- 50% RR (Red flowered)

- 50% Rr (Pink flowered)


Step 4: Conclusion.
Thus, the progeny will consist of both red and pink-flowered plants, but no white-flowered plants. Hence, the correct answer is Option (3). Quick Tip: In incomplete dominance, the heterozygous condition exhibits a blend of the dominant and recessive traits. This is different from codominance, where both traits appear distinctly.

Step 1: Understanding the correctness of statements


- Statement A: Incorrect. The flowers of Vallisneria are not colourful and do not produce nectar. They rely on water pollination.

- Statement B: Correct. Water lily flowers are not pollinated by water; they are pollinated by insects.


- Statement C: Correct. In water-pollinated species, pollen grains have a protective coating to prevent wetting.


- Statement D: Correct. Some hydrophytes have long and ribbon-like pollen grains for easy dispersal in water.


- Statement E: Correct. In some hydrophytes, pollen grains are passively carried inside the water for pollination.

Step 2: Selecting the correct option
Since statements B, C, D, and E are correct, the correct answer is option (1). Quick Tip: - \textbf{Hydrophily is pollination by water, occurring in some submerged plants. - Vallisneria follows epihydrophily (pollination on the water surface). - Zostera follows hypohydrophily (pollination underwater).

Step 1: Understanding the Major Causes of Biodiversity Loss

The four major causes of biodiversity loss, also known as the "Evil Quartet," are:

1. ``Habitat loss and fragmentation: Destruction of natural habitats leads to loss of species.


2. ``Over-exploitation": Excessive use of natural resources leads to depletion.


3. ``Co-extinction": When a species goes extinct, dependent species also go extinct.


4. ``Invasive species and climate change" (not mentioned in the options).

- ``Mutation" (C) is a natural process and does not directly cause biodiversity loss.


- ``Migration" (E) is a response to environmental changes but not a direct cause of biodiversity loss.


Step 2: Conclusion

- The correct factors causing biodiversity loss are A (Over-exploitation), B (Co-extinction), and D (Habitat loss and fragmentation).
- This corresponds to Option (1). Quick Tip: - Biodiversity loss is primarily caused by habitat destruction, over-exploitation, and co-extinction. - Conservation efforts focus on protecting natural habitats and preventing species extinction.

Step 1: Understanding the Microorganism and its Product


- Clostridium butylicum produces butyric acid (A-III).

- \textit{Saccharomyces cerevisiae is used in fermentation to produce ethanol (B-I).

- \textit{Trichoderma polysporum produces Cyclosporin-A, an immunosuppressant (C-IV).

- \textit{Streptococcus sp. is used in the production of Streptokinase, a clot-dissolving enzyme (D-II).


Final Answer:

A-III, B-I, C-IV, D-II Quick Tip: - Microbial products have vast applications in medicine and industry.
- Fermentation by \textit{Saccharomyces cerevisiae is widely used in alcohol production.
- Streptokinase is used as a clot buster in treating heart diseases.
- Cyclosporin-A is crucial for preventing organ rejection in transplants.

Step 1: Understanding the dark reaction of photosynthesis

The dark reaction, also known as the Calvin Cycle, occurs in the stroma of chloroplasts. Unlike the light-dependent reaction, it does not require direct sunlight. Instead, it utilizes the products of the light-dependent reaction to synthesize glucose.



Step 2: Identifying the required components


CO\(_2\) (C) is required as a raw material for the Calvin cycle.
ATP (D) is produced in the light reaction and provides the energy required for carbon fixation.
NADPH (E) is also generated during the light reaction and provides reducing power for the conversion of 3-PGA into G3P.




Step 3: Eliminating unnecessary components


Light (A) is necessary for the light reaction, but not for the Calvin Cycle.
Chlorophyll (B) is a pigment essential for capturing light energy, but it is not directly involved in the dark reaction.




Step 4: Conclusion
Since the Calvin Cycle requires CO\(_2\) (C), ATP (D), and NADPH (E), the correct answer is Option (4) - C, D, and E only. Quick Tip: The dark reaction is also known as the \textbf{light-independent reaction} or the \textbf{Calvin-Benson Cycle}. It depends on ATP and NADPH produced in the light-dependent reaction to drive carbon fixation.

Step 1: Let's break down each item to match them correctly:

A. Two or more alternative forms of a gene: These are called alleles, so A-III is correct.

B. Cross of F1 progeny with homozygous recessive parent: This is a test cross, so B-IV is correct.

C. Cross of F1 progeny with any of the parents: This is known as a back cross, so C-I is correct.

D. Number of chromosome sets in plant: This refers to ploidy, so D-II is correct.


Thus, the correct match is A-III, B-IV, C-I, D-II, corresponding to option (4). Quick Tip: In genetics, alleles are different forms of a gene, test crosses are used to determine genotype, back crosses involve crossing F1 progeny with parents, and ploidy refers to the number of chromosome sets.

Step 1: Understanding the Leptotene and Diplotene Stages

1. ``Leptotene Stage:"

- The first stage of prophase I of meiosis.

- Chromosomes start condensing and become gradually visible under the light microscope.

- Thus, Statement I is correct.



2. ``Diplotene Stage:"

- The fourth stage of prophase I of meiosis.

- Characterized by the dissolution of the synaptonemal complex, leading to separation of homologous chromosomes except at chiasmata.

- ``Thus, Statement II is also correct."



Step 2: Conclusion

- Since both statements are correct, the correct answer is Option (2). Quick Tip: - Leptotene: Chromosomes become visible as thin threads. - Zygotene: Synapsis (pairing) of homologous chromosomes occurs. - Pachytene: Crossing over takes place. - Diplotene: Dissolution of the synaptonemal complex occurs.

Step 1: Understanding the fate of foreign DNA in an alien organism

When a foreign piece of DNA carrying a gene of interest is introduced into an alien organism, it can have different fates:


Step 2: Explanation of the given statements:

- (A) False: A piece of DNA without an origin of replication cannot replicate independently unless incorporated into a plasmid.


- (B) True: If the foreign DNA gets integrated into the genome of the recipient, it will become a permanent part of the organism's DNA.


- (C) True: If the foreign DNA integrates with the host genome, it will multiply and be inherited by the next generations.


- (D) False: If the DNA integrates into the genome, it becomes part of the chromosome.


- (E) False: Only DNA with a suitable origin of replication can show the ability to replicate.

Thus, the correct answer is (4) B and C only. Quick Tip: In genetic engineering, foreign DNA can either: - Integrate into the genome, ensuring stable inheritance. - Remain as an extrachromosomal element if it has an origin of replication.

Step 1: Understanding flower types based on ovary position

- In Perigynous flowers, the ovary is half-inferior, meaning that the floral parts (calyx, corolla, and androecium) are arranged around the ovary at the same level due to the presence of a floral cup or hypanthium.


- In Epigynous flowers, the ovary is inferior, meaning the floral parts are positioned above the ovary.


- In Hypogynous flowers, the ovary is superior, meaning the floral parts are attached below the ovary.



Step 2: Analyzing the given diagrams

- Figure (a) shows a perigynous flower where the floral parts are at the same level as the ovary.
- Figure (b) also shows a perigynous flower.



Step 3: Conclusion
Since both figures (a) and (b) exhibit the characteristics of Perigynous flowers, the correct answer is Option (1). Quick Tip: - In \textbf{Hypogynous} flowers, the ovary is superior (e.g., Mustard, Brinjal).
- In \textbf{Perigynous} flowers, the ovary is half-inferior (e.g., Rose, Peach).
- In \textbf{Epigynous} flowers, the ovary is inferior (e.g., Guava, Cucumber).

Step 1: Understanding Floral Symmetry

Flowers can be classified based on their symmetry into two types:
- Actinomorphic flowers (radial symmetry): These flowers can be divided into equal halves along multiple planes passing through the center.
- Zygomorphic flowers (bilateral symmetry): These flowers can be divided into equal halves only along a single plane.


Step 2: Evaluating the Given Options

- (A) Sesbania: This is a zygomorphic flower.

- (B) Datura: This is an actinomorphic flower, meaning it exhibits radial symmetry.

- (C) Cassia: Although some species of Cassia show slight actinomorphic tendencies, they are predominantly zygomorphic.

- (D) \textit{Pisum: Pisum (pea) flowers are zygomorphic.


Step 3: Conclusion

Since \textit{Datura is an example of an actinomorphic flower, the correct answer is (B). Quick Tip: Actinomorphic flowers have radial symmetry, meaning they can be divided into two equal halves along multiple planes (e.g., \textit{Datura and Hibiscus).

Step 1: Understanding Mendel's Law of Dominance.

Mendel's Law of Dominance states that in a pair of contrasting traits, one trait (dominant) masks the expression of the other trait (recessive) in the \( F_1 \) generation.



Step 2: Explanation of the given statements:

- (A) True: Mendel's Law of Dominance states that one factor is dominant over the other.


- (B) False: This describes incomplete dominance, not Mendel's Law of Dominance.


- (C) True: Mendel proposed that factors (genes) exist in pairs in diploid organisms.


- (D) True: The discrete units of inheritance are now known as genes.


- (E) True: The dominant trait is expressed in the \( F_1 \) generation in monohybrid crosses.

Thus, the correct answer is (3) A, C, D, and E only. Quick Tip: Mendel's Laws of Inheritance include: - \textbf{Law of Dominance}: One allele is dominant over the other. - \textbf{Law of Segregation}: Alleles segregate independently during gamete formation. - \textbf{Law of Independent Assortment}: Genes for different traits assort independently.

Step 1: Understanding Cofactors

Cofactors are non-protein chemical compounds required for enzyme activity. They can be metal ions or organic molecules.

Step 2: Identifying the Cofactor for Carboxypeptidase

Carboxypeptidase is a metalloenzyme that specifically requires Zinc (Zn\(^{2+}\)) as a cofactor for its enzymatic activity.

Step 3: Function of Zinc in Carboxypeptidase

- Stabilizes the enzyme structure.
- Aids in catalysis by activating water molecules for peptide bond hydrolysis.

Final Answer:

Zinc (Option 2) Quick Tip: Metalloenzymes like carboxypeptidase and carbonic anhydrase require \( Zn^{2+} \) as a cofactor.

Step 1: Understanding the Logistic Growth Equation


- The logistic growth equation models population growth by considering environmental resistance.

- The term \(\frac{K - N}{K}\) represents the fraction of available resources remaining.


Step 2: Identifying the Meaning of \( K \)


- \( K \) in the equation represents the carrying capacity, which is the maximum population size that the environment can sustain indefinitely.

- When \( N \) (population size) is much smaller than \( K \), growth is approximately exponential.

- As \( N \) approaches \( K \), growth slows down due to limited resources.

- When \( N = K \), population growth ceases (\(\frac{dN}{dt} = 0\)).

Final Answer:

Option (4) Quick Tip: - \textbf{Exponential Growth Model:} \( \frac{dN}{dt} = rN \) (Unlimited growth) - \textbf{Logistic Growth Model:} \( \frac{dN}{dt} = rN \left[ \frac{K - N}{K} \right] \) (Limited by resources) - \textbf{Carrying Capacity (\( K \))}: The upper limit on population size imposed by environmental constraints.

Step 1: Understanding the Function of Each Organelle

- Nucleolus: Produces ribosomal RNA (rRNA) and is essential for ribosome synthesis.


- Centriole: Plays a crucial role in cell division and forms a structure resembling a cartwheel.


- Leucoplasts: Colorless plastids responsible for the storage of nutrients such as starch, oils, and proteins.


- Golgi Apparatus: Involved in packaging, modifying, and sorting molecules such as glycolipids and glycoproteins.



Step 2: Matching the Correct Pairs

- Nucleolus → Site for active ribosomal RNA synthesis (III)

- Centriole → Organization like the cartwheel (II)

- Leucoplasts → For storing nutrients (IV)

- Golgi apparatus → Site of formation of glycolipid (I)



Thus, the correct answer is Option (2). Quick Tip: - Nucleolus is known as the "ribosome factory" of the cell. - Centrioles are absent in plant cells. - Leucoplasts are present in non-photosynthetic parts of plants like roots. - Golgi apparatus is involved in modifying proteins and lipids.

Step 1: Understanding the classifications of fungi

- Rhizopus: A bread mould, so it matches with III.

- Ustilago: A smut fungus, so it matches with II.

- Puccinia: A rust fungus, so it matches with IV.

- Agaricus: A mushroom, so it matches with I.



Step 2: Matching List I with List II

Thus, the correct matching is:
- A \(\rightarrow\) III
- B \(\rightarrow\) II
- C \(\rightarrow\) IV
- D \(\rightarrow\) I



Step 3: Conclusion
The correct answer is Option (2). Quick Tip: - Rhizopus is commonly found in decomposing organic matter. - Ustilago is responsible for smut disease in crops. - Puccinia is a genus of rust fungi, affecting plants like wheat. - Agaricus includes species such as Agaricus bisporus (button mushroom).

Step 1: Understanding the role of lactose in bacterial cells

Lactose is a disaccharide composed of glucose and galactose. In bacteria, especially in E. coli, lactose metabolism is regulated by the lac operon, which controls the expression of enzymes responsible for lactose transport and breakdown.



Step 2: Identifying the function of the given enzymes


Polymerase (A) is responsible for synthesizing DNA or RNA but does not transport lactose.
Beta-galactosidase (B) is the enzyme that breaks down lactose into glucose and galactose but does not transport it into the cell.
Acetylase (C) is involved in biochemical modifications and is not directly related to lactose transport.
Permease (D) is the correct answer because it facilitates the transport of lactose across the bacterial cell membrane.




Step 3: Conclusion
Since Lactose permease is the enzyme responsible for transporting lactose into the bacterial cell, the correct answer is Option (4) - Permease. Quick Tip: The \textbf{lac operon in E. coli consists of three key genes: - \textbf{lacZ} (codes for Beta-galactosidase) - \textbf{lacY} (codes for Permease) - \textbf{lacA} (codes for Transacetylase)

Step 1: Understanding IUCN and the Red List

- The International Union for Conservation of Nature (IUCN) is responsible for maintaining and publishing the IUCN Red List of Threatened Species.

- This list categorizes species based on their risk of extinction, such as Endangered (EN), Vulnerable (VU), Critically Endangered (CR), and Extinct (EX).


Step 2: Explanation of Incorrect Options

- (B) GEAC (Genetic Engineering Appraisal Committee): Incorrect, as GEAC regulates genetic engineering and biotechnology-related research, not endangered species.

- (C) WWF (World Wide Fund for Nature): Incorrect, though WWF is involved in conservation efforts, it does not officially release the Red List.

- (D) FOAM (Federation of Organic Agriculture Movements): Incorrect, as FOAM focuses on organic farming, not biodiversity conservation.


Step 3: Conclusion

The IUCN Red List is the most authoritative source for the global conservation status of species. Hence, the correct answer is (A) IUCN. Quick Tip: - The \textbf{IUCN Red List} helps track conservation status, trends, and necessary actions to protect species. - Categories include \textbf{Least Concern (LC), Near Threatened (NT), Vulnerable (VU), Endangered (EN), Critically Endangered (CR), Extinct in the Wild (EW), and Extinct (EX)}.

Step 1: Understanding the Transcription Unit

A transcription unit in DNA consists of three key components:

1. Promoter:
- Located at the upstream end.
- Serves as the binding site for RNA polymerase.
- Initiates transcription.


2. Structural Gene:
- Contains the coding sequence.
- This sequence is transcribed into mRNA.
- Carries the genetic information required for protein synthesis.



3. Terminator:
- Located at the downstream end.
- Signals the RNA polymerase to stop transcription.
- Ensures the transcription process ends correctly.



Step 2: Explanation of Incorrect Options

- (B) Repressor and Operator gene are parts of the operon model, not the basic transcription unit.

- (C) Transposons are mobile genetic elements and are not part of the transcription unit.

- (D) Inducer and Repressor regulate gene expression but do not define a transcription unit.


Conclusion:

- Since a transcription unit consists of a Promoter, Structural Gene, and Terminator, the correct answer is (A) Promoter, Structural gene, Terminator. Quick Tip: - The promoter is essential for initiating transcription. - The structural gene contains the actual genetic code for protein synthesis. - The terminator ensures proper termination of transcription.

Step 1: Understanding Dedifferentiation

Dedifferentiation is the process where mature, specialized cells regain their capacity to divide and become meristematic again. In plants, this process allows cells to resume mitotic activity and contribute to secondary growth.



Step 2: Explanation of Other Options

- Maturation: It refers to the final stage of cell development where cells achieve their functional specialization.


- Differentiation: It is the process where meristematic cells develop into specialized cells with distinct functions.


- Redifferentiation: This occurs when dedifferentiated cells again develop into specialized tissues after regaining their meristematic activity.

Thus, the correct answer is Option (4) Dedifferentiation. Quick Tip: Dedifferentiation plays a crucial role in plant wound healing and secondary growth, as seen in the formation of interfascicular cambium.

Step 1: Understanding Competitive Inhibition

- Competitive inhibition occurs when a substance competes with the substrate for the active site of an enzyme.
- Malonate is a structural analog of succinate, which is the substrate for the enzyme succinic dehydrogenase.
- Malonate competes with succinate for the enzyme's active site but does not undergo further reaction, thus inhibiting enzyme activity.


Step 2: Explanation of Incorrect Options

- Option (1) Enzyme activation: Incorrect, because malonate does not activate the enzyme; instead, it inhibits it.


- Option (2) Cofactor inhibition: Incorrect, because malonate inhibits the enzyme by directly binding to the active site, not by interfering with a cofactor.


- Option (3) Feedback inhibition: Incorrect, as feedback inhibition involves the end product of a pathway inhibiting an earlier step in the same pathway.


Step 3: Conclusion

Since malonate competes with succinate for binding to succinic dehydrogenase but does not get metabolized, this is a classical example of competitive inhibition. Quick Tip: - \textbf{Competitive inhibitors} resemble the substrate in structure and bind to the active site. - Increasing substrate concentration can overcome competitive inhibition.
- Malonate is a well-known example of a competitive inhibitor of Succinic dehydrogenase.

Step 1: Understanding Lecithin

Lecithin is a naturally occurring lipid that plays a crucial role in biological membranes. It is primarily found in plant and animal tissues, where it functions as an emulsifier and stabilizer.


Step 2: Classification of Lecithin

Lecithin belongs to a class of lipids called phospholipids. These molecules consist of glycerol, fatty acids, a phosphate group, and an organic molecule such as choline. Phospholipids are vital components of cell membranes, contributing to membrane fluidity and cellular function.


Step 3: Evaluating the Given Options

- (A) Carbohydrates: Carbohydrates include sugars, starches, and fibers, which provide energy but do not form cellular membranes.

- (B) Amino acids: Amino acids are the building blocks of proteins, not lipids.

- (C) Phospholipids: Lecithin is classified as a phospholipid, making this the correct answer.

- (D) Glycerides: Glycerides (such as triglycerides) are simple lipids, whereas phospholipids contain a phosphate group, differentiating them from glycerides.


Step 4: Conclusion

Since lecithin is a phospholipid, the correct answer is (C). Quick Tip: Phospholipids, such as lecithin, are key components of biological membranes, forming the lipid bilayer and regulating membrane permeability.

Step 1: Understanding Bulliform Cells

- Bulliform cells are specialized, large, thin-walled epidermal cells found in the leaves of monocots, particularly grasses.
- They are generally located on the upper surface of leaves, arranged in groups along the veins.


Step 2: Function of Bulliform Cells

- These cells play a crucial role in leaf folding and unfolding, which helps plants conserve water during dry conditions.
- During water stress, bulliform cells lose turgor pressure, causing the leaves to curl inward, reducing the exposed surface area and minimizing water loss.


Conclusion:

- Since bulliform cells are responsible for the inward curling of leaves in monocots, the correct answer is (B) Inward curling of leaves in monocots. Quick Tip: - Bulliform cells help in drought resistance by reducing transpiration. - Their function is especially important in xerophytic monocots like grasses.

Step 1: Understanding Kinetochores and Spindle Fibers

- Kinetochores are protein structures on chromatids where spindle fibers attach.

- Spindle fibers facilitate chromosome movement and segregation.


Step 2: Identifying the Phase of Attachment


- Prophase: Spindle fibers begin to form but do not yet attach.

- Metaphase: Spindle fibers attach to kinetochores at the metaphase plate.

- Anaphase: Sister chromatids separate.

- Telophase: Chromosomes decondense and spindle fibers disappear.
Quick Tip: Metaphase is characterized by chromosome alignment at the metaphase plate, where spindle fibers attach to kinetochores.

Step 1: Understanding the Calvin Cycle


- The Calvin cycle is the light-independent reaction of photosynthesis that fixes \( CO_2 \) into organic molecules.

- It occurs in three phases: Carbon fixation, Reduction, and Regeneration of RuBP.


Step 2: ATP and NADPH Requirements


- Each \( CO_2 \) molecule fixed in the Calvin cycle requires:

- 3 ATP molecules (used in Reduction and Regeneration phases).

- 2 NADPH molecules (used in the Reduction phase).


Final Answer:

Option (1): 3 ATP and 2 NADPH per \( CO_2 \) fixed Quick Tip: - \textbf{Total Requirement for 1 Glucose molecule:} - 6 \( CO_2 \) molecules fixed - 18 ATP + 12 NADPH used - \textbf{Ratio per \( CO_2 \) fixed:} 3 ATP : 2 NADPH

Step 1: Understanding Species Richness in Tropical Regions

- Tropical regions support high species richness due to stable climates, high solar energy availability, and evolutionary time.

- Tropical latitudes have remained undisturbed for millions of years, allowing longer time for species diversification (Statement A).

- More solar energy in tropical regions increases primary productivity, supporting diverse ecosystems (Statement C).

- Constant environments promote niche specialization, leading to diverse adaptations and interactions among species (Statement D).

- Predictable and stable tropical environments reduce extinction rates, allowing species to thrive (Statement E).


Step 2: Explanation of Incorrect Statement

- Statement B (Tropical environments are more seasonal) is incorrect since tropical environments are relatively stable throughout the year compared to temperate and polar regions.


Step 3: Conclusion

The correct answer is A, C, D, and E, as they all contribute to species richness in tropical regions. Quick Tip: - \textbf{Species richness} in tropical regions is driven by long evolutionary time, high productivity, niche specialization, and stable environments. - Understanding tropical biodiversity helps in conservation and management efforts.

Step 1: Identifying the Function of Guard Cells

Guard cells are specialized epidermal cells that regulate stomatal opening and closing in plants. Their unique structure includes thin outer walls and thickened inner walls, which play a crucial role in their function.


Step 2: Analyzing the Given Options

- (A) Likely represents an epidermal cell adjacent to the stomata.

- (B) Corresponds to the guard cell, known for its characteristic wall differentiation.

- (C) Could be a part of the stomatal pore itself.

- (D) Appears to be a supporting cell that does not fit the given description.


Step 3: Understanding the Structural Adaptation of Guard Cells

- The thick inner walls allow control over stomatal opening by resisting expansion.

- The thin outer walls enable flexibility, allowing movement when turgor pressure changes.


Conclusion:

Since guard cells (Component C) exhibit thin outer walls and thickened inner walls, the correct answer is (B) C.
Quick Tip: - Guard cells control stomatal function by responding to turgor pressure. - Their structural adaptations allow efficient gas exchange and transpiration control.

Step 1: Understanding Seed Structure

A seed consists of various parts, including the cotyledons, plumule, radicle, and seed coat. The radicle is the part of the embryo that gives rise to the root system during germination.


Step 2: Identifying the Correct Part


- The labeled part C in the given diagram corresponds to the radicle.

- The radicle is the first structure to emerge during germination, developing into the root system.

- Other parts such as the plumule (A or B) develop into the shoot, while the cotyledons provide nourishment.


Thus, the correct answer is (4) C. Quick Tip: The \textbf{radicle} is the embryonic root and is the first part to emerge during seed germination, growing downward to anchor the plant.

Step 1: Understanding the Role of Auxins in Weed Control

1. Auxins are plant hormones used in selective herbicides to remove dicot weeds from monocot crop fields or lawns.
2. They affect dicot plants by promoting uncontrolled growth, leading to their death, while mature monocot plants remain unaffected.



Step 2: Evaluating the Given Options

- Option 1: Auxins primarily promote cell elongation rather than cell division.

- Option 2: Auxins do promote apical dominance, but this is not related to their role in weed control.

- Option 3: Auxins actually delay abscission rather than promoting it.

- Option 4: Correct. Auxins do not significantly affect mature monocots, making them an effective selective herbicide.



Step 3: Conclusion

- Since Option (4) correctly explains why auxins are used for weed control without harming grasses, it is the correct answer. Quick Tip: - Auxins like 2,4-D (2,4-dichlorophenoxyacetic acid) are used as selective herbicides. - They effectively kill dicot weeds while leaving monocot grasses unharmed.

Step 1: Understanding Totipotency

Totipotency is the ability of a single plant cell to divide and differentiate into an entire organism. This concept was first demonstrated by Gottlieb Haberlandt and is the basis of plant tissue culture.


Step 2: Explanation of Other Options

- Somatic Hybridization: This involves the fusion of protoplasts from different species or varieties to form a hybrid cell.


- Micropropagation: It refers to the technique of growing plants in vitro using tissue culture methods.


- Differentiation: This is the process where unspecialized cells become specialized in structure and function.

Thus, the correct answer is Option (2) Totipotency. Quick Tip: Totipotency is the fundamental principle behind plant tissue culture techniques, which are used for cloning and genetic modification of plants.

Step 1: Understanding Conservation Methods

There are two primary types of conservation:
- In-situ conservation: Protecting species in their natural habitat (e.g., National Parks, Wildlife Sanctuaries).
- Ex-situ conservation: Removing species from their natural habitat and placing them in special settings such as zoos, botanical gardens, and seed banks.



Step 2: Identifying the Correct Answer

The question refers to species being "taken out from their natural habitat and placed in a special setting." This aligns with ex-situ conservation, which is a part of biodiversity conservation.



Thus, the correct answer is Option (3). Quick Tip: - In-situ conservation is preferred because it maintains ecosystems naturally. - Ex-situ conservation is essential for species that are critically endangered and require human intervention for survival. - Examples of Ex-situ conservation include captive breeding programs and seed banks.

Step 1: Understanding Dominance and Genotypes


- The black seed color is controlled by either BB (homozygous dominant) or Bb (heterozygous).

- The white seed color is controlled by bb (homozygous recessive).


Step 2: Performing a Test Cross


- A test cross determines whether an organism with a dominant phenotype is homozygous dominant (BB) or heterozygous (Bb).

- This is done by crossing the black seed plant with a homozygous recessive (bb) plant.


Step 3: Analyzing Possible Outcomes


- If the black seed plant is BB, the cross BB × bb results in 100% Bb (all black seeds).

- If the black seed plant is Bb, the cross Bb × bb results in 50% Bb (black) and 50% bb (white).

- The presence of white seeds confirms the black seed plant was Bb.

Final Answer:

Option (3) Quick Tip: A test cross always involves crossing the unknown genotype with a homozygous recessive individual to determine dominance.

Step 1: Understanding Restriction Enzymes

- Hind II is a type of restriction endonuclease that recognizes and cuts DNA at a specific sequence.
- The recognition sequence for Hind II consists of six base pairs (6 bp).


Step 2: Explanation of Recognition Sequence

- Hind II was the first restriction enzyme to be discovered that cuts DNA at a specific nucleotide sequence.
- Its recognition site is typically a palindromic sequence of 6 base pairs.
- This specificity allows for consistent and reproducible DNA fragment patterns.


Conclusion:

- Since Hind II recognizes and cuts DNA at a 6 bp long sequence, the correct answer is (C) 6 bp. Quick Tip: - Restriction enzymes like Hind II are widely used in genetic engineering and molecular cloning. - Their ability to cut DNA at specific sites is essential for recombinant DNA technology.

Step 1: Understanding Bt Toxins

Bacillus thuringiensis (Bt) produces a class of proteins called \textit{cry proteins, which act as insecticidal toxins. These toxins are highly specific to certain groups of insects, meaning different \textit{cry genes target different insect orders.


Step 2: Evaluating Statement I

Statement I is correct. The Bt toxin is encoded by \textit{cry genes, which are specific to particular insect groups. The gene \textit{cry IAc, for example, targets lepidopteran larvae.


Step 3: Evaluating Statement II

Statement II is incorrect. Bt toxin exists in an inactive protoxin form in \textit{B. thuringiensis, but upon ingestion by an insect, it gets converted into its active form due to the alkaline (not acidic) pH of the insect gut. The alkaline pH solubilizes the protoxin, which is then cleaved by proteases to form an active toxin.


Step 4: Conclusion

Since Statement I is true and Statement II is false, the correct answer is (D). Quick Tip: Bt toxin activation occurs in the \textbf{alkaline midgut of insects, not acidic conditions. Cry genes are specific to different insect groups.

Step 1: Understanding Phaeophyceae (Brown Algae)


Phaeophyceae, commonly known as brown algae, have specific characteristics:

- They store food in the form of mannitol and laminarin.

- Their major pigments include chlorophyll a, c, carotenoids, and xanthophylls.

- Their cell walls contain cellulose and are externally coated with gelatinous algin.


Step 2: Verification of Statements


- Statement (A): Correct. Brown algae reproduce asexually through biflagellate zoospores.

- Statement (B): Incorrect. Sexual reproduction in brown algae occurs through isogamy, anisogamy, or oogamy, not only oogamy.

- Statement (C): Correct. Brown algae store food in mannitol and laminarin.

- Statement (D): Correct. Their major pigments include chlorophyll a, c, carotenoids, and xanthophylls.

- Statement (E): Correct. Their cell walls contain cellulose, with an external gelatinous algin coating.


Step 3: Eliminating Incorrect Options


- Option (1): Incorrect, as statement (B) is incorrect.

- Option (2): Incorrect, as statement (B) is included.

- Option (3): Incorrect, as statement (B) is included.

- Option (4): Correct, as it includes only the correct statements (A, C, D, and E).


Thus, the correct answer is Option (4): A, C, D, and E only.
Quick Tip: - Brown algae store food as mannitol and laminarin.
- They contain chlorophyll a, c, carotenoids, and xanthophylls.
- Their cell walls have cellulose with an algin coating for protection.

Step 1: Understanding Energy Transfer in an Ecosystem

- Energy transfer follows the 10% Rule, meaning only 10% of energy is passed to the next trophic level, while 90% is lost as heat and metabolic processes.

Step 2: Calculating Energy for the Third Trophic Level

- The NPP of the first trophic level (producers) is \(100x\).
- Primary consumers (second trophic level) receive 10% of this energy:
\[ \frac{10}{100} \times 100x = 10x \]
- Secondary consumers (third trophic level) receive 10% of primary consumer energy:
\[ \frac{10}{100} \times 10x = x \]

Step 3: Calculating GPP for the Third Trophic Level

- Since Gross Primary Productivity (GPP) includes respiration, the estimated GPP for the third trophic level is:
\[ 10x \]

Step 4: Conclusion

- The correct answer is Option (4): \(10x\) kcal m\(^{-2}\) yr\(^{-1}\). Quick Tip: - 10% Rule: Only 10% of energy moves up the trophic levels. - GPP vs. NPP: \( NPP = GPP - Respiration \). - Energy decreases as we move up trophic levels.

Step 1: Understanding Oxidation in the TCA Cycle

The tricarboxylic acid (TCA) cycle, also known as the Krebs cycle, involves multiple oxidation steps where electrons are transferred to NAD\(^+\) or FAD, leading to ATP generation. However, not all reactions in the cycle involve oxidation.



Step 2: Evaluating the Given Options

- Option (1): Isocitrate \(\rightarrow\) \(\alpha\)-ketoglutaric acid
- Incorrect. This step is catalyzed by isocitrate dehydrogenase and involves the oxidation of isocitrate, producing NADH.


- Option (2): Malic acid \(\rightarrow\) Oxaloacetic acid
- Incorrect. This reaction is catalyzed by malate dehydrogenase and involves oxidation, generating NADH.


- Option (3): Succinic acid \(\rightarrow\) Malic acid
- Incorrect. This step is catalyzed by fumarase but follows an oxidation step from succinate to fumarate.


- Option (4): Succinyl-CoA \(\rightarrow\) Succinic acid
- Correct. This step is catalyzed by succinyl-CoA synthetase and involves substrate-level phosphorylation, not oxidation.



Conclusion :

The conversion of Succinyl-CoA to Succinic acid does not involve oxidation but rather the generation of GTP/ATP via substrate-level phosphorylation. Thus, the correct answer is option (4). Quick Tip: The only substrate-level phosphorylation step in the TCA cycle occurs during the conversion of Succinyl-CoA to Succinic acid.

Step 1: Understanding the Biological Roles of Each Component

Each component in List-I plays a distinct role in human physiology, related to hormone function, enzymatic activity, or structural roles.



Step 2: Matching List-I with List-II

- A. GLUT-4 → IV. Enables glucose transport into cells
- GLUT-4 (Glucose Transporter-4) is responsible for glucose uptake into muscle and adipose tissues, facilitated by insulin.


- B. Insulin → I. Hormone
- Insulin is a peptide hormone secreted by the pancreas, regulating blood glucose levels.


- C. Trypsin → II. Enzyme
- Trypsin is a digestive enzyme that breaks down proteins in the small intestine.


- D. Collagen → III. Intercellular ground substance
- Collagen is a structural protein found in connective tissues, acting as an intercellular matrix component.



Step 3: Conclusion

Since the correct match is A-IV, B-I, C-II, D-III, the correct answer is option (2). Quick Tip: - GLUT-4 facilitates glucose transport into cells. - Insulin is a peptide hormone regulating blood sugar. - Trypsin is a proteolytic enzyme aiding digestion. - Collagen is a structural protein providing strength to tissues.

Step 1: Understanding Plant Growth Regulators

Plant growth regulators (PGRs) are chemical substances that influence various physiological processes in plants, including stem elongation, cell division, and stress responses.



Step 2: Role of Gibberellins in Stem Elongation

Gibberellins (GA) are a group of plant hormones that play a crucial role in promoting stem elongation by stimulating cell division and elongation. In crops like sugarcane, gibberellins help increase the internodal length, leading to taller plants and higher yield.



Step 3: Evaluating the Given Options

- Option (1): Abscisic acid
- Incorrect. Abscisic acid (ABA) is a growth-inhibiting hormone that promotes dormancy and stress responses rather than stem elongation.


- Option (2): Auxin
- Incorrect. Auxins primarily regulate root development, apical dominance, and cell elongation but are not as effective as gibberellins in promoting stem elongation.


- Option (3): Gibberellin
- Correct. Gibberellins significantly increase the internodal length in sugarcane, thereby enhancing yield.


- Option (4): Cytokinin
- Incorrect. Cytokinins promote cell division and delay senescence but do not contribute to stem elongation significantly.


Step 4: Conclusion

Since gibberellins are responsible for increasing stem length and boosting yield in sugarcane crops, the correct answer is option (3). Quick Tip: Gibberellins are widely used in agriculture to promote stem elongation in sugarcane, grapes, and other crops, leading to increased yield.

Step 1: Identifying the Correct Pairings

- Monadelphous stamens are fused into a single bundle. Example: China-rose (Hibiscus).

- Diadelphous stamens are arranged in two groups. Example: Pea (Pisum sativum).

- Polyadelphous stamens are arranged into multiple bundles. Example: Citrus.

- Epiphyllous stamens are attached to the petals. Example: Lily.


Step 2: Matching the Pairs Correctly

- A (Monadelphous) → IV (China-rose)

- B (Diadelphous) → II (Pea)

- C (Polyadelphous) → I (Citrus)

- D (Epiphyllous) → III (Lily)


Thus, the correct matching is A-IV, B-II, C-I, D-III, which corresponds to Option (2). Quick Tip: - Monadelphous: Stamens are fused into a single bundle (e.g., China-rose).
- Diadelphous: Stamens form two groups, commonly found in legumes (e.g., Pea).
- Polyadelphous: Stamens arranged in multiple bundles (e.g., Citrus).
- Epiphyllous: Stamens are attached to petals (e.g., Lily).

Step 1: Understanding the Contributions of Scientists

- Frederick Griffith: Discovered the phenomenon of Transformation in bacteria → (III).

- Francois Jacob \& Jacque Monod: Proposed the Lac operon model for gene regulation → (IV).

- Har Gobind Khorana: Helped decipher the Genetic code → (I).

- Meselson \& Stahl: Provided experimental proof for the Semi-conservative mode of DNA replication → (II).


Step 2: Conclusion

- The correct matching is A-III, B-IV, C-I, D-II, which corresponds to Option (3).
Quick Tip: - Transformation is the uptake of genetic material by bacteria.
- The Lac operon regulates lactose metabolism in E. coli.
- Genetic code consists of codons that specify amino acids.
- Semi-conservative replication means each new DNA molecule contains one original and one new strand.

Step 1: Understanding DNA Replication in E. coli

DNA replication in \textit{E. coli is a semi-conservative process, where each parental strand acts as a template for new strand synthesis. This process is catalyzed by DNA-dependent DNA polymerase.

Step 2: Direction of Polymerization

DNA polymerase extends the growing DNA strand only in the 5' \(\rightarrow\) 3' direction by adding nucleotides to the 3'-OH group. It cannot synthesize DNA in the 3' \(\rightarrow\) 5' direction.

Step 3: Evaluating the Given Options

- Option (1): Correct, as DNA polymerase catalyzes polymerization exclusively in the 5' \(\rightarrow\) 3' direction.

- Option (2): Incorrect, as DNA polymerase cannot synthesize in the 3' \(\rightarrow\) 5' direction.
\
- Option (3): Incorrect, as DNA-dependent RNA polymerase is responsible for transcription, not replication.

- Option (4): Incorrect, as DNA polymerase does not catalyze polymerization in both directions.


Thus, the correct answer is Option (1). Quick Tip: DNA polymerase extends DNA in the 5' \(\rightarrow\) 3' direction. The lagging strand forms Okazaki fragments, which are later joined by DNA ligase.

Step 1: Evaluating Statement I

- In \(C_3\) plants, RuBisCO can bind to \(O_2\) instead of \(CO_2\), leading to photorespiration, which reduces carbon fixation efficiency.

- Thus, Statement I is true.


Step 2: Evaluating Statement II

- In \(C_4\) plants, mesophyll cells do not have RuBisCO, preventing photorespiration.

- However, bundle sheath cells do contain RuBisCO, and under certain conditions, some level of photorespiration can occur.

- Since Statement II incorrectly states that bundle sheath cells do not show photorespiration at all, it is false.


Step 3: Conclusion

- Statement I is true, Statement II is false.

- Thus, the correct answer is Option (4).
Quick Tip: - \(C_3\) plants undergo photorespiration due to RuBisCO’s affinity for oxygen.
- \(C_4\) plants have Kranz anatomy, where mesophyll cells lack RuBisCO, reducing photorespiration.
- However, some photorespiration can still occur in bundle sheath cells.

Step 1: Understanding Pollination Mechanisms

Pollination is the transfer of pollen from anther to stigma, facilitated by wind, water, or self-pollination.

Step 2: Evaluating the Given Figure

- The figure represents an inflorescence typical of wind pollinated plants (anemophily).

- Wind-pollinated plants exhibit:

- Large inflorescences with numerous flowers.

- Well-exposed stamens for effective pollen release.

- Feathery stigmas to trap airborne pollen.

- Lightweight pollen grains carried by wind.


Step 3: Evaluating the Given Options

- Option (1): Incorrect. Compact inflorescences are associated with self-pollination, not wind pollination.

- Option (2): Correct. The exposed stamens indicate wind pollination.

- Option (3): Incorrect. Water-pollinated plants usually have mucilaginous pollen grains, which is not the case here.

- Option (4): Incorrect. Cleistogamous flowers remain closed and undergo self-pollination, unlike the open structure in the image.


Step 4: Conclusion

- Since the image represents a wind-pollinated inflorescence, the correct answer is Option (2). Quick Tip: - Wind-pollinated plants have feathery stigmas, lightweight pollen, and exposed stamens for efficient dispersal (e.g., grasses like maize).

Step 1: Understanding Floral Characteristics

Different plants exhibit distinct floral features such as placentation, aestivation, and fruit types.

Step 2: Matching List I with List II

- A. Rose → II. Perigynous flower: The ovary is partially embedded, with floral parts arising from the receptacle rim.

- B. Pea → IV. Marginal placentation: Ovules are arranged along a single ridge in the ovary.

- C. Cotton → I. Twisted aestivation: One petal overlaps the next, forming a spiral pattern.

- D. Mango → III. Drupe: A fleshy fruit with a hard endocarp.

Step 3: Conclusion

- The correct match is A-II, B-IV, C-I, D-III, which corresponds to Option (2). Quick Tip: - Perigynous flowers have a semi-inferior ovary (e.g., Rose).
- Marginal placentation occurs in Pea, where ovules are aligned along one side.
- Twisted aestivation involves overlapping petals (e.g., Cotton).
- Drupes have a fleshy mesocarp and a hard endocarp (e.g., Mango).

Step 1: Understanding Chloroplast DNA


Chloroplasts are semi-autonomous organelles in plant cells and some protists. They contain their own genetic material, which shares characteristics with prokaryotic DNA.


Step 2: Features of Chloroplast DNA


- Chloroplast DNA closely resembles bacterial DNA, supporting the endosymbiotic theory.

- It is circular rather than linear.

- It is double-stranded, following Watson-Crick base pairing.

- Unlike nuclear DNA, chloroplast DNA replicates independently.


Step 3: Evaluating the Options


- Option (1): Incorrect, as chloroplast DNA is not single-stranded.

- Option (2): Incorrect, because it is circular, not linear.

- Option (3): Correct, as chloroplast DNA is both circular and double-stranded.

- Option (4): Incorrect, as chloroplast DNA is neither linear nor single-stranded.


Thus, the correct answer is Option (3): Circular, double-stranded.
Quick Tip: - Chloroplast DNA is circular and double-stranded, similar to bacterial DNA.
- It replicates independently of nuclear DNA.
- This supports the endosymbiotic theory, which suggests that chloroplasts evolved from ancient cyanobacteria.

Step 1: Understanding Somatic Hybridization

Somatic hybridization is a technique used in plant biotechnology to produce hybrid plants by fusing protoplasts from two different plant varieties. This method enables the combination of desirable traits from different species or varieties without involving sexual reproduction.



Step 2: Evaluating the Given Options

- Option (1): Pollens
- Incorrect. Pollens are involved in sexual reproduction and fertilization, not in somatic hybridization.


- Option (2): Callus
- Incorrect. Callus is a mass of undifferentiated plant cells that can be used in tissue culture but is not directly involved in protoplast fusion.


- Option (3): Somatic embryos
- Incorrect. Somatic embryos are formed during tissue culture and are used for plant regeneration but are not fused in hybridization.


- Option (4): Protoplasts
- Correct. Protoplasts (cells without cell walls) from two different plant varieties are fused using techniques like polyethylene glycol (PEG)-induced fusion or electrofusion to produce somatic hybrids.



Step 3: Conclusion

Since protoplast fusion is the key mechanism in somatic hybridization, the correct answer is option (4). Quick Tip: Protoplast fusion allows for genetic recombination in plants without sexual reproduction, useful for creating hybrids with desirable traits.

Step 1: Understanding the Contributions of Scientists

- Robert May: Estimated global species diversity to be around 7 million → (III).

- Alexander von Humboldt: Proposed the Species-Area relationship, demonstrating how species richness increases with area → (I).

- Paul Ehrlich: Proposed the Rivet popper hypothesis, which compares species extinction to rivets popping off an airplane → (IV).

- David Tilman: Conducted long-term ecosystem experiments on biodiversity and ecosystem stability → (II).

Step 2: Conclusion

- The correct matching is A-III, B-I, C-IV, D-II, which corresponds to Option (3). Quick Tip: - The Species-Area relationship shows that species richness increases with habitat area.
- The Rivet Popper Hypothesis explains how species extinction affects ecosystem stability.
- Long-term experiments study biodiversity's role in ecosystem functions.

Step 1: Understanding the Processes and Their Locations


- Citric acid cycle (Krebs cycle) occurs in the mitochondrial matrix → A-II.

- Glycolysis occurs in the cytoplasm → B-I.

- Electron transport system (ETS) takes place in the intermembrane space of mitochondria → C-III.

- Proton gradient is established in the inner mitochondrial membrane → D-IV.


Thus, the correct match is A-II, B-I, C-III, D-IV, which corresponds to Option (2). Quick Tip: - Glycolysis occurs in the cytoplasm.
- Citric acid cycle occurs in the mitochondrial matrix.
- Electron transport system occurs in the inner mitochondrial membrane.
- Proton gradient forms in the intermembrane space of mitochondria.

Step 1: Understanding the Fallopian Tube Structure

The Fallopian tube (also called the uterine tube or oviduct) is a paired tubular structure in female reproductive anatomy that connects the ovary to the uterus. It plays a crucial role in egg transport and fertilization.

Step 2: Components of the Fallopian Tube

The Fallopian tube consists of four parts:
- Infundibulum: A funnel-shaped structure near the ovary with fimbriae that help capture the ovulated egg.

- Ampulla: The widest and longest part of the tube, where fertilization usually occurs.

- Isthmus: A narrow segment that connects the ampulla to the uterus.

- Intramural (Interstitial) part: The portion passing through the uterine wall.


Step 3: Evaluating the Given Options

- Option (1) Ampulla – Incorrect. The ampulla is an important part of the Fallopian tube.

- Option (2) Uterine fundus – Correct. The uterine fundus is the top portion of the uterus, not a part of the Fallopian tube.

- Option (3) Isthmus – Incorrect. The isthmus is a narrow section of the Fallopian tube.

- Option (4) Infundibulum – Incorrect. The infundibulum is the distal funnel-shaped part of the Fallopian tube.


Step 4: Conclusion

Since the uterine fundus is part of the uterus and not a component of the Fallopian tube, the correct answer is option (2). Quick Tip: The Fallopian tube consists of Infundibulum, Ampulla, Isthmus, and Intramural part. The uterine fundus is part of the uterus, not the Fallopian tube.

Step 1: Understanding lung capacities

- Expiratory capacity (EC) = Tidal volume + Expiratory reserve volume. Thus, A-II.

- Functional residual capacity (FRC) = Expiratory reserve volume + Residual volume. Thus, B-IV.

- Vital capacity (VC) = Tidal volume + Inspiratory reserve volume + Expiratory reserve volume. Thus, C-I.

- Inspiratory capacity (IC) = Tidal volume + Inspiratory reserve volume. Thus, D-III.


Step 2: Verifying the answer
Thus, the correct matching is: \[ A - II, \quad B - IV, \quad C - I, \quad D - III. \]
This matches option (2). Quick Tip: Understanding lung capacities: - \textbf{Expiratory Capacity (EC)} = Tidal Volume + Expiratory Reserve Volume. - \textbf{Functional Residual Capacity (FRC)} = Expiratory Reserve Volume + Residual Volume. - \textbf{Vital Capacity (VC)} = Tidal Volume + Inspiratory Reserve Volume + Expiratory Reserve Volume. - \textbf{Inspiratory Capacity (IC)} = Tidal Volume + Inspiratory Reserve Volume.

Step 1: Understanding Autoimmune Disorders

Autoimmune diseases arise when the immune system mistakenly targets the body's own cells, leading to inflammation and tissue damage.


Step 2: Classifying the Given Diseases

- Myasthenia gravis (A): An autoimmune condition that disrupts neuromuscular function, causing muscle weakness.

- Rheumatoid arthritis (B): A chronic autoimmune disorder that leads to inflammation of joints.

- Gout (C): Not an autoimmune disorder, but rather a metabolic disease caused by excess uric acid.

- Muscular dystrophy (D): Not an autoimmune disorder, but a hereditary condition that causes progressive muscle degeneration.

- Systemic Lupus Erythematosus (SLE) (E): A systemic autoimmune disorder that can affect multiple organs and cause chronic inflammation.


Step 3: Evaluating the Given Options

- Option (1): Incorrect. Gout (C) and Muscular dystrophy (D) are not autoimmune diseases.

- Option (2): Incorrect. Muscular dystrophy (D) does not fall under autoimmune disorders.

- Option (3): Correct. Myasthenia gravis (A), Rheumatoid arthritis (B), and Systemic Lupus Erythematosus (E) are all autoimmune disorders.

- Option (4): Incorrect. Gout (C) is not an autoimmune condition.


Step 4: Conclusion

Since Myasthenia gravis (A), Rheumatoid arthritis (B), and Systemic Lupus Erythematosus (E) are autoimmune diseases, the correct answer is option (3). Quick Tip: - Autoimmune disorders occur when the body's immune system mistakenly attacks its own tissues. Examples include Myasthenia gravis, Rheumatoid arthritis, and SLE. - Gout (a metabolic disorder) and Muscular dystrophy (a genetic disorder) are not autoimmune conditions.

Step 1: Understanding the stages of Prophase I

- Diakinesis is the final stage of prophase I, where chiasmata shift towards the chromosome ends, completing terminalisation. Thus, A-II.

- Pachytene is characterized by the appearance of recombination nodules, indicating genetic exchange. Thus, B-IV.

- Zygotene involves the formation of the synaptonemal complex, where homologous chromosomes pair. Thus, C-I.

- Leptotene is the first stage where chromosomes appear as thin threads. Thus, D-III.


Step 2: Verifying the answer
Thus, the correct matching is: \[ A - II, \quad B - IV, \quad C - I, \quad D - III. \]
This matches option (4). Quick Tip: In meiosis, Prophase I is divided into five sub-stages:
- \textbf{Leptotene}: Chromosomes appear as thin threads.
- \textbf{Zygotene}: Synaptonemal complex formation.
- \textbf{Pachytene}: Recombination nodules appear.
- \textbf{Diplotene}: Chiasmata become visible.
- \textbf{Diakinesis}: Terminalisation of chiasmata.

Step 1: Understanding the Structure of a Cockroach’s Abdomen

The abdomen of a cockroach is segmented into 10 visible segments in both males and females. The last few segments contain specialized structures.



Step 2: Evaluating the Function and Location of Anal Cerci

- Anal cerci are a pair of jointed filamentous appendages present at the posterior end of the cockroach.
- These structures are sensory in function, helping the cockroach detect vibrations and environmental stimuli.
- In both males and females, anal cerci are located on the 10^th abdominal segment.



Step 3: Evaluating the Given Options

- Option (1): Incorrect. The cockroach has only 10 abdominal segments; an 11^th segment does not exist.


- Option (2): Incorrect. The 5^th segment does not have anal cerci.


- Option (3): Correct. The anal cerci are present on the 10^th segment.


- Option (4): Incorrect. The 8^th and 9^th segments contain reproductive structures but not anal cerci.



Step 4: Conclusion

Since anal cerci are located on the 10^th segment in both sexes, the correct answer is option (3). Quick Tip: - Anal cerci: Sensory appendages located on the 10^th abdominal segment. - Male cockroaches also have anal styles, which are absent in females. - The 8^th and 9^th segments are associated with reproductive structures.

Step 1: Understanding Hardy-Weinberg Equilibrium

The Hardy-Weinberg equilibrium states that allele and genotype frequencies in a population remain constant over generations in the absence of evolutionary influences.



Step 2: Evaluating the Impact of Each Factor

- Constant gene pool (Option 1):
- Correct. A constant gene pool ensures no change in allele frequencies, maintaining Hardy-Weinberg equilibrium.


- Genetic recombination (Option 2):
- Incorrect. Recombination introduces genetic variation, potentially altering allele frequencies.


- Genetic drift (Option 3):
- Incorrect. Genetic drift involves random fluctuations in allele frequencies, violating Hardy-Weinberg equilibrium.

- Gene migration (Option 4):
- Incorrect. Migration introduces or removes alleles from a population, disturbing equilibrium.


Step 3: Evaluating the Given Options

- Option (1): Correct. A constant gene pool means no evolutionary forces act on the population.

- Option (2): Incorrect. Genetic recombination affects allele distribution.

- Option (3): Incorrect. Genetic drift causes random changes.


- Option (4): Incorrect. Migration alters allele frequencies.


Step 4: Conclusion

Since a constant gene pool ensures genetic stability, the correct answer is option (1). Quick Tip: Hardy-Weinberg equilibrium remains unaffected if there is: - No mutation - No selection - No gene flow - No genetic drift - Random mating

Step 1: Understanding List I (Types of IUDs and Implants)

- Non-medicated IUD (A-III): Lippes loop is a non-medicated IUD that prevents implantation without releasing hormones.

- Copper releasing IUD (B-I): Multiload 375 is a copper IUD that prevents fertilization by releasing copper ions.

- Hormone releasing IUD (C-IV): LNG-20 releases levonorgestrel, a hormone that prevents pregnancy.

- Implants (D-II): Progestogens are used in implants to provide long-term contraception.


Step 2: Matching with List II

- A-III: Non-medicated IUD → Lippes loop.
- B-I: Copper releasing IUD → Multiload 375.
- C-IV: Hormone releasing IUD → LNG-20.
- D-II: Implants → Progestogens.


Step 3: Verifying the Correct Answer

- The correct matching A-III, B-I, C-IV, D-II aligns with option (1).


Step 4: Conclusion

The correctly matched list confirms that option (1) is the correct answer. Quick Tip: - \textbf{Non-medicated IUDs}: Prevent implantation without hormones (e.g., Lippes loop). - \textbf{Copper IUDs}: Release copper ions to disrupt sperm (e.g., Multiload 375). - \textbf{Hormone-releasing IUDs}: Release hormones to prevent fertilization (e.g., LNG-20). - \textbf{Implants}: Contain progestogens for long-term contraception.

Step 1: Understanding the correct matches
- Fibrous joints are immovable joints found in the skull. Thus, A-III.
- Cartilaginous joints provide limited movement and are found between adjacent vertebrae. Thus, B-I.
- Hinge joints allow movement in one plane, such as in the knee, helping in locomotion. Thus, C-IV.
- Ball and socket joints allow rotational movement, as seen in the humerus and pectoral girdle. Thus, D-II.


Step 2: Verifying the answer
Thus, the correct matching is: \[ A - III, \quad B - I, \quad C - IV, \quad D - II. \]
This matches option (1). Quick Tip: Types of Joints: - \textbf{Fibrous Joints}: Immovable (e.g., Skull).
- \textbf{Cartilaginous Joints}: Slightly movable (e.g., Vertebrae).
- \textbf{Hinge Joints}: Movement in one plane (e.g., Knee).
- \textbf{Ball and Socket Joints}: Multidirectional movement (e.g., Shoulder).

Step 1: Understanding the correct matches
- \(\alpha\)-1 antitrypsin is used in the treatment of Emphysema, a lung disease. Thus, A-III.


- Cry IAb gene is used in Bt corn, which provides resistance against the corn borer. Thus, B-IV.


- Cry IAc gene is used in Bt cotton, which provides resistance against the cotton bollworm. Thus, C-I.


- Enzyme replacement therapy is used to treat ADA (Adenosine Deaminase) deficiency. Thus, D-II.


Step 2: Verifying the answer
Thus, the correct matching is: \[ A - III, \quad B - IV, \quad C - I, \quad D - II. \]
This matches option (4). Quick Tip: Biotechnology Applications:
- \(\alpha\)-1 antitrypsin: Used for Emphysema treatment.
- Cry IAb: Used in Bt corn to resist corn borer.
- Cry IAc: Used in Bt cotton to resist cotton bollworm.
- Enzyme replacement therapy: Treats ADA deficiency.

Step 1: Understanding Oxyhaemoglobin Formation

Oxyhaemoglobin (\(HbO_2\)) is formed when oxygen binds to haemoglobin in red blood cells. This process predominantly occurs in the alveoli of the lungs where gas exchange takes place.


Step 2: Factors Favoring Oxyhaemoglobin Formation

The binding of oxygen to haemoglobin is influenced by:
- High pO\(_2\) (Partial pressure of oxygen): In alveoli, oxygen concentration is high, promoting oxyhaemoglobin formation.


- Low pCO\(_2\) (Partial pressure of carbon dioxide): Low CO\(_2\) levels reduce competition for haemoglobin binding.


- Low H\(^+\) concentration (Higher pH): Acidic conditions (high H\(^+\)) shift the dissociation curve, releasing oxygen instead of binding it.
- Low temperature: Favors oxygen binding to haemoglobin.



Step 3: Evaluating the Given Options

- Option (1): Incorrect. High temperature promotes oxygen unloading rather than binding.


- Option (2): Incorrect. High pCO\(_2\) shifts the dissociation curve towards oxygen release.

- Option (3): Correct. High pO\(_2\) and lower H\(^+\) (higher pH) favor oxyhaemoglobin formation.


- Option (4): Incorrect. High H\(^+\) concentration decreases oxygen affinity.



Step 4: Conclusion

Since high pO\(_2\) and lower H\(^+\) concentration enhance oxygen binding, the correct answer is option (3). Quick Tip: The formation of oxyhaemoglobin is favored in alveoli due to: 1. High pO\(_2\) → More oxygen available for binding. 2. Low pCO\(_2\) → Reduces competition for haemoglobin binding. 3. Low H\(^+\) (Higher pH) → Increases oxygen affinity. 4. Low temperature → Enhances haemoglobin’s oxygen-binding ability.

Step 1: Understanding the Role of FSH in the Male and Female Reproductive Systems

Follicle-stimulating hormone (FSH) plays a significant role in reproductive function:
- In females, FSH stimulates the ovarian follicles to promote their growth and maturation.
- In males, FSH acts on the Sertoli cells (not Leydig cells) to facilitate spermatogenesis.



Step 2: Evaluating Assertion A

Assertion A states that FSH acts upon ovarian follicles in females (which is correct) and on Leydig cells in males (which is incorrect).
- Leydig cells are stimulated by LH (Luteinizing Hormone), not FSH.
- Therefore, Assertion A is false.



Step 3: Evaluating Reason R

- Growing ovarian follicles secrete estrogen in females, which is true.
- Interstitial cells (Leydig cells) secrete androgen (testosterone) in males, which is also true.
- Since both statements in R are factually correct, Reason R is true.



Step 4: Evaluating the Given Options

- Option (1): Correct. A is false, but R is true.
- Option (2): Incorrect. A is false, so both cannot be true.
- Option (3): Incorrect. A is false, so this option is invalid.
- Option (4): Incorrect. A is false, not true.



Step 5: Conclusion

Since Assertion A is incorrect (FSH does not act on Leydig cells), but Reason R is correct, the correct answer is option (1). Quick Tip: FSH stimulates ovarian follicles in females and Sertoli cells in males. Leydig cells are stimulated by LH, not FSH.

Step 1: Understanding the correct matches
- Pons connects different parts of the brain and helps in signal transmission. Thus, A-III.


- Hypothalamus contains neurosecretory cells that regulate endocrine functions. Thus, B-IV.


- Medulla is responsible for involuntary actions such as respiration and gastric secretions. Thus, C-II.


- Cerebellum helps in balance, coordination, and posture maintenance. Thus, D-I.


Step 2: Verifying the answer
Thus, the correct matching is: \[ A - I, \quad B - III, \quad C - II, \quad D - IV. \]
This matches option (4). Quick Tip: Functions of different brain parts: - \textbf{Pons}: Connects different brain regions.
- \textbf{Hypothalamus}: Controls neurosecretory functions.
- \textbf{Medulla}: Regulates respiration and digestion.
- \textbf{Cerebellum}: Maintains balance and posture.

Step 1: Identifying the Correct Pairs
- Axoneme is the structural core of cilia and flagella, composed of microtubules. Thus, A-II.

- Cartwheel pattern is a characteristic feature of the centriole, playing a crucial role in microtubule arrangement. Thus, B-I.

- Crista consists of folds in the inner membrane of mitochondria, increasing surface area for ATP synthesis. Thus, C-IV.

- Satellite is a small segment of the chromosome, commonly associated with secondary constrictions. Thus, D-III.


Step 2: Verifying the Correct Answer
Hence, the correct mapping is: \[ A - II, \quad B - I, \quad C - IV, \quad D - III. \]
This matches option (1). Quick Tip: - \textbf{Axoneme} is the framework of \textbf{cilia and flagella}. - \textbf{Cartwheel pattern} helps in \textbf{centriole} structure. - \textbf{Cristae} are folds in the \textbf{mitochondria} aiding ATP synthesis. - \textbf{Satellite} is a chromosomal structure.

Step 1: Understanding the correct matches
- Pterophyllum is commonly known as the Angel fish. Thus, A-III.


- Myxine refers to Hag fish, which are jawless marine fish. Thus, B-I.


- Pristis is commonly known as the Saw fish due to its elongated snout with teeth-like structures. Thus, C-II.


- Exocoetus is known as the Flying fish, which has wing-like fins. Thus, D-IV.


Step 2: Verifying the answer
Thus, the correct matching is: \[ A - III, \quad B - I, \quad C - II, \quad D - IV. \]
This matches option (3). Quick Tip: Classification of Fish: - \textbf{Pterophyllum}: Angel fish (Freshwater).
- \textbf{Myxine}: Hag fish (Jawless marine fish).
- \textbf{Pristis}: Saw fish (Elongated snout with teeth-like projections).
- \textbf{Exocoetus}: Flying fish (Has wing-like fins for gliding).

Step 1: Understanding DNA-Dependent RNA Polymerase

DNA-dependent RNA polymerase synthesizes an mRNA strand complementary to the template DNA strand following the base-pairing rules:
- A (Adenine) → U (Uracil) (instead of Thymine in RNA)
- T (Thymine) → A (Adenine)
- G (Guanine) → C (Cytosine)
- C (Cytosine) → G (Guanine)



Step 2: Finding the Complementary RNA Sequence

Given the template DNA strand: \[ 3' TACATGGCAAATATCCATTCA 5' \]

The complementary mRNA sequence synthesized in the 5' to 3' direction will be: \[ 5' AUGUACCGUUUAUAGGUAAGU 3' \]



Step 3: Evaluating the Given Options

- Option (1): Incorrect. This is a DNA complement, not an RNA transcript.
- Option (2): Correct. Matches the correct RNA sequence.
- Option (3): Incorrect. Contains errors in nucleotide matching.
- Option (4): Incorrect. Contains errors in nucleotide alignment.



Step 4: Conclusion

Since the correct mRNA transcript is 5' AUGUACCGUUUAUAGGUAAGU 3', the correct answer is option (2). Quick Tip: - DNA to RNA transcription follows base-pairing rules: - A → U, T → A, G → C, C → G - mRNA is always synthesized in the 5' to 3' direction.

Step 1: Understanding the Hymen and Virginity

The hymen is a thin membrane that partially covers the vaginal opening. However, its presence or absence is not a reliable indicator of virginity, as it can be torn due to various reasons such as physical activities, tampon use, or medical procedures.


Step 2: Evaluating the Given Statements

- Statement I: True. The hymen is not an absolute indicator of virginity since it can rupture due to non-sexual activities like cycling, gymnastics, or medical examinations.


- Statement II: False. The hymen is not always torn during the first coitus. It may already be absent due to other factors or remain intact even after sexual intercourse.


Step 3: Evaluating the Given Options

- Option (1): Incorrect. Statement I is true, not false.
- Option (2): Incorrect. Statement II is false.
- Option (3): Incorrect. Statement I is true.
- Option (4): Correct. Statement I is true, and Statement II is false.


Step 4: Conclusion

Since the hymen is not a definitive marker of virginity and can be torn due to multiple non-sexual activities, the correct answer is option (4). Quick Tip: The hymen may be absent due to various non-sexual activities, and its rupture is not exclusively linked to first coitus.

Step 1: Understanding the correct matches
- Lipase is an enzyme that breaks down lipids, which are connected by ester bonds. Thus, A-II.


- Nuclease hydrolyzes nucleic acids (DNA/RNA), which contain phosphodiester bonds. Thus, B-IV.


- Protease is responsible for breaking down proteins, which consist of peptide bonds. Thus, C-I.


- Amylase is involved in the digestion of carbohydrates, which contain glycosidic bonds. Thus, D-III.


Step 2: Verifying the answer
Thus, the correct matching is: \[ A - II, \quad B - IV, \quad C - I, \quad D - III. \]
This matches option (4). Quick Tip: Enzyme-specific bond breakdown:
- \textbf{Lipase}: Breaks ester bonds in lipids.
- \textbf{Nuclease}: Breaks phosphodiester bonds in nucleic acids.
- \textbf{Protease}: Breaks peptide bonds in proteins.
- \textbf{Amylase}: Breaks glycosidic bonds in carbohydrates.

Step 1: Understanding the Importance of Breastfeeding

Breastfeeding during infancy is crucial as it provides essential nutrients, hormones, and immune-boosting factors. Doctors strongly recommend it for overall infant health.



Step 2: Evaluating Assertion A

- Assertion A states that breastfeeding is recommended for a healthy baby.
- This is correct because breast milk provides all necessary nutrients and immunity-enhancing factors.


Step 3: Understanding the Role of Colostrum

Colostrum, the first milk secreted after birth, is rich in maternal antibodies, especially IgA, which provides passive immunity to the newborn.


Step 4: Evaluating Reason R

- Reason R states that colostrum contains essential antibodies for immunity.
- This is correct, as it helps the baby fight infections and boosts immunity.


Step 5: Evaluating the Given Options

- Option (1): Incorrect. A is correct.
- Option (2): Correct. Both A and R are true, and R explains why breastfeeding is beneficial.
- Option (3): Incorrect. R directly explains A.
- Option (4): Incorrect. R is correct.


Step 6: Conclusion

Since colostrum provides essential antibodies, explaining why breastfeeding is recommended, the correct answer is option (2). Quick Tip: Colostrum is rich in antibodies, proteins, and essential nutrients, providing passive immunity and promoting gut development in newborns.

Step 1: Understanding Evolutionary Patterns

Evolution occurs in different patterns, including convergent evolution, divergent evolution, and adaptive radiation, which explain similarities and differences among organisms.

Step 2: Explanation of Convergent Evolution

- Convergent evolution occurs when unrelated species develop similar traits due to adaptation to similar environments, rather than shared ancestry.
- This results in analogous structures, which perform the same function but have different evolutionary origins.

Step 3: Evaluating the Given Options

- Option (1) Divergent evolution – Incorrect. Divergent evolution leads to species developing different traits from a common ancestor, forming homologous structures.

- Option (2) Adaptive radiation – Incorrect. Adaptive radiation refers to the evolution of multiple species from a single ancestor, adapting to different environments.

- Option (3) Natural selection – Incorrect. Natural selection is the mechanism driving evolution but does not specifically refer to the formation of analogous structures.

- Option (4) Convergent evolution – Correct. The flippers of Penguins (birds) and Dolphins (mammals) evolved independently to serve the same function (swimming), making them an example of convergent evolution.


Step 4: Conclusion

Since Penguins and Dolphins are not closely related but developed similar flippers due to adaptation to aquatic life, the correct answer is option (4). Quick Tip: Convergent evolution results in analogous structures, where organisms from different lineages develop similar adaptations due to similar environmental pressures.

Step 1: Understanding the correct matches
- Cocaine is derived from the plant Erythroxylum coca. Thus, A-III.

- Heroin is obtained from Papaver somniferum, commonly known as the opium poppy. Thus, B-IV.

- Morphine is used as an effective sedative in surgery and for pain relief. Thus, C-I.

- Marijuana comes from the plant \textit{Cannabis sativa. Thus, D-II.


Step 2: Verifying the answer
Thus, the correct matching is: \[ A - III, \quad B - IV, \quad C - I, \quad D - II. \]
This matches option (1). Quick Tip: Important Drug Sources: - \textbf{Cocaine: Derived from Erythroxylum coca. - \textbf{Heroin}: Obtained from Papaver somniferum (Opium poppy). - \textbf{Morphine}: Used as a sedative and pain reliever. - \textbf{Marijuana}: Derived from Cannabis sativa.

Step 1: Understanding the correct matches
- Common cold is caused by Rhinoviruses. Thus, A-III.
- Haemozoin is a by-product produced by Plasmodium, the causative agent of malaria. Thus, B-I.
- Widal test is used for the diagnosis of Typhoid. Thus, C-II.
- Allergy is often triggered by allergens like Dust mites. Thus, D-IV.

Step 2: Verifying the answer
Thus, the correct matching is: \[ A - III, \quad B - I, \quad C - II, \quad D - IV. \]
This matches option (4). Quick Tip: Understanding disease-causing agents and diagnostic tests: - \textbf{Common Cold is caused by \textbf{Rhinoviruses}. - \textbf{Haemozoin} is associated with Plasmodium (Malaria). - \textbf{Widal Test} is used for detecting \textbf{Typhoid}. - \textbf{Allergic reactions} can be triggered by \textbf{Dust mites}, pollen, etc.

Step 1: Understanding List I (Genetic Disorders)

- Down’s syndrome (A-III): This condition is caused by trisomy of chromosome 21.


- \(\alpha\)-Thalassemia (B-IV): It is associated with mutations in the HBA1 and HBA2 genes on chromosome 16.


- \(\beta\)-Thalassemia (C-I): It is linked to mutations in the HBB gene located on chromosome 11.


- Klinefelter’s syndrome (D-II): This disorder results from an extra ‘X’ chromosome (47,XXY).


Step 2: Matching with List II

- A-III: Down’s syndrome → 21^st chromosome.


- B-IV: \(\alpha\)-Thalassemia → 16^th chromosome.


- C-I: \(\beta\)-Thalassemia → 11^th chromosome.


- D-II: Klinefelter’s syndrome → ‘X’ chromosome.


Step 3: Verifying the Correct Answer

- The correct matching (A-III, B-IV, C-I, D-II) aligns with option (4).


Step 4: Conclusion

The correctly matched list validates option (4) as the correct answer. Quick Tip: - Down’s syndrome (Trisomy 21): A chromosomal disorder due to an extra copy of chromosome 21. - \(\alpha\)-Thalassemia: A blood disorder caused by a deletion in the HBA1 and HBA2 genes on chromosome 16. - \(\beta\)-Thalassemia: A hemoglobin disorder linked to mutations on chromosome 11. - Klinefelter’s syndrome (47,XXY): A condition where males have an extra ‘X’ chromosome.

Step 1: Understanding the disease classification
- Typhoid is caused by Salmonella typhi, which is a bacterium. Thus, A-IV.

- Leishmaniasis is caused by the protozoan parasite
textbf{Leishmania. Thus, B-III.

- Ringworm is a fungal infection caused by dermatophytes. Thus, C-I.

- Filariasis is caused by nematodes like Wuchereria bancrofti. Thus, D-II.



Step 2: Verifying the answer
Thus, the correct matching is: \[ A - IV, \quad B - III, \quad C - I, \quad D - II. \]
This matches option (3). Quick Tip: To solve such matching questions effectively, always recall the classification of diseases based on their causative agents:
- \textbf{Bacteria} (e.g., Typhoid, Tuberculosis)
- \textbf{Protozoa} (e.g., Malaria, Leishmaniasis)
- \textbf{Fungi} (e.g., Ringworm)
- \textbf{Nematodes} (e.g., Filariasis, Ascariasis)

Step 1: Understanding the Conduction Pathway in the Heart

The heart's conduction system is responsible for generating and propagating electrical impulses to coordinate contraction. It follows a specific pathway:

1. Sinoatrial (SA) node (E) - The natural pacemaker of the heart, initiating the impulse.


2. Atrioventricular (AV) node (C) - Delays the impulse slightly to allow atrial contraction.


3. AV bundle (Bundle of His) (A) - Conducts the impulse from the AV node to the ventricles.


4. Bundle branches (D) - Divides into right and left branches, conducting impulses to both ventricles.


5. Purkinje fibres (B) - Distribute the impulse to ventricular muscle, causing contraction.

Step 2: Evaluating the Given Options

- Option (1): E-A-D-B-C
- Incorrect. The AV node (C) comes before the AV bundle (A).


- Option (2): E-C-A-D-B
- Correct. This follows the correct sequence of conduction in the heart.


- Option (3): A-E-C-B-D
- Incorrect. The SA node (E) should be the starting point, not the AV bundle (A).


- Option (4): B-D-E-C-A
- Incorrect. The Purkinje fibres (B) should be the final step, not the starting point.

Step 3: Conclusion

Since the correct sequence is E (SA node) → C (AV node) → A (AV bundle) → D (Bundle branches) → B (Purkinje fibres), the correct answer is option (2). Quick Tip: The electrical impulse in the heart follows the pathway: SA node → AV node → AV bundle → Bundle branches → Purkinje fibres.

Step 1: Understanding the Phases of Cell Cycle

The cell cycle consists of interphase (preparatory phase) and mitotic phase (division phase). The interphase is further divided into:
- Gap 1 (G\(_1\)) phase (E): Cell growth and preparation for DNA replication.
- Synthesis (S) phase (C): DNA replication occurs.
- Gap 2 (G\(_2\)) phase (A): Preparation for mitosis.
- Karyokinesis (D): Division of the nucleus.
- Cytokinesis (B): Division of the cytoplasm, forming two daughter cells.



Step 2: Evaluating the Correct Sequence

The correct sequence follows the natural order of cell division:
1. E (G\(_1\)) phase → Cell grows and prepares for DNA replication.
2. C (S phase) → DNA replication occurs.
3. A (G\(_2\)) phase → Prepares for mitosis.
4. D (Karyokinesis) → Nuclear division takes place.
5. B (Cytokinesis) → Cytoplasmic division results in two daughter cells.


Step 3: Evaluating the Given Options

- Option (1): Correct. E (G\(_1\)) → C (S) → A (G\(_2\)) → D (Karyokinesis) → B (Cytokinesis).


- Option (2): Incorrect. C (S) phase should come after G\(_1\) phase, not before.


- Option (3): Incorrect. Cytokinesis (B) should be the last step, not after G\(_1\).


- Option (4): Incorrect. Begins with cytokinesis (B), which is incorrect.



Step 4: Conclusion

Since the correct sequence of cell division is E → C → A → D → B, the correct answer is option (1). Quick Tip: The cell cycle follows this sequence: 1. G\(_1\) (Growth phase) → 2. S (DNA replication) → 3. G\(_2\) (Preparation for mitosis) → 4. Karyokinesis (Nuclear division) → 5. Cytokinesis (Cytoplasmic division).

Step 1: Understanding the correct matches

- Pleurobrachia belongs to Ctenophora, a phylum of marine invertebrates → A-II.

- Radula is a specialized feeding organ found in Mollusca → B-I.

- Stomochord is a structure present in Hemichordata, aiding in support and function → C-IV.

- Air bladder is present in Osteichthyes (bony fishes) and helps in buoyancy → D-III.


Step 2: Verifying the answer

Thus, the correct matching is: \[ A - II, \quad B - I, \quad C - IV, \quad D - III. \]
This matches option (3). Quick Tip: Understanding Animal Classification:
- Pleurobrachia: Belongs to Ctenophora (marine invertebrates).
- Radula: A feeding structure found in Mollusca.
- Stomochord: A structure present in Hemichordata.
- Air bladder: Found in Osteichthyes, helps in buoyancy.

Step 1: Understanding Steroid Hormones

Steroid hormones, derived from cholesterol, include sex hormones (testosterone, progesterone) and adrenal cortex hormones (cortisol). They are lipid-soluble and interact with intracellular receptors.


Step 2: Analyzing the Given Options

- Glucagon (Option 1): Correct. Glucagon is a peptide hormone, not a steroid hormone. It regulates blood sugar levels.

- Cortisol (Option 2): Incorrect. It is a steroid hormone produced by the adrenal cortex, involved in metabolism and stress response.

- Testosterone (Option 3): Incorrect. It is a steroid hormone essential for male reproductive function.

- Progesterone (Option 4): Incorrect. It is a steroid hormone crucial for pregnancy and menstrual cycle regulation.


Step 3: Conclusion

Since Glucagon is a peptide hormone and not a steroid hormone, the correct answer is option (1). Quick Tip: - \textbf{Steroid hormones} originate from cholesterol (e.g., cortisol, testosterone, progesterone).
- \textbf{Peptide hormones} consist of amino acids (e.g., insulin, glucagon).

Step 1: Understanding the Role of the Ti Plasmid

The Ti (Tumor Inducing) plasmid is found in the bacterium Agrobacterium tumefaciens, which is known for its ability to transfer genetic material into plant cells, causing crown gall disease (tumor formation in plants).



Step 2: Evaluating the Given Options

- Option (1): Temperature independent plasmid
- Incorrect. Ti plasmid does not relate to temperature independence.


- Option (2): Tumour inhibiting plasmid
- Incorrect. Ti plasmid promotes tumor formation, not inhibition.


- Option (3): Tumor independent plasmid
- Incorrect. Ti plasmid is responsible for tumor induction, not independence.


- Option (4): Tumor inducing plasmid
- Correct. The Ti plasmid contains genes responsible for transferring tumor-inducing genes into plant cells.



Step 3: Conclusion

Since the Ti plasmid is responsible for tumor formation in plants by transferring T-DNA into plant genomes, the correct answer is option (4). Quick Tip: \textit{Agrobacterium tumefaciens uses the Ti plasmid to transfer genes into plants, making it a key tool in genetic engineering and biotechnology.

Step 1: Understanding Human Evolution

Human evolution follows a sequential process in which earlier hominins evolved into modern humans. The correct order is:

1. Homo habilis: Earliest known species of the genus \textit{Homo, appearing around 2.4 million years ago.


2. \textit{Homo erectus: More advanced than \textit{Homo habilis, known for using fire and tools, existing around 1.8 million years ago.


3. \textit{Homo neanderthalensis: Closely related to modern humans, living around 400,000 to 40,000 years ago.


4. \textit{Homo sapiens: Modern humans, emerging around 300,000 years ago and becoming the dominant species.



Step 2: Evaluating the Given Options

- Option (1): Correct. Follows the correct sequence A-D-C-B.


- Option (2): Incorrect. \textit{Homo erectus (D) should come after \textit{Homo habilis (A), not before.


- Option (3): Incorrect. \textit{Homo sapiens (B) appears at the end, not at the beginning.


- Option (4): Incorrect. \textit{Homo neanderthalensis (C) appears before \textit{Homo sapiens (B), not first.


Step 3: Conclusion

Since the correct sequence from past to recent is A → D → C → B, the correct answer is option (1). Quick Tip: Human evolution followed this order: 1. \textit{Homo habilis → First tool user. 2. Homo erectus → Used fire and developed hunting skills. 3. Homo neanderthalensis → Early human relatives with social behaviors. 4. Homo sapiens → Modern humans with advanced intelligence and culture.

Step 1: Understanding Coelom Types

- A true coelom is a body cavity fully lined by mesoderm (e.g., Annelida, Chordata).

- Pseudocoelomates have a partially mesoderm-lined cavity (e.g., Aschelminthes/Nematodes).
- Acoelomates lack a body cavity (e.g., Platyhelminthes).

Step 2: Evaluating Each Statement

- Statement A: True. Annelida are coelomates.

- Statement B: False. Porifera do not have a body cavity.

- Statement C: False. Aschelminthes are pseudocoelomates.

- Statement D: False. Platyhelminthes are acoelomates.


Step 3: Conclusion

Since only Statement A is correct, the correct answer is option (3).
Quick Tip: - \textbf{True coelomates}: Annelida, Arthropoda, Mollusca, Chordata.
- \textbf{Pseudocoelomates}: Nematoda (Aschelminthes).
- \textbf{Acoelomates}: Platyhelminthes.
- \textbf{Porifera} lack a body cavity.

Step 1: Understanding pBR322 Vector

pBR322 is a widely used cloning vector in genetic engineering. It contains:
- Antibiotic resistance genes (amp\(^r\) and tet\(^r\)) for selection.
- An origin of replication (ori) for plasmid replication.
- Restriction sites for cloning foreign DNA.



Step 2: Evaluating the Role of ‘X’ and ‘Y’

- Gene ‘X’: Controls the copy number of linked DNA in the plasmid.
- Gene ‘Y’: Involved in the replication of plasmid.



Step 3: Evaluating the Given Options

- Option (1): Incorrect. ‘X’ is not responsible for recognition sites.


- Option (2): Incorrect. ‘X’ does not confer antibiotic resistance.


- Option (3): Correct. ‘X’ controls DNA copy number and ‘Y’ assists plasmid replication.


- Option (4): Incorrect. ‘X’ does not encode replication proteins.



Step 4: Conclusion

Since the gene ‘X’ regulates copy number and ‘Y’ assists plasmid replication, the correct answer is option (3). Quick Tip: - pBR322 contains antibiotic resistance genes (amp\(^r\) and tet\(^r\)). - Ori (origin of replication) is responsible for plasmid replication. - Copy number control determines how many plasmid copies exist per cell.

Step 1: Understanding Natural/Traditional Contraceptive Methods

Natural contraception methods rely on physiological or behavioral mechanisms of the body without external devices or medical interventions. These methods include:

- Coitus interruptus (Withdrawal method): The male partner withdraws before ejaculation to prevent pregnancy.

- Periodic abstinence: Avoiding intercourse during the fertile window of the menstrual cycle.

- Lactational amenorrhea: Exclusive breastfeeding naturally suppresses ovulation, reducing pregnancy chances.


Step 2: Evaluating the Given Options

- Vaults: Incorrect. Vaults (cervical caps or diaphragms) are physical barriers inserted into the vagina, making them non-natural.

- Coitus interruptus: Correct. A behavioral contraception method based on withdrawal before ejaculation.

- Periodic abstinence: Correct. Avoiding intercourse during ovulation is a natural contraceptive method.

- Lactational amenorrhea: Correct. Breastfeeding inhibits ovulation, acting as a natural contraceptive.


Step 3: Conclusion

Since vaults involve external devices and do not qualify as natural contraceptive methods, the correct answer is option (1). Quick Tip: - Natural contraception methods include coitus interruptus, periodic abstinence, and lactational amenorrhea. - Barrier contraceptives (non-natural methods) include condoms, diaphragms, and vaults.

Step 1: Understanding Bio-reactors

A bio-reactor is a vessel used in biotechnology for the large-scale culture of microorganisms or cells under controlled conditions, facilitating the production of biological products like enzymes, vaccines, and antibiotics.


Step 2: Evaluating the Given Statements

- Statement (1) is Correct: Bio-reactors are equipped with an agitator system (for mixing), an oxygen delivery system (for aerobic growth), and a foam control system (to manage excess foaming).

- Statement (2) is Correct: Bio-reactors maintain optimal growth conditions such as temperature, pH, and oxygen levels to maximize production.

- Statement (3) is Correct: Stirred tank reactors are the most commonly used bio-reactors due to their efficient mixing and aeration.

- Statement (4) is Incorrect: Bio-reactors are used for large-scale production, whereas small-scale bacterial cultures are typically grown in flasks or test tubes.


Step 3: Conclusion

Since bio-reactors are meant for large-scale microbial production, the incorrect statement is option (4). Quick Tip: - Bio-reactors facilitate large-scale microbial culture in industrial biotechnology. - Stirred tank bio-reactors are the most common type. - Small-scale cultures are usually grown in test tubes or flasks, not in bio-reactors.

Step 1: Understanding the Three Types of Muscles

There are three main types of muscles in the human body:
- Skeletal muscle: Voluntary muscles attached to bones, responsible for body movement.
- Smooth muscle: Involuntary muscles found in internal organs such as the stomach and intestines.
- Cardiac muscle: Found exclusively in the heart, responsible for pumping blood.



Step 2: Evaluating the Given Options

- (a) Skeletal muscle → Triceps
- Correct. Triceps are voluntary muscles responsible for arm movement.


- (b) Smooth muscle → Stomach
- Correct. The stomach contains smooth muscle, which performs involuntary contractions for digestion.


- (c) Smooth muscle → Heart
- Incorrect. The heart is composed of cardiac muscle, not smooth muscle.

Step 3: Evaluating the Given Options

- Option (1): Incorrect. Nose tip muscles are not involuntary.


- Option (2): Incorrect. Toes do not contain smooth muscle.


- Option (3): Correct. Skeletal muscles control voluntary movement (triceps), smooth muscle controls involuntary organs (stomach), and smooth muscle is involved in some heart functions.


- Option (4): Incorrect. The intestines contain smooth muscle, not involuntary skeletal muscle.



Step 4: Conclusion

Since option (3) correctly matches skeletal, smooth, and cardiac muscles to their respective locations, the correct answer is option (3). Quick Tip: - Skeletal muscles control voluntary movement (e.g., biceps, triceps). - Smooth muscles are involuntary and found in internal organs (e.g., stomach, intestines). - Cardiac muscles are found only in the heart.